Isolation and molecular characterization of a gene from Drosophila melanogaster encoding a predicted Rho guanine nucleotide exchange factor
Item Type text; Dissertation-Reproduction (electronic)
Authors Werner, Lisa Anne, 1958-
Publisher The University of Arizona.
Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.
Download date 30/09/2021 09:01:22
Link to Item http://hdl.handle.net/10150/282483 INFORMATION TO USERS
This manuscript has been reproduced from the microfihn master. UMI fihns the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistina print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely afreet reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing m this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Information Company 300 North Zeeb Road, Ann Aibor MI 48106-1346 USA 313/761-4700 800/521-0600 I ISOLATION AND MOLECULAR CHARACTERIZATION OF A GENE FROM DROSOPHILA MELANOGASTER ENCODING A PREDICTED RHO GUANINE NUCLEOTIDE EXCHANGE FACTOR
by
Lisa Anne Werner
A Dissertation Submitted to the Faculty of the
DEPARTMENT OF MOLECULAR AND CELLULAR BIOLOGY
In Partial Falfillment of the Requirements For the Degree of
DOCTOR OF PHILOSOPHY
In the Graduate College
THE UNIVERSITY OF ARIZONA
19 9 7 UMX Number: 9814358
UMI Microform 9814358 Copyright 1998, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 THE UNIVERSITY OF ARIZONA ® GRADUATE COLLEGE
As members of the Final Examination Committeet we certify that we have
read the dissertation prepared fay Lisa Anne Werner
entitled ISOLATION AND MOLECULAR CHARACTERIZATION OF A GENE FROM
DROSOPHILA MELANOGASTER ENCODING A PREDICTED RHO GUANINE
NUCLEOTIDE EXCHANGE FACTOR
and recommend that it be accepted as fulfilling the dissertation
requirement for the Degree of Doctor of Philosophy
leau Date. ///2s/^ J- Date
1)1^4hi David Mount Date
Date
Date
Final approval and acceptance of this dissertation is contingent upon the candidate's submission of the final copy of the dissertation to the Graduate College.
I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.
^ J ^ 2-/^/ f f- Diss:fer tat ion/ Director Lynn Manseau Date
i r i 3
STATEMENT BY AUTHOR
This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at The University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.
Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his or her judgment the proposed use of the material is in the interests of scholarship. In all other instances, however, permission must be obtained from the author.
SIGNED: 4
ACKNOWLEDGMENTS
I am very grateful to a number of people who provided me with the guidance and support that enabled me to complete this work. I would like to thank my dissertation advisor, Lynn Manseau, for giving me the opportunity to do this research, and for helping me to develop as a scientist. I especially appreciate the enthusiasm and passion that she had for my projects. I would like to thank the other members of my committee, Danny Brower, Carol Dieckmann, Roger Miesfeld. and David Mount for their advice and encouragement over the years. My friend, Leona Mukai, has helped me tremendously with the completion of this dissertation and its submission to the graduate college. I accepted a lecturer position with the University of Maryland in Korea before defending my dissertation. Leona did all the leg work and more to distribute my dissertation to my committee, schedule my defense and submit my dissertation to the graduate college. That was a hell of a lot of work! Very special thanks to you Leona. there is no way that I could have finished graduate school without you. The Manseau Lab was a very exciting and fun place to do research. Again, thank you Lynn for creating such a synergistic environment. I am indebted to John Calley for patiently sharing his computer expertise with me on many, many occasions. John's wife, Cindy, and daughter Amelia drove me to the hospital in the wee hours of the morning when 1 had an attack of appendicitis. Steve Emmons conducted work to show that DrtGEF was not spire. Anne LaPorte assisted me with a portion of the chromosomal walk. Wenliang Chen, Huy Phan, Brian James, Lin Hollis, Andrea Wellington and the other members of the Manseau lab were also super to work with. The fifth floor, as well as some of the lower echelons of the Life Sciences South building was populated by a number of individuals who brightened my life. Thank you to my friends Tanya Sandrock, Dave Lydall, Chris Byrd, Rachel Hughes, Julie Mustard, Robin Staples, Chunhong Mao, Tracy Futch. Mike Graner, and Marc Brabant, as well as non-Life Science South people Herman Gordon and Anne Pollack for interesting discussions on science and philosophy, hikes and outdoors fun. parlour games such as poker, and your ability to get silly. I would like to thank Thomas Lindell, Marty Hewlett and Vas Aposhian for allowing me to be a Teaching Assistant for their courses and encouraging and supporting my growth as a teacher. You have helped guide me to a profession 1 truly love. A personal source of inspiration comes from my friend, Nicole Lohr Smith who has conquered a brain tumor, twice, all the while keeping her sunny disposition (and her desire to play hide and seek). Also thanks to Nic's mother, Margie Smith who has been a terrific friend and supporter since my first year in graduate school. My family has been behind me all the way. I thank my father, Pete Werner; my mother. Hazel Werner, my siblings. Eve, Tom and Tim: and my dog Margie. My husband. Hubert Meitz, has provided unconditional love, support, and proofreading. Thank you Hubert. This dissertation is dedicated to those who wonder. 6
TABLE OF CONTENTS
LIST OF RGURES 7
LIST OF TABLES 9
LIST OF ABBREVIATIONS 10
ABSTRACT 12
CHAPTER 1: THE MOLECULAR MAPPING OF38DI TO 38C2 ON THE DROSOPHILA SECOND CHROMOSOME 13 Summary 14 Introduction to Drosophila Oogenesis and Establishment of the Body Axes... 15 Oogenesis 15 The Ovarian Cytoskeleton 18 The Posterior Group Genes 21 The Role of giirken and the Oocyte Nucleus in Establishing A/P and D/V polarity 23 spire and cappuccino 24 Results 27 Cytogenetic Mapping of spir and Initiation of a Chromosomal Walk . .27 Chromosomal Walk in the 38C Region 30 Identification of Transcription Units in the spir Region 31 RFLP Analysis 31 Ovarian Expression of the Candidate cDNAs 40 Expression of the Candidate Genes in spir Mutant Ovaries 41 Sequence Analysis of Mutant Alleles 41 Discussion 43
CHAPTER 2: THE MOLECULAR CHARACTERIZATION OF A PREDICTED GUANINE NUCLEOTIDE EXCHANGE FACTOR FOR RHO GTPASES 46 Summary 47 The Importance of Rho Guanine Nucleotide Exchange Factors as Activators of the Rho Signaling Cascade and Regulators of Cellular Events. .48 Rho Guanine Nucleotide Exchange Factors 50 Rho Signaling Pathways 56 Molecular Mechanisms for Rho Pathway Regulation of the Cytoskeleton 58 Rho Pathways Control Cytoskeletal Changes in Morphogenesis 61 Results 70 Isolation and Identification of a Drosophila RhoGEF Gene 70 DrtGEF mRNA is Abundant in Cells Undergoing Morphogenic Movements 99 Discussion 123 General Discussion and Future Directions 133
CHAPTER 3: MATERIALS AND METHODS 139
REFERENCES 145 7
LIST OF FIGURES
RGURE I: The Stages of Oogenesis in Drosophilamelanogaster 16
nOURE 2: Organization Of Microtubules During Oogenesis 19
FIGURE 3: Deficiency Map of the Location of spir 28
FIGURE 4: Genomic Map of the Chromosomal Walk 32
RGURE 5: Genomic Map of the Region Containing DrtGEF 73
RGURE 6: DNA Sequence of DrtGEF 72
FIGURE 7: Genomic Organization of DrtGEF 82
FIGURE 8: Domain Structure of DrtGEF and Other Putative RhoGEFs 84
RGURE 9: Sequence Alignment of the DrtGEF RhoGEF Domain with RhoGEF Domains from Other Proteins 87
RGURE 10; Sequence Alignment of the DrtGEF PH Domain with PH Domains from Other Proteins 89
RGURE II : Sequence Alignment of the DrtGEF SH3 Domain with SH3 Domains from Other Proteins 93
RGURE 12: Sequence Alignment of the DrtGEF Carboxy Terminus with the Carboxy Termini of HsORF, Mmp85SPR, and HsKIAA0142 95
RGURE 13: Distribution of DrtGEF mRNA During Oogenesis lOl
RGURE 14: Distribution of DrtGEF mRNA During Early Embr>'ogensis 103
RGURE 15: Distribution of DrtGEF mRNA in the Cellular Blastoderm 105
RGURE 16: Subcellular Localization of DrtGEF mRNA in the Cellular Blastoderm 107
RGURE 17: Distribution of DrtGEF mRNA During Stage 6 of Gastrulation 109
RGURE 18: Distribution of DrtGEF mRNA During Stage 7 of Gastrulation Ill
