DOCSLIB.ORG

MAFB Determines Human Macrophage Anti-Inflammatory

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MAFB Determines Human Macrophage Anti-Inflammatory MAFB Determines Human Macrophage Anti-Inflammatory Polarization: Relevance for the Pathogenic Mechanisms Operating in Multicentric Carpotarsal Osteolysis This information is current as of September 25, 2021. Víctor D. Cuevas, Laura Anta, Rafael Samaniego, Emmanuel Orta-Zavalza, Juan Vladimir de la Rosa, Geneviève Baujat, Ángeles Domínguez-Soto, Paloma Sánchez-Mateos, María M. Escribese, Antonio Castrillo, Valérie Cormier-Daire, Miguel A. Vega and Ángel L. Corbí Downloaded from J Immunol published online 16 January 2017 http://www.jimmunol.org/content/early/2017/01/15/jimmun ol.1601667 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2017/01/15/jimmunol.160166 Material 7.DCSupplemental Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published January 16, 2017, doi:10.4049/jimmunol.1601667 The Journal of Immunology MAFB Determines Human Macrophage Anti-Inflammatory Polarization: Relevance for the Pathogenic Mechanisms Operating in Multicentric Carpotarsal Osteolysis Vı´ctor D. Cuevas,* Laura Anta,† Rafael Samaniego,‡ Emmanuel Orta-Zavalza,* Juan Vladimir de la Rosa,x Genevie`ve Baujat,{,‖ A´ ngeles Domı´nguez-Soto,* Paloma Sa´nchez-Mateos,‡ Marı´a M. Escribese,# Antonio Castrillo,x Vale´rie Cormier-Daire,{,‖ Miguel A. Vega,* and A´ ngel L. Corbı´* Macrophage phenotypic and functional heterogeneity derives from tissue-specific transcriptional signatures shaped by the local micro- environment. Most studies addressing the molecular basis for macrophage heterogeneity have focused on murine cells, whereas the factors Downloaded from controlling the functional specialization of human macrophages are less known. M-CSF drives the generation of human monocyte-derived macrophages with a potent anti-inflammatory activity upon stimulation. We now report that knockdown of MAFB impairs the acquisition of the anti-inflammatory profile of human macrophages, identify the MAFB-dependent gene signature in human macrophages and il- lustrate the coexpression of MAFB and MAFB-target genes in CD163+ tissue-resident and tumor-associated macrophages. The con- tribution of MAFB to the homeostatic/anti-inflammatory macrophage profile is further supported by the skewed polarization of monocyte-derived macrophages from multicentric carpotarsal osteolysis (Online Mendelian Inheritance in Man #166300), a pathology http://www.jimmunol.org/ caused by mutations in the MAFB gene. Our results demonstrate that MAFB critically determines the acquisition of the anti- inflammatory transcriptional and functional profiles of human macrophages. The Journal of Immunology, 2017, 198: 000–000. acrophage heterogeneity derives from the existence of bition of tumor cell growth and production of LPS-induced cy- tissue-specific factors that control macrophage differ- tokines (7, 14). Specifically, GM-CSF primes macrophages M entiation and functional maturation. M-CSF and IL-34 (GM-MØ) to gain immunogenic activity and to produce inflam- control macrophage differentiation in most tissues (1, 2), whereas matory cytokines upon TLR stimulation, whereas M-CSF primes GM-CSF drives the generation of alveolar macrophages (3). Cir- macrophages (M-MØ) with tissue repair and proangiogenic culating monocytes are recruited to damaged tissues under in- functions, and with potent TLR-induced IL-10–producing ability by guest on September 25, 2021 flammatory conditions (4) and acquire specialized functions (7, 15). Accordingly, human GM-MØ and M-MØ are considered (macrophage polarization) under the influence of extracellular as proinflammatory and anti-inflammatory macrophages (6, 16). cues (5). The macrophage sensitivity to the surrounding milieu is MAFB is a transcription factor of the large MAF subfamily exemplified by the ability of GM-CSF and M-CSF to induce the (MAFA, cMAF, MAFB, NRL) that binds to a specific DNA acquisition of distinct effector functions (6, 7). Previous studies element (MARE); heterodimerizes with cMAF, JUN, and FOS have demonstrated that GM-CSF–primed macrophages (GM-MØ) (17–19); and associates and functionally inhibits MYB (19), and M-CSF–primed macrophages (M-MØ) exhibit distinct cellu- MITF, and NFATc1 (20). MAFB controls lens development (21), lar phenotypes (8–11), a distinct metabolic state (12, 13), and lymphangiogenesis (22), pancreatic a and b cell differentiation (23, display opposite effector functions like activin A–mediated inhi- 24), skin cell differentiation (25), chondrocyte matrix formation and *Laboratorio de Ce´lulas Mieloides, Centro de Investigaciones Biolo´gicas, Consejo Grant S2010/BMD-2350 (to A´ .L.C. and A.C.), and a Formacio´ndePersonalInves- Superior de Investigaciones Cientı´ficas, 28040 Madrid, Spain; †Servicio de Cirugı´a tigador predoctoral fellowship from MINECO through Grant BES-2012-053864 Ortope´dica y Traumatologı´a, Complejo Hospitalario de Santiago de Compostela, (to V.D.C.). 15706 Santiago de Compostela, Spain; ‡Laboratorio de Inmuno-Oncologı´a, Unidad V.D.C., L.A., M.M.E., A.C., M.A.V., and A´ .L.C. designed the research; V.D.C., L.A., de Microscopı´a Confocal, Instituto de Investigacio´n Sanitaria Gregorio Maran˜o´n, x R.S., E.O.-Z., J.V.d.l.R., G.B., A´ .D.-S., P.S.-M., and V.C.-D. performed experiments, 28007 Madrid, Spain; Instituto de Investigaciones Biomedicas Alberto Sols, Consejo { recruited patients, and analyzed data; V.D.C. and A´ .L.C. wrote the manuscript. Superior de Investigaciones Cientı´ficas, 28029 Madrid, Spain; Unidad de Biomedi- cina, Instituto de Investigaciones Biome´dicas–Universidad de Las Palmas de Gran The sequences presented in this article have been submitted to Gene Expression Canaria (ULPGC), Instituto Universitario de Investigaciones Biomedicas y Sanitarias Omnibus under accession number GSE84622. de la ULPGC, 35001 Las Palmas, Spain; ‖De´partement de Ge´ne´tique, INSERM Address correspondence and reprint requests to Dr. A´ ngel L. Corbı´ and Dr. Miguel A. U781, Universite´ Paris Descartes-Sorbonne Paris Cite´, Institut Imagine, Hoˆpital Vega, Centro de Investigaciones Biolo´gicas, Consejo Superior de Investigaciones Necker Enfants Malades, 75015 Paris, France; and #Institute for Applied Molecular Cientı´ficas, Calle Ramiro de Maeztu 9, 28040 Madrid, Spain. E-mail addresses: Medicine, School of Medicine, University CEU San Pablo, Madrid, Spain [email protected] (A´ .L.C.) and [email protected] (M.A.V.) ORCIDs: 0000-0002-2816-8070 (V.D.C.); 0000-0002-4196-5218 (L.A.); 0000-0002- The online version of this article contains supplemental material. 3081-7332 (R.S.); 0000-0003-1443-7548 (J.V.d.l.R.); 0000-0003-1980-5733 (A´ .L.C.). Abbreviations used in this article: GM-MØ, GM-CSF–primed macrophages; GSEA, Received for publication September 26, 2016. Accepted for publication December gene set enrichment analysis; MARE, MAF recognition element; MCTO, multicen- 16, 2016. tric carpotarsal osteolysis; M-MØ, M-CSF–primed macrophages; RANKL, receptor This work was supported by Ministerio de Economı´a y Competitividad (MINECO) activator for NF-kB ligand; siControl, small interfering RNA control; siMAFB, Grant SAF2014-52423-R and Instituto de Salud Carlos III Red de Investigacio´n MAFB-specific small interfering RNA; TRAP, tartrate-resistant acid phosphatase. en Enfermedades Reuma´ticas Grant RIER RD12/009 (to A´ .L.C. and M.A.V.), MINECO Grant SAF2014-56819-R (to A.C.), Comunidad Auto´noma de Madrid/ Copyright Ó 2017 by The American Association of Immunologists, Inc. 0022-1767/17/$30.00 