RGURE 19: Distribution of DrtGEF mRNA in Cells Undergoing Changes in Shape in the Posterior Midgut Invagination 113
RGURE 20: Distribution of DrtGEF mRNA During Germband Extension 115
RGURE 21: Distribution of DrtGEF mRNA in a Stage 11 Embryo 117 8
LIST OF FIGURES - Continued
RGURE 22: Distribution of DrtGEF niRNA in a Stage 13 Embryo 119
RGURE 23: Distribution of DrtGEF mRNA in a Stage 15 Embryo 121 9
LIST OF TABLES
TABLE I: Comparison of Predicted RhoGEF Domain Protein Sequences from other RhoGEFs to the DrtGEF RhoGEF Domain 91
TABLE 2: Comparison of Predicted PH Domain F*rotein Sequences from other RhoGEFs to the DrtGEF PH Domain 91
TABLE 3: Comparison of E^edicted SH3 Domain Protein Sequences to the DrtGEF SH3 Domain 97
TABLE 4: Comparison of Carboxy Termini of Related Proteins to DrtGEF 97 10
ABBREVIATIONS LIST
AA. amino ad d(s) A/P anterior-posterior cDNA. DNA complementary to RNA c.. Caenorhabditis CH. calponin homology CRIB. Cdc42/Rac interactive binding DH. DBL-homology DrtGEF. Drosophila rho-type guanine nucleotide exchange factor EW dorsal-ventral EGF, epidermal growth factor EGFR epidermal growth factor receptor ECM extracellular Matrix GAP. GTPase activating protein GEF. guanine nucleotide exchange factor GAP GTPase-activte protein GDP. guanine diphosphate GTP, guanine triphosphate ISREC, Swiss Institute for Cancer Research JNK. Jun amino-terminal kinase LPA. lysophophatidic acid MAP. mitogen-activated protein MAPK mitogen-activated protein kinase MAPKX mitogen-activated protein kinase kinase MAPKKK mitogen-activated protein kinase kinase kinase MBS. myosin-binding subunit MLC myosin light chain MTOC microtubule organizing center ORF. open reading frame PAK, protein-activated kinase PDGF. platelet-derived growth factor PH. pleckstrin homology PI, phosphatidylinositol PI3K. phosphatidylinositol 4,5-bisphosphate PIP2, phosphtidylinositol4^bisphosphate PIP-5 kinase, phosphtidylinositol-4 phosphate-5 kinase PKN, protein kinase N PMA. phorbol myristic acetate RacGEF. guanine nucleotide exchang factor for rac GTPases RhoGEF. guanine nucleotide exchang factor for rho GTPases Rho-K, rho-associated kinase RFLP restriction fragment length polymorphisms RTK receptor tyrosine kinase S.. Saccharomyces SAPK. stress-activated protein kinase SH2, src homology 2 ABBREVIATIONS LIST - Continued
SH3, src homology 3 WASP. Wiskott-Aldrich syndrome protein
Genes bed bicoid boss bride-of-sevenless capu cappuccino drk downtream of receptor kinase elp ellipse grk gurken osk oskar sev sevenless spir spire stau staufen SOS son-of sevenless top torpedo tor torso 12
ABSTRACT
I conducted a chromosomal walk in the 38C region on the second chromosome to execute the molecular analysis of spire, (spir), a Drosophila maternal effect locus
required for establishment of both the dorsal-ventral and anterior-posterior axes during embryonic development. This analysis resulted in the isolation and mapping of approximately 300 kb of DNA from 38DI to 38C2. I identified a gene in this region, which I named Drosophila Rho-type Guanine Nucleotide Exchange Factor (DrtGEF) that has substantial sequence homology to a distinct class of proto-oncogenes that includes
DBL. VAV, Tiam-1. ost and ect-2. It has predicted Rho or Rac guanine exchange factor
(Rho/RacGEF) and pleckstrin homology (PH) domains with the PH domain being immediately downstream of the Rho/RacGEF domain (Cerione and Zheng 1996).
Rho/RacGEFs catalyze the dissociation of GDP from the Rho/Rac subfamily of ras-like
GTPases. thus activating the target Rho/Rac. Members of the Rho/Rac subfamily regulate organization of the actin cytoskeleton, which controls the morphology, adhesion and motility of cells. DrtGEF mRNA is present throughout oogenesis and embryogenesis. Of particular interest, DrtGEF mRNA is most abundant in furrows and folds of the embryo where cell shapes are changing and the cytoskeleton is likely to be undergoing reorganization. 13
CHAPTER 1
THE MOLECULAR MAPPING OF 38D1 TO 38C2 ON THE DROSOPHILA SECOND CHROMOSOME 14
DROSOPHILA OOGENESIS AND
THE ESTABLISHMENT OF THE BODY AXES
Summary
spire {spir) and cappuccino {capu) are upstream genes in a hierarchy for
localization of molecular determinants that establish the anterior-posterior (A/P) and
dorsal-ventral (D/V) axes in development (Manseau and Schiipbach 1989).
In Drosophila, the body axes originate by the generation of polarity within the
developing oocyte. Molecular determinants deposited at the anterior, at the anterior
dorsal comer, and at the posterior pole are interpreted during embryogenesis to specify
pattern formation (Driever and Nusslein-Volhard 1988a; Drieverand Nusslein-Volhard
1988b; Neuman-Silberberg and Schiipbach 1994; Spradling 1993; Spradling 1993; St.
Johnston et al. 1991; Stephenson and Pokrywka 1992). Subcellular localization of
cytoplasmic determinants is a universal mechanism for determining polarity- in
development and is believed to be largely controlled by the cytoskeleton (Forristall et al.
1995; Konradetal. 1985; Micklem 1995; Mowry 1996; Nishida 1994; Stromeand
Wood 1983; Swalla and Jeffery 1995; Yisraeli et al. 1990). My dissertation project
began as the molecular characterization of spir. I conducted a chromosomal walk in the
38C region of the second chromosome, where spir maps. I cloned and mapped the
DNA between 38D1,2 and 38C2, which spans approximately 300 kb. Within this walk,
I identified the boundaries of the cytogenetic region where spir is believed to be located.
I isolated and began to characterize cDNAs from three genes within this region. None of these candidates were spir; however, one cDNA had a predicted rho guanine nucleotide exchange factor domain, suggesting that it may have a role in regulating cytoskeleton. 15
Since the cytoskeleton controls many important events during oogenesis, I continued to
study this gene.
Oogenesis
The Drosophila ovary is an excellent system for studying pattern formation in
development because it is amenable to genetic and cell biological studies, and it is well
characterized. The Drosophila ovary consists of a series of maturing egg chambers,
arranged in a linear, developmentaily ordered fashion within a muscular bundle called an
ovariole (Fig. I). The oocyte develops as one of 16 cells within the egg chamber, and the
remaining 15 nurse cells nourish and support its development. The egg chambers are
organized such that the oocyte is the most posterior cell, with the nurse cells at the
anterior. Stem cells in the most anterior portion of the ovariole. or germarium. produce
cystoblasts that then undergo four incomplete divisions resulting in a cyst of 16 germline
cells connected by cytoplasmic bridges that pass through specialized actin structures
called ring canals. One of these sixteen cells will differentiate to become the oocyte,
while the remaining 15 cells will differentiate into highly synthetic nurse cells that
transport maternal components through the ring canals into the oocyte. Cells of a third
type, the somatically derived follicle cells, cover the nurse cells and the oocyte (King
1970; Kingetal. 1982; Mahajan-Miklos and Cooley 1994; Spradling 1993; Spradling 1993).
[n early oogenesis (Rg. I), stages 2 through 6, the egg chamber gradually
increases in size with the oocyte proportionate to the individual nurse cells. During mid- oogenesis, stages 7 through lOa, yolk proteins synthesized by fat bodies and follicle cells are taken in by the oocyte through endocytosis, enlarging the oocyte such that by stage 10 the oocyte is the same size as all 15 nurse cells. During these stages of 16
FIGURE 1: The Stages of Oogenesis in Z><35op/i//a me/cyiogoyrer. Egg chambers are oriented with the anterior to the left and the posterior to the right. A. The Drosophila egg chamber consists of nurse cells, follicle cells and an oocyte. The oocyte is located most posteriorly, the nurse cells occupy the anterior portion of the eggchamber, and both oocyte and nurse cells are surrounded by follicle cells. B. Egg chambers develop in a sequential fashion. A: Drosophila Kgg Chamber
Anterior Posterior
Fuliicle Cells Nurse Cells.
B: Kgg Chambers Develop in a Sequential Fashitm
Stage 2 4 6
Germarium 18
mid-oogenesis. the molecular determinants that specify the body axes are selectively
transported from the nurse cells to the oocyte and localized asymmetrically within the
oocyte (Mahajan-Miklos and Cooley 1994; Spradling 1993; Spradling 1993).