Fonds Europe´en de De´veloppement E´ conomique et Re´gional RAPHYME Program www.jimmunol.org/cgi/doi/10.4049/jimmunol.1601667 2 MAFB-DIRECTED MACROPHAGE ANTI-INFLAMMATORY POLARIZATION development (26), and podocyte generation (27–30), and also reg- that were provided by M. Palomero (Oncology Department, Hospital Gen- ulates type I IFN production through recruitment of coactivators to eral Universitario Gregorio Maran˜o´n). Macrophage supernatants were IFN regulatory factor 3 (31). Within the murine myeloid lineage, assayed for the presence of cytokines using commercial ELISA kits for CCL2 (BD Biosciences) and IL-10 (BioLegend), according to the proto- MafB is preferentially expressed in most tissue-resident macro- cols supplied by the manufacturers. Mouse bone marrow–derived macro- phages, whose specific enhancers contain an overrepresentation of phages were generated using human M-CSF (10 ng/ml; ImmunoTools). All MARE sequences (32). MAFB restricts the ability of M-CSF to animal procedures were approved by the Comite´ E´ tico de Experimentacio´n instruct myeloid cell proliferation, promotes macrophage differen- Animal (Ethical Committee for Animal Experimentation) of the Consejo Superior de Investigaciones Cientı´ficas and conducted in accordance with tiation (33) through repression of self-renewal
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Metallothionein Monoclonal Antibody, Clone N11-G
    Metallothionein monoclonal antibody, clone N11-G Catalog # : MAB9787 規格 : [ 50 uL ] List All Specification Application Image Product Rabbit monoclonal antibody raised against synthetic peptide of MT1A, Western Blot (Recombinant protein) Description: MT1B, MT1E, MT1F, MT1G, MT1H, MT1IP, MT1L, MT1M, MT2A. Immunogen: A synthetic peptide corresponding to N-terminus of human MT1A, MT1B, MT1E, MT1F, MT1G, MT1H, MT1IP, MT1L, MT1M, MT2A. Host: Rabbit enlarge Reactivity: Human, Mouse Immunoprecipitation Form: Liquid Enzyme-linked Immunoabsorbent Assay Recommend Western Blot (1:1000) Usage: ELISA (1:5000-1:10000) The optimal working dilution should be determined by the end user. Storage Buffer: In 20 mM Tris-HCl, pH 8.0 (10 mg/mL BSA, 0.05% sodium azide) Storage Store at -20°C. Instruction: Note: This product contains sodium azide: a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only. Datasheet: Download Applications Western Blot (Recombinant protein) Western blot analysis of recombinant Metallothionein protein with Metallothionein monoclonal antibody, clone N11-G (Cat # MAB9787). Lane 1: 1 ug. Lane 2: 3 ug. Lane 3: 5 ug. Immunoprecipitation Enzyme-linked Immunoabsorbent Assay ASSP5 MT1A MT1B MT1E MT1F MT1G MT1H MT1M MT1L MT1IP Page 1 of 5 2021/6/2 Gene Information Entrez GeneID: 4489 Protein P04731 (Gene ID : 4489);P07438 (Gene ID : 4490);P04732 (Gene ID : Accession#: 4493);P04733 (Gene ID : 4494);P13640 (Gene ID : 4495);P80294 (Gene ID : 4496);P80295 (Gene ID : 4496);Q8N339 (Gene ID : 4499);Q86YX0 (Gene ID : 4490);Q86YX5
    [Show full text]
  • The Expression of the Human Apolipoprotein Genes and Their Regulation by Ppars
    CORE Metadata, citation and similar papers at core.ac.uk Provided by UEF Electronic Publications The expression of the human apolipoprotein genes and their regulation by PPARs Juuso Uski M.Sc. Thesis Biochemistry Department of Biosciences University of Kuopio June 2008 Abstract The expression of the human apolipoprotein genes and their regulation by PPARs. UNIVERSITY OF KUOPIO, the Faculty of Natural and Environmental Sciences, Curriculum of Biochemistry USKI Juuso Oskari Thesis for Master of Science degree Supervisors Prof. Carsten Carlberg, Ph.D. Merja Heinäniemi, Ph.D. June 2008 Keywords: nuclear receptors; peroxisome proliferator-activated receptor; PPAR response element; apolipoprotein; lipid metabolism; high