Messenger RNA for the anterior morphogen Bicoid is concentrated in a ring at the
anterior cortex (Berleth et al. 1988; Stephenson and Pokrywica 1992). Oskar mRNA
and other posterior determinants are localized to polar granules, electron dense structures
composed of protein and RNA found near the posterior pole. mRNA for gurken (.grk), a
determinant for both the A/P and also the D/V axes, is localized along with the oocyte
nucleus, first to the posterior, then to the dorsal anterior. In late oogenesis, stages 10b
through 12. the nurse cells dump the remainder of their contents into the oocyte,
accompanied by microtubule based ooplasmic streaming (Gutzeit 1986; Mahajan-Miklos
and Cooley 1994; Spradling 1993; Spradling 1993).
The Ovarian Cytoskeleton
The oocyte microtubule cytoskeleton is asymmetrically organized. During early
oogenesis a microtubule organizing center (MTOC) at the posterior pole organizes an
array of microtubules that emanates from the posteriorly located oocyte nucleus toward
the anterior (Fig. 2). At stage 8 in oogenesis, the oocyte nucleus migrates to the dorsal anterior, and the microtubules are completely reorganized. The anterior cortex acts as a
MTOC and microtubules emanate with plus-ends toward the posterior (Cooley and
Theurkauf 1994; Knowles and Cooley 1994; Theurkauf etal. 1992; Theurkauf etal.
1993). This reorganization requires Notch and Deba. genes that encode proteins involved with follicle cell signaling to the oocyte (Ruohola et al. 1991). Localization of molecular determinants is microtubule dependent. Studies with inhibitors of microtubules show that BicD exuperantia, KIO, orb, osk and Stau gene products 19
FIGURE 2: ORGANIZATION OF MICROTUBULES DURING OOGENESIS
A. During eariy oogenesis, microtubules emanate from the posteriorly located oocyte nucleus toward the anterior, depicted in an oocyte from a stage 6 eggchamber. The oocyte nucleus is shown in black. The arrows indicate the direction of the plus ends of microtubules.
B. At stages 7 and 8, this MTOC is reorganized so that at stage 9 microtubules emanate from the anterior cortex. The oocyte nucleus is shown in black. The arrows indicate the direction of the plus ends of microtubules. A
Anterior Posterior 21
require microtubules for proper localization (Cooley and Theurkauf 1994; Ferrandon et
al. 1994; Glotzeretal. 1997; Pokrywa and Stephenson 1995; Pokrywkaand
Stephenson 1991; Stephenson and Pokrywka 1992). Microtubules are initially
organized from the posterior of the oocyte, until stage 6. At stages 7 and 8. this MTOC
is reorganized so that at stage 9 microtubules emanate from the anterior (Fig. 2)
(Theurkauf et al. 1992; Theurkauf et al. 1993; Cooley and Theurkauf 1994; Knowles
and Cooley 1994). LacZ fusions with a plus-end directed kinesin accumulated at the
posterior pole, but a minus-end dynein has also been shown to accumulate at the
posterior pole (Clark et al. 1994; Clark etal. 1997; Haysetal. 1994; Micklem 1995).
The actin cytoskeleton appears to be important in several morphogenic events. In
late oogenesis, the contents of the nurse cell cytoplasm are rapidly transported through
the ring canals into the oocyte. At stage 11 in oogenesis, polymerization of a meshwork of actin filaments occurs, creating a cage around the nurse cell nuclei, and thus
preventing passage of the nuclei through the ring canals (Cooley and Theurkauf 1994;
Gutzeit 1986; Knowles and Cooley 1994; Mahajan-Miklos and Cooley 1994). At stage
9 in oogenesis, most of the anterior follicle cells migrate to the posterior, and form a columnar epithelium around the oocyte as they are pushed together. Only about 50 cells
remain around the nurse cells, and these become squamous in order to cover the nurse cells. At the same time, about 6-10 follicle cells, known as the border cells, migrate from the anterior tip of the egg chamber in between the nurse cells to the nurse cell/oocyte border(Spradling 1993; Spradling 1993).
The Posterior Group Genes
The anterior-posterior axis is determined by three distinct sets of genes
(Niisslein-Volhard et al. 1987). The anterior is established by a genetic pathway that 22
regulates the anterior determinants Bicoid and Hunchback (Akam 1987; Berleth et al.
1988: Driever and Niissiein-Volhard 1988a; Driever and NUssIein-Volhard 1988b;
Driever and Niisslein-Volhard 1989: Ingham 1988; St. Johnston et al. 1989). The
termini of the embryo are determined by the torso signaling pathway (Akam 1987:
Ingham 1988). A collection of maternal effect loci known as the posterior group genes,
which include spire, ntago nashi, staufen, oskar, pipsqueak, vasa. valois. rudor.
pumilio. and nemos specifies the posterior axis. Females homozygous for these genes
produce embryos that have normal heads and thoraces but have fused or missing
abdominal segments (Boswell and Mahowald 1985: Boswelletal. 1991; Frohnhofer
and Niissiein-Volhard 1986: Hayetal. 1988: Lehman and Niisslein-Volhard 1986:
Manseau and Schiipbach 1989: Newmark and Boswell 1994: Nusslein-Volhard et al.
1987; Schiipbach and Wieschaus 1986a: Schiipbach and Wieschaus 1986b: Siegel et al. 1993). This genetic pathway functions to create a gradient of the posterior determinant, Nanos, which protects the posterior from the influence of the anterior morphogen Hunchback, and allows development of the default posterior cell fates.
(Driever and Niisslein-Volhard 1989; Hulskamp et al. 1989; Irish etal. 1989: Lehman and Niisslein-Volhard 1991; Murata and Wharton 1995: Struhl 1989; Wang and
Lehmann 1991).
An ordered pathway of the posterior group genes has been determined through genetic analysis. It is thought that the genes upstream of oskar in this pathway serve to organize an asymmetric microtubule network in the egg or are otherwise involved in the localization of o5A:ar mRNA. and that 5p/r zxidcapu direct formation of a microtubule network responsible for this transport (Theurkauf et al. 1993; Cooley and Theurkauf
1994: Manseau et al. 1996). Stau protein associates with oskar mRNA to form a particle that is transported by a microtubule-dependent mechanism to the posterior, oskar 23
directs pathways for the determination of the posterior via nanos and for the
determination of pole cells, pipsqueak, vasa, valois, and tudor are also required for
both these pathways, but pumilio and nanos function only in posterior determination
(Boswell and Mahowald 1985; Hayetal. 1988; Lehman and Niisslein-Volhard 1991;
Siegel etal. 1993).
The Role of gurken and the oocyte nucleus in establishing A/P and
polarity
Cell/cell communications between the oocyte and the follicle cells are critical for
establishing both the A/P and D/V axes. During oogenesis, mRNA for gurken igrk).
which encodes aTGF-alpha-like protein, is localized along with the oocyte nucleus, first
to the posterior pole, and later, at stage 8. to the anterior dorsal region of the oocyte
(Gonzalez-Reyes et al. 1995: Roth etal. 1995). grk and torpedo (top), the Drosophila
EGF receptor, participate in the determination of the fates of the posterior follicle cells.
Lack of grk and top produces egg chambers with anterior follicle cells on both ends
(Gonzalez-Reyes et al. 1995). It is thought that Grk directs localized activation of Top
in subsets of follicle cells in the posterior, and later at the anterior dorsal comer. This
information is communicated back to the embryo, determining the posterior and dorsal
sides of the animal (Gavis 1995: Gonzalez-Reyes et al. 1995; Gonzalez-Reyes and SL
Johnston 1994; Munn and Steward 1995; Roth etal. 1995). 5/7//-and are required
for proper anterior dorsal localization of grk mRNA (Neuman-Silberberg and Schupbach
1993). No role has been reported for spir and capu in the posterior localization of grk
mRNA. spir and capu are not necessary for determination of posterior follicle cell fates
(Gonzalez-Reyes et al. 1995).
i 24
spire and cappuccino
spir and capu are maternal effect genes that are required during oogenesis and
influence zygotic development. Homozygotes are normal; however, all embryos from
females homozygous for either spir or capu have defects in A/P and D/V pattern
formation. When discussing maternal effect mutants, the term 'mutant embryo' or
'mutant ovary' refers to the products of homozygous mutant mothers. Phenotypes of
spir or capu mutant embryos can be arranged into a series. The weakest alleles produce defects in the germline. Moderate alleles produce defects in abdominal segmentation as
well. The strongest alleles have defects in the dorsal-ventral axis. Mutant eggshells and embryos are usually dorsalized; however, some alleles of spir and capu can also produce ventralized eggshells and embryos. The severity of the D/V phenotype appears to be related to the degree of the anterior-posterior phenotype. Both Ayp and D/V defects are attributed to the mislocalization of key molecular determinants such as gurken. oskar and nanos( Emmons et al. 1995; Manseau and Schupbach 1989).
The earliest phenotypes of spir and capu mutant ovaries can be discerned at stage
8 of oogenesis, spir and capu mutant ovaries have a very different organization of microtubules compared to wild type (Emmons et al. 1995). Microtubule based ooplasmic streaming, which usually occurs during the nurse cell dumping later in oogenesis, commences prematurely in spir and capu mutant egg chambers and can be observed at stage 8 (Emmons et al, 1995). The anterior MTOC is not apparent; instead, bundles of
MT are seen along the oocyte cortex, as usually occurs later during ooplasmic streaming
(Manseau et al. 1996). Oskar mRNA, staufen protein, and other components of the polar granules do not accumulate at the posterior pole and are spread throughout the ooplasm (Manseau and Schiipbach 1989; St. Johnston 1993). Likewise, mRNA 25
is mislcxralized so that it is present in a ring around the anterior of the oocyte instead of
being secluded in the anterior dorsal comer (Neuman-Silberberg and Schiipbach 1993).
capu has sequence similarity to the formins, a family of proteins that appear to
influence polarity during development (Emmons etal. 1995). The mouse formin,
encoded by the vertebrate limh deformity locus, affects anterior posterior patterning in
the limbs, the Aspergillus FigA regulates branching of hyphae, and a yeast formin. Bni-
1. influences bud site selection (Evangelista et al. 1997: Marhoul and Adams 1995:
Zelleret al. 1989). capu also has a poly-proline rich region that is a putative SH3
domain binding motif. A poly-proline rich domain is a common theme among the formin
collective (Emmons et al. 1995).
Yeast 2-hybrid analysis indicates that Capu and profilin. the actin
regulating/sequestering protein, directly interact (Manseau etal. 1996). Profilin has been
shown to bind polyprolines. so it may associate with the poly-proline rich domain of
Capu (Tanaka 1985). Other work in yeast and mammalian cells demonstrate a direct
interaction between formins, profilin and the actin cytoskeleton. The yeast formin. Bni-
1 p has been shown to complex with the yeast homologue of profilin and Bud6. another
actin associated protein. Bni-lp also binds the activated form of CDC42p. a Rho family
GTPase that regulates the actin cytoskeleton. Bni-lp, Bud6p and Cdc42p are localized
along with actin to the tips of mating projections (Evangelista et al. 1997). pl40mDia.
the mammalian homologue of Drosophila diaphanous, a member of the formin family,
interacts specifically with activated RhoGTPase, and also binds with profilin. These
three proteins are recruited to actin structures. Overexpression of p l40mDia in Cos-7
cells results in the formation of actin filaments (Watanabe 1997).
Profilin and the actin cytoskeleton have been shown to influence ooplasmic streaming in a manner similar to capu. Egg chambers from females mutant for 26
chickadee, which encodes profilin, have premature ooplasmic streaming. Treatment of
ovaries with the actin cytoskeleton inhibitor, cytochalasin D, also results in premature
ooplasmic streaming. Taken together, these data indicate that the actin cytoskeleton
regulates this microtubule based event and that actin is important for pattern formation in
the oocyte. The present model is that Capu interacts directly with profilin to regulate the
actin cytoskeleton. and this interaction directly, or through a signaling process controls
the organization of microtubules (Manseau et al. 1996). By analogy to Bni-1 and
p l40mDia. Capu may also influence the cytoskeleton through interaction with a
RhoGTPase.
j 27
RESULTS
spir is located at 38C on the proximal left arm of chromosome two (Manseau and
Schupbach 1989). Cytogenetic mapping through complementation tests with deficiency chromosomes further narrowed the location of spir to a 50 to 100 kb region that appeared to lie in 38C 5.6 (Fig. 3). The strategy I used to identify the spir gene was to isolate
DNA from this region and to identify candidate trancription units expressed during oogenesis. 1 isolated cDNAs representing three transcription units in the spir region and performed a number of experiments to determine whether these candidate genes could be spir. I examined the spatial and temporal pattern of mRNA expression of each of these genes during oogenesis to see if it was compatible with that predicted for spir. I compared expession of mRNA in wild-type and spir mutant ovaries. I conducted
Southern blot analysis to determine if restriction fragment length polymorphisms
(RFLPs) in genomic DNA from spir mutant flies were associated with any of these genes. Partial sequences of cDNAs from the candidates were obtained to determine if they matched sequences for known genes. Finally, spir mutant alleles of two candidates were sequenced. Taken together. I did not obtain any data that indicated that any of the three candidates was spir.
Cytogenetic Mapping of spir and Initiation of a Chromosomal Walk.
Through complementation tests with chromosomes that have deficiencies
(deletions) in the 38C region. Dr. Manseau had narrowed the location of spir to 38C 5.6
(Fig. 3). Cytological examination of polytene chromosomes reveals that the purple (pr)
26, pr49 ^^21 deficiency chromosomes (named for an eye color phenotype) contain deletions which appear to extend from approximately 38C 5.6 towards the distal end of 28
HGURE 3: Deficiency Map of the Lxtcation of spir. Diagram represents the chromosomal banding pattern of the 38C region of chromosome 2. Bars represent regions of the chromosome deleted in the various deficiency chromosomes. Genetic analysis conducted by Dr. Manseau revealed that the pr^l, pr 26^ p,- 49^ ^nd 1 lA deficiency chromosomes uncover the spir mutation. This narrows the spir locus to between the proximal breakpoint of the pr21 deficiency and the distal breakpoint of the
1 lA deficiency. 29
III A I I f A H AHA I At M
1 t 30
the chromosome (BrittnacherandGanetzky 1984). The 1 lA deficiency chromosome
contains a small deletion which is the result of a P-element excision. Cytologically, this
deletion appears to extend from 38C 5,6 towards the proximal end of the chromosome.
The purple (pr) 26 ^ pi49 p,.2l jjig [ deficiency chromosomes all fail to
complementtherefore, the molecular lesion resulting in the spir phenotype in the
spir allele chromosomes should be in the overlap between the proximal breakpoints of
the pr26, pj21, and pi^^ and the distal breakpoint of the 11A deficiencies.
Dr. Manseau entered the region by constructing a library with genomic DNA
from the largest deficiency. pr26. then used an available clone to enter the region distal to
the deficiency, found a clone in her library that spanned the pr^^ deficiency, and jumped
across to the proximal side of the deficiency. She then walked distally towards the pr^l
proximal and 11A distal breakpoints which bound the spir region. The distance of the
walk from the pr^^ proximal break to the I lA distal break was estimated to be about 50
to ICQ kb. judging from examination of the banding pattern of deficiency chromosomes
probed with clones from the pr 26 breakpoint region.
Chromosomal Walk in the 38C Region
My work began at the third step of the walk. 1 used the Maniatis and the Tamkun
genomic phage libraries, and the Tamkun genomic cosmid libraries (Tamkun et al.
1992). Most of the steps were taken in either of the two genomic phage libraries, as
there were many holes in the Tamkun cosmid library in this region. Progress in the walk
was monitored by comparing in situ hybridization of fragments from the walk to
polytene chromosomes heterozygous for the deficiencies bounding the region, and for
wild type. Fragments that have crossed a breakpoint hybridize to parental polytene
chromosomes but signal is not present on deficiency chromosomes. 1 also obtained PI
I iL 31
clones of genomic DMA from the 38C region as they became available from the
Drnsophila Genome Project amd used them to further map the spir region, and to extend
the walk. The entire chromosomal walk covers over 300 kb of DNA (Fig. 3). It is over
260 kb from the pr^^ proximal break to the 11A distal break. Chromosomal in situ
hybridizations of clones from the walk to pr^l and 11A deficiency chromosomes map
spir to 38C2. The distance from the pr^l proximal break and the 1 lA distal break is
about 55 to 83 kb. I will refer to this segment of the genome as the 'spir region'.
Identification of Transcription Units in the spir Region
Transciption units were identified using reverse northern analysis with
digoxygenin labeled ovar>' mRNA probes to southern blots of DNA from the region.
Probe hybridized to 7.0 kb BamHI, 5.8 kb BamHI-Notl. and 6.2 kb BamHI-NotI
fragments, suggesting that they contained sequences transcribed in oogenesis (Fig. 4.
p J8). These genomic fragments were used to isolate cDNA clones from the Tolias
ovarian cDNA library (Stroumbakis, et al. 1994). Three families of cDNAs were
identified. A 5.8 kb BamHI-NotI family with a 1.6 kb transcript size, a 2.3 BamHI and
5.8 BamHI-NotI positive family having a 3.5 kb transcript size, and a 7.0 BamHI
positive family with a 2-5 kb transcript size on a northern blot made from ovarian mRNA
(data not shown). I will refer to these families as candidate A, candidate B and candidate
C, respectively .
RFLP Analysis
RFLP analysis was used as a crude screen for sequence changes in spir mutant
alleles to try to pinpoint the location spir. Identification of a polymorphism associated J 32
RGURE 4: Genomic Map of the Chromosomal Walk. The restriction sites are EcoRI unless noted. Clones of genomic DNA in the region are indicated below the restriction map. and may include cosmid, phage or PI vectors. The nomenclature for cosmid and phage clones includes a letter designating the library ( C, Tamkun cosmid clone; M,
Maniatis phage clone: T, Tamkun phage clone), followed by the fragment screened with followed by a number designating the isolate. B. BamHl; N, Notl. < Proxima Distal >
(1.0 .6 1.7 4.1 >(1.8 2.1 4.0 2.0 ^4 8.5 4.3 1.2 1.4 1 II 1 1
C7-5 Ml.2+10-1 ?