density lipoprotein; low density lipoprotein. Lipids are any fat-soluble, naturally-occurring molecules and one of their main biological functions is energy storage. Lipoproteins carry hydrophobic lipids in the water and salt-based blood environment for processing and energy supply in liver and other organs. In this study, the genomic area around the apolipoprotein genes was scanned in silico for PPAR response elements (PPREs) using the in vitro data-based computer program. Several new putative REs were found in surroundings of multiple lipoprotein genes. The responsiveness of those apolipoprotein genes to the PPAR ligands GW501516, rosiglitazone and GW7647 in the HepG2, HEK293 and THP-1 cell lines were tested with real-time PCR. The APOA1, APOA2, APOB, APOD, APOE, APOF, APOL1, APOL3, APOL5 and APOL6 genes were found to be regulated by PPARs in direct or secondary manners. Those results provide new insights in the understanding of lipid metabolism and so many lifestyle diseases like atherosclerosis, type 2 diabetes, heart disease and stroke.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name epithelial membrane protein 2 Gene Symbol Emp2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.21730 Ensembl Gene ID ENSRNOG00000002664 Entrez Gene ID 360468 Assay Information Unique Assay ID qRnoCIP0024746 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000003615 Amplicon Context Sequence CCTGCTGCCTTCGCTGCCCTGTGAACATGTTGGTGATTCTTGCCTTCATCATCGT CTTCCACATCGTGTCTACGGCACTCTTGTTCATTTCAACCATTGACAATGCCTGG TGGGTAGGAGATGGCTTCTCAGCT Amplicon Length (bp) 104 Chromosome Location 10:4276703-4281842 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9989 cDNA Cq 20.98 cDNA Tm (Celsius) 82.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Emp2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Bioluminescent Properties of Semi-Synthetic Obelin and Aequorin Activated by Coelenterazine Analogues with Modifications of C-2, C-6, and C-8 Substituents
    International Journal of Molecular Sciences Article Bioluminescent Properties of Semi-Synthetic Obelin and Aequorin Activated by Coelenterazine Analogues with Modifications of C-2, C-6, and C-8 Substituents 1, 2,3, 1 2, Elena V. Eremeeva y , Tianyu Jiang y , Natalia P. Malikova , Minyong Li * and Eugene S. Vysotski 1,* 1 Photobiology Laboratory, Institute of Biophysics SB RAS, Federal Research Center “Krasnoyarsk Science Center SB RAS”, Krasnoyarsk 660036, Russia; [email protected] (E.V.E.); [email protected] (N.P.M.) 2 Key Laboratory of Chemical Biology (MOE), Department of Medicinal Chemistry, School of Pharmaceutical Sciences, Shandong University, Jinan 250012, China; [email protected] 3 State Key Laboratory of Microbial Technology, Shandong University–Helmholtz Institute of Biotechnology, Shandong University, Qingdao 266237, China * Correspondence: [email protected] (M.L.); [email protected] (E.S.V.); Tel.: +86-531-8838-2076 (M.L.); +7-(391)-249-44-30 (E.S.V.); Fax: +86-531-8838-2076 (M.L.); +7-(391)-290-54-90 (E.S.V.) These authors contributed equally to this work. y Received: 23 June 2020; Accepted: 27 July 2020; Published: 30 July 2020 Abstract: Ca2+-regulated photoproteins responsible for bioluminescence of a variety of marine organisms are single-chain globular proteins within the inner cavity of which the oxygenated coelenterazine, 2-hydroperoxycoelenterazine, is tightly bound. Alongside with native coelenterazine, photoproteins can also use its synthetic analogues as substrates to produce flash-type bioluminescence. However, information on the effect of modifications of various groups of coelenterazine and amino acid environment of the protein active site on the bioluminescent properties of the corresponding semi-synthetic photoproteins is fragmentary and often controversial.