( ) unsiire of order of fragments
= 10 kb
CTTZTZ] Crosses (Icficicncy proximal breakpoint
(S3SS3 Within pr^^ Deficiency
N = NotI site
C = Tamkun cosmid clone M = Maniatis phage clone < Proximal Distal>
3.9 13.0 1.0 8.5 7.0 4.8
Ml.2+10-1 M7.5+3-1
.M3.0+7-3 Ml.4+10-1
Ml.8+3-3 = 10 kb
a Within Deficiency
M = Manialis phage clone
^ 4.8 ^ I j I 1 lawKWiWiWMaiw g
Ml.8+3.3
——. M 1.2+4-1
Tl .9+4-5
17.5+5-1 r5.()S-H'v2 = 10 kb rssNS.\^s\N Wilhin pr^^ Deficiency M = Maniatis phage clone T = Tamkun phage clone
<6.0 6.0 2.4 8.0 n 4()-60kb LJ.
•^7.5+4-5 T5.0S+2-2 T3.3R.S+3-3
PI 536 ( >
=10kb ) unsure of break = BamI 11 site I5-25531 Within pr deficiency = Tamkun phage clone (2il'L'23 Crosses pr deficiency proximal breakpotv<\ few?:?!! Within pr49 andpr26 deficiency
4 4 2 6 2.8 1.0 3.6 1.2 3.9 1.3 2.9 2.4 B 4.9 B 7.0 J 1. . ' ' . !• U ' ' ' iiiiiiiiiiiiiiiiiiiiiiiniiimmiiiiiiiiiiiiiiiiiiiiiimii
PI 56 C6.0BX+6-3
T3.9+IO-1
CI.7+6-3
= lOkb PI 41-63 ^
B = Bam HI site Within and pr26 deficiencies C = Tamkun cosmid clone luiiiiiTill Crosses pr21 deficiency proximal breakpoint T = Tamkun phage clone illllllllll Within pr^', pr^^, and pr26 deficiencies ( ) = unsure of breakpoint
1 , I C 13 7.0 n2.3 M2.6liH 5.8 N 6.2 13 4.3 B 16.0
liiiiiiiiiiiiiiiiiiiiiiiiiiiiliiiiiiiiliiiiiiiiiliiLiiiiiiiiiiiiiiiiiiiiliimiiiiiiiiiiiiiiiimiiliniiimiiniiiinlniiiuiiiiutg
——————— C1.7-H>-3
T6.2+1-1 >
'1 41-63
=IOkb . B = Baml U site llllllllilil Within pr , pr , and pr ^ dcfioicncics N = Noll site i .1 = Contains transcription units C - Tanikun cosniid done '[' = I'anikun phage clone
B IG.U 13 2,5 n I I lililllllllllllillllllillllltlllllllllllilllllllllllilllillillllllliilliilllllliillillillillllllilllllllllllllllllllllllllllH
T6.2+1-1
IM 41-63
= 10 kb imilil Within pr ^' , pr , and pr^^ dcriciencies Crosses 11A deliciency distal breakpoint
( ) unsure of breakpomt 40
with one of the candidate transcription units would suggest that this candidate was spir.
Genomic Southern blots of DNA isolated from spir mutant flies were probed with the
genomic fragments from the spir region. I screened with probes made from the cosmid
1.7+C6-3, as well as the 7.0 Icb, 23 kb, and 2.6 kb BamHI fragments and the 6.2 kb
and 5.8 kb BamHI-NotI fragments (Fig. 4, p36). Fourteen different alleles and six
enzymes were used; however, no polymorphisms were detected (data not shown).
Ovarian Expression of the Candidate cDNAs
I used the candidate cDNAs as probes for mRNA localization in ovaries to see if
expression was at stages of oogenesis and cell types predicted for spir . Analysis of
genetically mosaic egg chambers shows that Spir is required in germline cells, therefore.
I would expect spir to be expressed in the nurse cells and/or in the oocyte, but not
necessarily in the somatically-derived follicle cells. Furthermore, spir is required for
proper localization of other posterior group gene products, including oskar {osk) mRNA.
Since localization of osk mRNA to the posterior of the oocyte is apparent at stages 8
throughout 10b of oogenesis, I would expect spir transcripts to be present in the egg chamber before this time. All three candidates met this criterion, showing expression in the nurse cells from the earliest stages throughout oogenesis. All three candidate genes also had mRNA expression in the follicle cell throughout oogenesis, and expression in the oocyte during the early stages of oogenesis. As this is a negative result and the mRNA expression patterns of the three candidates are indistinguishable from each other, data is not shown here. However the expression pattern of candidate B, which I characterized further and call DrtGEF, is shown later in figure 13. 41
Expression of the Candidate Genes in spir Mutant Ovaries
I tested whether transcription of candidates A, B or C was altered in spir mutant
ovaries. Transcript from mutant spir alleles could be decreased or absent, or altered in
size. Northern analysis of ovarian mRNA from two of the strongest alleles of spir,
RP48 and EC34. showed that the size and amount of message detected by probe made
from the candidate cDNAs was comparable to wild type in these alleles (data not shown)
These probes were also used to examine RNA expression in ovary whole mounts, with
no noticeable difference in the amount and location of message between five vp/r alleles and wild type (data not shown).
Sequence Analysis of Mutant Alleles
Partial sequences of candidate A and candidate B cDNAs were obtained to determine if they matched sequences for known genes. Partial sequences were performed by Steve Emmons. 1 subcloned the cDNAs into Bluescript. and he used M13 forward and reverse primers to sequence in from either end. Blast analysis of the partial sequence of candidate A revealed it to be the Drosophila homologue of the Lupus
Antigen, an RNA binding protein which has been cloned and sequenced (Altschul et al.
1990; Bai et al. 1994). Blast analysis of the partial sequence of candidate B revealed sequence similarity to an uncharacterized human ORF. Analysis of the human ORF sequence with Swiss PROSITE, a database of protein motifs, indicated that this gene possessed a predicted actin binding domain, an SH3 domain, a Rho Guanine Nucleotide
Exchange Factor domain, and a Pleckstrin Homology domain (Bairoch 1997a; Bairoch
1997b). Analysis of the partial sequence of candidate B with Swiss Prosite did not give a match to any of these domains. This partial sequence data suggested that both 42
candidate A and candidate B could encode proteins that could have a role in mRNA
localization or regulation of the cytoskeleton.
A collaborative effort of sequencing of mutant alleles by Steve Emmons, Dr.
Manseau, and myself suggested that neither candidate A nor candidate B encoded Spir.
PCR was used to amplify DNA from spir mutant flies and this product was sequenced.
Dr. Manseau and Steve Emmons sequenced the mutant alleles of candidate A. Sequence
of 90% of the coding region, including the putative functional domains of the Lupus
Antigen protein, using seven mutant alleles, revealed no changes. I sequenced the cDNA
subclones of candidate B. and designed primers for amplification. Steve Emmons
amplified the DNA from mutant flies, and sequenced it. Mutant DNA from seven alleles
of the candidate B gene were sequenced through 90% of the coding region, including
putative SH3. RhoGEF and PH domains, the 5' untranslated region, and across several
intron/exon boundaries. No changes that would alter amino acid sequence were detected. 43
DISCUSSION
I isolated DNA approximately 300 kb of DNA from 38D 12- to 38C2, and
identified a region within this DNA which cytogenetic mapping suggested contained the
spir gene. I identified restriction fragments containing transcription units expressed during oogenesis. I isolated cDNAs representing three transcription units in the spir
region and performed a number of experiments to determine whether these candidate genes could be spir.
I examined the spatial and temporal pattern of mRNA expression of three spir candidate genes during oogenesis and found that all three were expressed in the oocyte in the early stages of oogenesis and in the nurse cells and follicle cells throughout oogenesis, spir has been shown to be required in the germline, and to be required by stage 8, so expression of these genes in the germline derived nurse cells and oocyte is compatible with that predicted for 5/9/> (Manseau and Schiipbach 1989). From these data I could not rule out any of the three spir candidates.
I compared expression of mRNA from the three candidate genes in wild-type and spir mutant ovaries. Northern analysis comparing two strong v/j/r alleles with wild-type showed no difference in size or quantity of transcripts. Comparison of mutant and wild- type ovaries also showed no discernible difference in transcript expression pattern.
While I would expect transcript to be altered in strong alleles of .vp/r, it is possible that the message is full length and in similar abundance to wild-type, and that the strong phenotypes arise from an altered protein.
RFLP analysis of DNA fragments containing the candidate transcription units did not reveal any polymorphisms in spir alleles. An RfT-P would only be apparent if a rather large disruption of the DNA sequence occurred, such as a deletion. Point 44
mutations would not usually be detected through RFLP analysis. Also, if these spir
alleles were regulator)' mutants, sequence changes could be located some distance from
the transcript and could be missed.