    [Show full text]
  • Hyperactivated Wnt-Β-Catenin Signaling in the Absence of Sfrp1 and Sfrp5 Disrupts Trophoblast Differentiation Through Repressio
    Bao et al. BMC Biology (2020) 18:151 https://doi.org/10.1186/s12915-020-00883-4 RESEARCH ARTICLE Open Access Hyperactivated Wnt-β-catenin signaling in the absence of sFRP1 and sFRP5 disrupts trophoblast differentiation through repression of Ascl2 Haili Bao1,2,3†, Dong Liu2†, Yingchun Xu2, Yang Sun2, Change Mu2, Yongqin Yu2, Chunping Wang2, Qian Han2, Sanmei Liu2, Han Cai1,2, Fan Liu2, Shuangbo Kong1,2, Wenbo Deng1,2, Bin Cao1,2, Haibin Wang1,2*, Qiang Wang3,4* and Jinhua Lu1,2* Abstract Background: Wnt signaling is a critical determinant for the maintenance and differentiation of stem/progenitor cells, including trophoblast stem cells during placental development. Hyperactivation of Wnt signaling has been shown to be associated with human trophoblast diseases. However, little is known about the impact and underlying mechanisms of excessive Wnt signaling during placental trophoblast development. Results: In the present work, we observed that two inhibitors of Wnt signaling, secreted frizzled-related proteins 1 and 5 (Sfrp1 and Sfrp5), are highly expressed in the extraembryonic trophoblast suggesting possible roles in early placental development. Sfrp1 and Sfrp5 double knockout mice exhibited disturbed trophoblast differentiation in the placental ectoplacental cone (EPC), which contains the precursors of trophoblast giant cells (TGCs) and spongiotrophoblast cells. In addition, we employed mouse models expressing a truncated β-catenin with exon 3 deletion globally and trophoblast-specifically, as well as trophoblast stem cell lines, and unraveled that hyperactivation of canonical Wnt pathway exhausted the trophoblast precursor cells in the EPC, resulting in the overabundance of giant cells at the expense of spongiotrophoblast cells.
    [Show full text]
  • Discovery and Protein Engineering of Baeyer-Villiger Monooxygenases
    Discovery and Protein Engineering of Baeyer-Villiger monooxygenases Inauguraldissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Ernst-Moritz-Arndt-Universität Greifswald vorgelegt von Andy Beier geboren am 11.10.1988 in Parchim Greifswald, den 02.08.2017 I Dekan: Prof. Dr. Werner Weitschies 1. Gutachter: Prof. Dr. Uwe T. Bornscheuer 2. Gutachter: Prof. Dr. Marko Mihovilovic Tag der Promotion: 24.10.2017 II We need to learn to want what we have, not to have what we want, in order to get stable and steady happiness. - The Dalai Lama - III List of abbreviations % Percent MPS Methyl phenyl sulfide % (v/v) % volume per volume MPSO Methyl phenyl sulfoxide % (w/v) % weight per volume MPSO2 Methyl phenyl sulfone °C Degrees Celsius MTS Methyl p-tolyl sulfide µM µmol/L MTSO Methyl p-tolyl sulfoxide aa Amino acids MTSO2 Methyl p-tolyl sulfone + AGE Agarose gel electrophoresis NAD Nicotinamide adenine dinucleotide, oxidized aq. dest. Distilled water NADH Nicotinamide adenine dinucleotide, reduced + BLAST Basic Local Alignment Search NADP Nicotinamide adenine dinucleotide Tool phosphate, oxidized bp Base pair(s) NADPH Nicotinamide adenine dinucleotide phosphate, reduced BVMO Baeyer-Villiger monooxyge- OD600 Optical density at 600 nm nase CHMO Cyclohexanone monooxyge- PAGE Polyacrylamide gel electrophoresis nase Da Dalton PAMO Phenylacetone monooxygenase DMF Dimethyl formamide PCR Polymerase chain reaction DMSO Dimethyl sulfoxide PDB Protein Data Bank DMSO2 Dimethyl sulfone rpm Revolutions per minute DNA Desoxyribonucleic acid rv Reverse dNTP Desoxynucleoside triphosphate SDS Sodium dodecyl sulfate E. coli Escherichia coli SOC Super Optimal broth with Catabolite repression ee Enantiomeric excess TAE TRIS-Acetate-EDTA FAD Flavin adenine dinucleotide TB Terrific broth Fig.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]