Partial sequence of candidate A cDNA revealed that this gene was a newly
characterized gene for a Drosophila homologue of the Lupus Antigen, an RNA binding
protein. Partial sequence of candidate B cDNA was similar to sequences from a human
ORF with predicted actin-binding, SH3, RhoGEF. and PH domains. As spir is required
for mRNA localization and spir mutant ovaries have alterations in actin based ooplasmic
streaming, both these genes could be construed as candidates for spir. Mutant alleles of
these two candidates were sequenced. Sequence of 90% of the coding region of the
Lupus Antigen protein, including the putative functional domains, of seven mutant alleles
revealed no changes. Mutant DNA from seven alleles of the candidate B gene was
sequenced through 90% of the coding region, including putative SH3. RhoGEF and PH domains, the 5' untranslated region and across several intron/exon boundaries. No changes were detected.
Taken together, these experiments suggest that neither candidate A nor candidate
B are spir. Sequence analysis of corresponding DNA from spir mutants did not reveal differences in the coding regions. It is possible that these seven alleles are regulatory mutants, in which case I would not expect to see changes in the coding region or intron/exon boundaries. However, analysis of mRNA transcripts of these genes in two strong spir alleles, which were among the seven alleles sequenced, did not reveal any quantitative differences from wild-type. Furthermore, the I lA deficiency evolved from a P-element induced allele of spir. the deletion being the result of an excision of the P- element. Often in such cases, one end of the deficiency marks the location of the former 45
P-element. This suggests that spir could be located at the distal break of 11 A, which is
approximately 20-30 kb distal from these genes.
At this point I chose to focus my dissertation research on the characterization of
the candidate B gene. As it contains predicted SH3, RhoGEF and PH domains, it is
likely to have an important role in regulating the cytoskeleton that controls many
important events in oogenesis. Furthermore, at that time no RhoGEF had been reported
in Drosnphila.
Fmally, I would like to note that the spir gene has been isolated by Steve
Emmons, Dr. Manseau and Andrea Wellington using a P-element allele provided by
Peter Tolias. spir extends from the 6.2 BamHI-NotI fragment, which is adjacent to candidates A and B. through the 11A deficiency distal breakpoint. 46
CHAPTER 2
THE MOLECULAR CHARACTERIZATION OF A PREDICTED GUANINE NUCLEOTIDE EXCHANGE FACTOR FOR RHO SMALL GTPASES 47
SUMMARY
This chapter describes the molecular characterization of a predicted Drosophila
Rho guanine nucleotide exchange factor, DrtGEF. Rho guanine nucleotide exchange
factors (RhoGEFs) are activators of RhoGTPases, small G proteins that act as
molecular switches for the regulation of the cytoskeleton and of other cellular functions
(Cerione and Zheng 1996; Narumiya 1996; Symons 1996; Takaietal. 1995; Tapon and Hall 1997). DrtGEF has predicted RhoGEF and pleckstrin homology (PH) domains, with the PH domain immediately downstream of the RhoGEF domain, and a
predicted SH3 domain in the amino terminus. mRNA transcripts from this gene are found throughout oogenesis and embryogenesis. In the embryo. mRNA is highly expressed in regions where cell shapes are changing and the cytoskeleton is likely to be undergoing reorganization, leading me to hypothesize that DrtGEF plays a role in morphogenesis. 48
THE IMPORTANCE OF RHO GUANINE NUCLEOTIDE EXCHANGE
FACTORS AS ACTIVATORS OF THE RHO SIGNALING CASCADE
AND REGULATORS OF CELLULAR EVENTS
Rho guanine nucleotide exchange factors (RhoGEFs) are activators of
RhoGTPases. small G-proteins that act as molecular switches for the regulation of the
cytoskeleton and a host of other cellular functions (Cerione and Zheng 1996; Narumiya
1996; Symons 1996; Takaietal. 1995; Tapon and Hall 1997). As G proteins, they
bind OTP and have intrinsic GTPase activity which dephosphorylates the bound GTP to
GDP. RhoGTPases cycle between the conformationally distinct GTP-bound active and
GDP-bound inactive forms. RhoGEFs catalyze the exchange of bound GDP for GTP,
which activates the Rho signalling pathway. A second type of regulator. RhoGAPs
(GTPase activating proteins), promote the intrinsic GTPase activity of RhoGTPases.
resulting in the inactive state (Boguski and McCormick 1993; Narumiya 1996).
RhoGTPases are members of the RasGTPase Superfamily, small 2C)-25kd G
proteins that act as molecular switches for key cellular functions (Bourne et al. 1990;
Hall 1992; Narumiya 1996; Symons 1996; Takaietal. 1995; Tapon and Hall 1997).
About 70 Ras-like GTPases have been described (Feig 1994; McCormick 1993). These
have been classed into subfamilies based on sequence similarity. Each class seems to regulate specific aspects of cellular function. Ras itself is an important regulator of cellular differentiation and proliferation (Marshall 1995; Wassarman et al. 1995). The
Rab/Arf subfamily regulates intracellular vesicle transport (Ferro-Novick and Jehn 1994;
Rothman 1994; Zerial and Stemmark 1993) and Ran/TC4GTPases regulate cell cycle progression and nuclear-cytosolic trafficking of RNAs and proteins (Rush et al. 1996;
Sazer 1996). The Rho/Rac subfamily regulates dynamic re-organization of the actin 49
cytoskeleton (Bourne et al. 1990; Paterson etal. 1990; Symons 1996; Takaietal.
1995; Tapon and Hall 1997).
RhoGTPases include several isoforms of Cdc42, Rac, and Rho, as well as the
more distantly related RhoE, RhoG, RhoL andTCIO (Larochelle et al. 1996; Murphy
and Montell 1996; Nakamura et al. 1996; Narumiya 1996; Shinjo et al. 1990; Tapon
and Hall 1997; Vincent etal. 1992). RhoGTPases share about 30% sequence identity
with other Ras-superfamily proteins and about 50% sequence identity with each other
(Murphy and Montell 1996; Nobes and Hall 1994). Protein sequences of the members
of each isoform are 8S95% identical (Boivin et al. 1996; Murphy and Montell 1996).
Five domains required for GTP binding and hydrolysis are scattered along the protein
and are especially highly conserved (Boivin et al. 1996; Takai et al. 1995). Alterations
of these amino acid sequences can produce constitutively activated or dominant negative
forms of RhoGTPases (Harden et al. 1995). RhoGTPases are post-translationally
modified by geranylgeranylation or. in the case of RhoE, famesyiation of a cysteine three
residues from the carboxy-terminus, proteolytic removal of the last three residues, and
methylationofthe cysteine (Boivin etal. 1996; Larochelle et al. 1996). These
modifications are essential for membrane translocation of Rho, an important step in cell
activation, and for recognition by GEFs, and GAPs (Boivin et al. 1996).
RhoGTPases are intimately involved in cell adhesion and motility, formation of
focal adhesions and stress fibers in fibroblasts, regulation of the the avidity of cell
surface integrins, neurite retraction cytokinesis and maintenance of the contractile ring, and increasing calcium sensitivity in smooth muscle cells (Dutartre et al. 1996; Hirata et al. 1992; Jalinketal. 1990; Kishietal. 1993; Larochelle et al. 1996; Mabuchietal.
1993; Morii and Nakamiya 1992; Narumiya 19%; Nishikietal. 1990; Nobes and Hall
1995; Otto etal. 1996; Tominagaetal. 1993). Different RhoGTPase cascades regulate 50 separate aspects of the cytoskeleton. For example, in mammalian fibroblasts, Rho
induces stress fibers and focal adhesions, E^c induces lamellipodia and membrane ruffles, and Cdc42 induces the formation of filopcdia and microspikes (Dutartre et al.
19%; Nobes et al. 1995; Ridley and Hall 1992; Ridley et al. 1992). Furthermore,
RhoGTPases regulate cellular events using pathways independent of the cytoskeleton, including cell growth and proliferation, gene expression, yeast cell wall biogenesis, activation of NADPH Oxidase, and receptor mediated endocytosis and exocytosis
(Dieckmann et al. 1994; Drgonova et al. 1996; Freeman etal. 1996; Hilletal. 1995;
Lamazeetal. 1996; Narumiya 1996; Qadotaetal. 1996; Urichetal. 1997).
Intriguingly. over 15 RhoGEFs and RhoGAPs each have been identified whereas only a few RasGEFs and RasGAPs seem to exist (Bokoch et al. 1994;
Lamarche 1994; Tapon and Hall 1997). The ability ofcells to differentially regulate functions mediated by the various Rho-type proteins may occur through specific GEFs or GAPs. It has been suggested that RhoGEFs and RhoGAPs, not the RhoGTPases, may be the critical molecular switches in the Rho signalling pathway (Bokoch et al.
1994; Lamarche 1994; Tapon and Hall 1997).
Here. I review the current literature describing RhoGEFs and their specific contibution to regulation and integration of Rho signaling cascades; the components of
Rho signaling cascades; molecular mechanisms for Rho pathway mediation of cytoskeletal events, and the role of Rho signaling in morphogenesis.
RHO GUANINE NUCLEOTIDE EXCHANGE FACTORS
Stractaral Domains of RhoGEFs
The RhoGEF domain was first identified in DBL, a human oncogene isolated from a B-cell lymphoma (Eva and Aaronson 1985; Eva etal. 1987; Eva etal. 1988; 51
Ron et al. 1989; Ron et al. 1991). This identification led to the characterization of a
distinct class of proto-oncogenes (inducing DBL, VAV. Tiam-1, ost, ect2, dbs, TIM, Ifc
and Ibc) isolated using an in vitro screen for transformation capability (Chan et al. 1994;
Fasano et al. 1984; Glaven et al. 1996; Habets et al. 1994; Horii et al. 1994; Zheng et
al. 1994). This same approach had been used successfully to isolate several members of
the Ras gene family. All share two common domains, an approximately 250 amino acid
Cdc24. Dbl homology (DH) or RhoGEF domain, and a 1(X) amino acid pleckstrin
homology (PH) domain immediately downstream of the RhoGEF domain (Adams et al.
1992; Evaetal. 1988; Habets etal. 1994; Hartetal. 1991; Horii etal. 1994; Mikl et
al. 1993). The DH domain is required for Rho-type GEF activity, and the PH domain is
believed to be required for membrane orcytoskeletal targeting (Cerione and Zheng 1996;
Hart et al. 1994). Truncation of the amino terminus of these genes results in
transforming potential; and deletions or mutations in the RhoGEF or PH domains can
abolish the ability to transform (Eva et al. 1987; Habets etal. 1994; Hartetal. 1994;
Horii etal. 1994; Michiels et al. 1995; Mikietal. 1993; Ron etal. 1989; van Leeuwen etal. 1995; Whitehead etal. 1995b; Whitehead et al. 1995a). Additionally, RhoGEFs
may contain other functional motifs, such as SH2 domains, SH3 domains, actin binding domains, or diacyglyceral binding regions (Castrena and Saraste 1995; Cerione and Zheng 1996).
RhoGEF Activity
Biochemical characterization of RhoGEFs reveals that their specificity for a particular RhoGTPase substrate is remarkable. Cdc24 catalyzes the exchange on Cdc42 in yeast; Dbl catalyzes exchange on Cdc42 and RhoA, but not on Rac 1 or TC10; Ost catalyzes exchange on Cdc42 and RhoA, but not on Ha-Ras, RaplA, TCIO, RhoB, 52
RhoC. RhoG. Racl or Rac2 and so forth (Hart et al. 1991; Zheng et al. 1994). Recent work suggests that each RhoGEF binds its GTPase in a unique manner. Chimeras and site directed mutagenesis were employed to map the residues of Rho and Cdc42 that specified interactions with Lbc and Cdc24 respectively (Li and Zheng 1997). In contrast with other Ras superfamily members, the region for RhoGTPase specificity for a particular GEF is not discretely localized, and residues involved vary between different
GEFs (Parketal. 1994; Quilliametal. 1996: Quilliametal. 1994). With RhoA and
Cdc42Hs, multiple regions of amino acids are involved in GEF binding and GDP release and residues specific for RhoA/Lbc interaction are different from those required for
Cdc42Hs/Cdc24 interaction. Furthermore, mutations that abolished RhoA/Lbc interactions preserved sensitivity to Dbl and GAP (Li and Zheng 1997). Multiple sites have also been shown to be required for Racl interaction with PAK and BCR (Bokoch et al. 1994). This suggests that there may be a unique activation mechanism of Rho proteins with their cognate GEFs.
Tyrosine kinase function has been shown to be required upstream of RhoA and it is possible that RhoGEFs are activated by tyrosine kinases (Nobes et al. 1995: Ridley and Hall 1994: Zigmond 1996). Several RhoGEFs become tyrosine or serine phosphorylated upon growth factor stimulation; and in the case of Vav this phosphorylation is required for its GEF activity (Gulbins et al. 1994; Horii et al. 1994;
Wu et al. 1995).
The Pleckstrin Homology Domaiii
Pleckstrin Homology (PH) domains are 100-120 AA structural modules found in many molecules involved in cell signalling or cytoskeletal regulation. They were first identified in pleckstrin. the primary substrate of protein kinase C (PKC). in activated 53
blood platelets. The majority of PH domain proteins can be classified into seven groups:
serine threonine kinases, tyrosine kinases, regulators of Rho/Rac and Ras family
GTPases. endocytotic GTPases, signalling adaptors, cytoskeletal associated molecules,
and lipid associated enzymes. Many of these proteins also have SH2 and SEi3 domains
and/or SH3 or SH2 binding domains (Gibson et al. 1994: Ingley and Hemmings 1994;
Lemmon et al. 1996; Shaw 1996).
PH domains have been reported to interact or bind several types of molecules. The PH domains of beta-ARK. Btk. PLCyl, lRS-1 and Ras-GRF have been shown to
bind to plasma membrane-associated Py subunits of trimeric G proteins (Inglese et al.
1995; Ingley and Hemmings 1994; Kochetal. 1993; Pitcher etal. 1992: Touharaet al. 1994). GPy is localized to the membrane by isoprenylation of GPV' so a protein
binding Gpy would be co-localized. This could represent a general mechanism for
targeting PH containing proteins to the membrane. The PH domain of B-ARK and beta-
spectrin bind to WD40 repeats, sequences with a large proportion of Trp-Asp (WD) that
are about 40 aa long (Wang et al. 1995; Wang et al. 1994). The N terminal region of PH domains from several proteins, including PLCyl, pleckstrin. and spectrin, have been shown to bind inositol 4,5 triphosphate (IF3) and/or phosphatidyl inositol 4,5
biphosphate (PIP2) (Abrams et al. 1995; Burgering and Coffer 1995b; Cifuentes et al.
1994; Cifuentes et al. 1993; Davis and Bennet 1994; Harlan etal. 1994; Hyvonenet al. 1995; Kanematsu 1992; Konishietal. 1996; Lemmonetal. 1996; Lombardoetal.
1994; Yagisawa 1994; Yaoetal. 1994; Zhang etal. 1996; Z^engetal. 1996). It has been proposed that PH domains may direct membrane targeting by phospholipid binding
(Ferguson et al. 1995; Hyvonen et al. 1995). The PH domains of Btk kinases and the
Akt/Ran/PKB serine threonine kinases interact with PKC (Konishi et al. 1994; Yao et al. 1994). 54
There is abundant evidence to support the hypothesis that the function of pH domains is membrane localization (Shaw 1996). Among the most convincing evidence are substitution experiments such as a study of the RhoGEF Lfc where a small deletion in the PH domain abolishes transformation capability, yet addition of a C-terminal CaaX box that has an isoprenylation site and would direct the protein to the membrane restores transformation ability. The interpretation of this result is that the PH domain is responsible for membrane localization necesary for the regulatory activity of the DH domain. Ras, Rho/Rac protein substrates of DH/PH proteins are membrane localized, and all reported cytoskeletal proteins containing PH domains are associated with vesicles on the plasma membrane. However, the PH domain in DBL has also been shown to target DBL to the insoluble cytoskeleton fraction of the cell and not the membrane (Zheng et al. 1996).
Cellular Roles for RhoGEFs
RhoGEFs influence the actin cytoskeleton in a manner which corresponds with their cognate RhoGTPases. Expression of activated Vav or DBL, which catalyze exchange on Rho, increases formation of stress fiber and focal adhesions, while mutant
Tiam.which catalyzes exchange on Rac, increases membrane ruffling and invasiveness
(Bonnefoy-Berard et al. 1996; Habetsetal. 1994; Michiels et al. 1995; van Leeuwen et al. 1995). About 12 RhoGEFs have been biochemically characterized and have GEF activity for Rho, Rac or Cdc42, or a specific combination of the three(Hart et al. 1991;
Zheng et al. 1994). The ability of cells to differentially regulate functions mediated by the various Rho-type proteins may occur through activation of specific GEFs (Bokoch et al. 1994). 55
RhoGEFs may play a role in integration of Rho signalling pathways. Although different RhoGTPase cascades regulate separate aspects of the cytoskeleton Rho, Rac and Cdc42 seem to have some shared functions: and there is cross-talk between Rho pathways. Activating Cdc42 induces filopodia, then lamelipodia, and finally focal adhesion and stress fibers, implying that these three cascades may be linked. Supporting this notion, activation of Rac results in lamellipodia, followed by focal contacts and stress fibers (Chant and Stowers 1995). RhoGEFs may serve to couple the functions of
RhoGTPases. The RhoGEFs DBL, Ect2, Ost, and Tiam I can interact with two or more
RhoGTPases subfamily members (Cerione and Zheng 1996; Horii et al. 1994). Trio, a protein which binds the LAR transmembrane tyrosine phosphate and has a protein kinase domain, also has separate GEF domains for Rac I and RhoA. Trio is proposed to be a coordinator of the Rac I and RhoA pathways for cytoskeletal reorganization and cell matrix interactions(Debant et al. 1996).
RhoGEFs have several interesting attributes apart from GEF activity.
RhoGEFs generally contain other functional motifs, such as SH2 domains, SH3 domains, actin binding domains, or diacyglyceral binding regions, which implies other varied duties (Castrena and Saraste 1995; Cerione and Zheng 1996). In fact. RhoGEFs do not have the same cellular effects as the RhoGTPases they activate. While the cytoskeletal phenotypes of activated RhoGEFs are similar to the effects of activation of their RhoGTPases. RhoGTPases do not transform cells as readily as their GEFs.
(Khosravi-Far et al. 1994; Prendergast and Gibbs 1994; Qiuetal. 1997; Symons
1996). This suggests that RhoGEFs may have a greater cellulcir role than that of a simple biochemical activator.
A piquant question is whether the DH/PH domain itself has functions apart from GEF activity. RhoGEFs are associated with the plasma membranes of several cell 56
types, and it has been proposed that an additional purpose of these proteins is to escort
their activated RhoGTPases to the membrane (Bokoch et al. 1994). RasGRF is a GEF
for Ras that also contains a predicted DH/PH domain, although no GEF activity is
detected for RhoGTPases. Interestingly, mutations in the DH/PH domain analogous to
those known to abolish GEF and/or transforming activity in DEL greatly inhibit
activation of the Ras pathway by calcium, suggesting an important role other than
exchange activity (McCollam et al. 1995). BCR and Ect carry DH/PH domains that are
required for transformation, but do not have GEF activity for any GTPase (Cerione and
Zheng 1996)
RHO SIGNALLING PATHWAYS
Upstream Activators of Rho Pathways
While Ras functions downstream of receptor tyrosine kinases (RTK), studies of
reorganization of the actin cytoskeleton in response to agonists and dominant negative
GTPases and of membrane localization of RhoGTPases in response to stimuli suggest that Rho-family GTPases respond to more diverse extracellular signals (Symons 1996;
Tapon and Hall 1997; Zigmond 1996).
Rho has been shown to mediate induction of cellular events by hetereotrimeric
G proteins and RTKs (Buhl et al. 1995; Laudanna et al. 1996; Sah et al. 1996; Xu et al. 1996; Zhang et al. 1996). Several RTKs, including the epidermal growth factor receptor (EGFr), the platelet-derived growth factor receptor (PDGFr) and the insulin receptor, are known to activate membrane ruffling and formation of lamellaepodia by Rac
(Hessetal. 1997; Peppelenbosch et al. 1996; E?idleyetal. 1992; Zigmond 1996). A number of experiments indicate that PI3-K is necessary for activation of Rac by RTKs 57
(Divecha and Irvine 1995: Hawkins etal. 1995; Nobesetal. 1995; Pawson 1995;
Ridley and Hall 1994; Ridley et al. 1992; Wennstroni 1994).
Downstream Targets of RhoGTPases
Physical targets of Rho, Rac and Cdc42 have been identified using affinity
chromotography and yeast two-hybrid screens. While Ras has been shown to activate
the mitogen-activated protein kinase (MAPK) pathway, recent work implicates other
serine-threonine kinases as Rho conduits. RhoA interacts with two different classes of
serine-threonine kinases, Rho Kinases and Protein Kinase N (PKN). RhoA, Rac I and
Cdc42 have also been shown to regulate the c-jun amino-terminal kinase (JNK)
signalling, p38/RK and the pp70 S6 kinase pathways (Symons 1996: Tapon and Hall
1997). Tyrosine kinases have also been shown to be required for RhoA action and to
bind to Racl and Cdc42Hs (Symons 1996; Tapon and Hall 1997).
Several lines of evidence indicate that RhoA can activate Phospholipase D
(PLD). PLD catalyzes the production of phosphatidic acid (PA), a putative intracellular
messenger and mediator of the actin polymerization. (Kwak 1995: Ohguchietai. 1995.
Frohman and Morris 1996; Hess etal. 1997; Schmidt etal. 1996). Three other proteins
have been found to bind RhoA: rhophilin. rhotekin and citron. Rhophilin and rhotekin
share homology with PKN in a 70 AA region which binds RhoA called the Riio
effector motif class 1 (REM-1) (Madaule et al. 1995; Reidetal. 19%; Watanabe et al.
1996).
In yeast, GTP-bound Cdc42p interacts with Bnil. Bnil binds actin, and two
actin associated proteins, profilin and Bud6p. In mammalian cells, Cdc42Hs interacts
specifically with a GTPase binding site in WASP, the product of the Wiskott-Aldrich
syndrome locus (Aspenstrom et al. 1996; Symons 1996; Tapon and Hall 1997).
I i 58
WASP is involved in rho-dependent actin polymerization, and T-celis from Wiskott-
Aldrich syndrome patients have an unusual morphology suggesting an abnormality in
cytoskeleton organization (Kirchhausen and Rosen 1996; Tapon and Hall 1997). In
phagocytes, GTP-bound Rac directly interacts with the p67hox protein which is part of
the multimolecular complex that activates NADPH oxidase (Dieckmann et al. 1994).
POR-1, a leucine zipper containing protein which may play a role in membrane ruffling, interacts with Rac I in yeast (Van Aelst et al. 1996). IQGAP interacts with both Rac and
Cdc42, and has a number of interesting domains including a calmodulin-binding domain, a WW domain, an SH3-binding comain, and a RasGAP-like domain (Tapon and Hall 1997). An 18 AA binding motif designated CRIB (Cdc42/Rac interactive binding) has been identified as being in common with the Cdc42 or Rac binding sites on
WASP, p65f*^^, and pl20^C^. More than 25 proteins in Genbank have been found to have this motif (Berbelo et al. 1995: Tapon and Hall 1997).
MOLECULAR MECHANISMS FOR RHO PATHWAY REGULATION OF
THE CYTOSKELETON
Rho subfamily members appear to have distinct roles in regulation of the actin cytoskeleton, which controls cell shape, motility and adhesiveness. In mammalian fibroblasts, Rho induces stress fibers and focal adhesions, Rac induces lamellipodia and membrane rufTles. and Cdc42 induces the formation of filopodia and microspikes
(Dutartre et al. 1996; Nobesetal. 1995; Ridley and Hall 1992; Ridley etal. 1992).
However, roles of Rho proteins are not static. Rho proteins seem to affect different cytoskeletal events depending on the cell type. In the KB cell line both Rac and Rho 59
induce membrane ruffling, in neuronal tissue culture cells RhoA induces cell rounding
and retraction of neurites instead of stress fibers. Depending on the cellular background
and stimulus, Rho, Rac and Cdc 42 have all been shown to be required for formation of
focal attachments (Eaton etal. 1995; Narumiya 1996; Nobesetal. 1995). In polarized epithelial cells, Rho plays a role in organizing actin associated with tight junctions, and therefore regulating tight junctions (Nusrat et al. 1995). Rho proteins have other roles in organizing the cytoskeletal architecture, including formation of the contractile ring and cytokinesis(Larochelleetal. 1996; Mabuchietal. 1993).
A dynamic actin cytoskeleton is the fundamental force behind changes in cell shape and mobility. Elongation of actin filaments is achieved by increasing the availability of free barbed (plus) ends, by increasing the availability of actin monomers, and by stabilizing F-actin. Two proteins regulate remodeling of the cyto-architecture.
Profilin. a G-actin binding protein, generally promotes actin polymerization by increasing availability of actin monomers. Gelsolin destabilizes actin structures.
Increases in phosphatidylinositol (PI) turnover are frequently correlated with actin polymerization (Apgar 1994; Apgar 1995; Divecha and Irvine 1995; Gipsetal. 1994). Phosphatidylinositol 4.5 bisphosphate (PIP2) modulates the actin regulators profilin and gelsolin. RhoGTPases have been shown to be involved with phosphatidyl inositides and with profilin. Additionally, direct links have been established between Rho pathways and the cytoskeleton.
Several studies indicate that RhoGTPases influence PI signalling by upregulating activity of kinases involved in generation of phosphotidyl inositide second messengers. In permeabilized platelets, a strong link has been established between
Racl, phosphotidyl inositol signalling and actin polymerization. Activated Racl mediates rapid incorporation of phosphate into PIP2 which promotes uncapping of F- 60
actin, presumably by increasing the availability of barbed ends for elongation (Hartwig et
al. 1995; Zigmond 1996). Cdc42 and Rho increase phosphatidylinositol 4-phosphate 5- kinase (PIP5K) activity in Swiss 3T3 cells resulting in increased production of PIP2
(Chong et al. 1994). Rho physically associates with PIP5K, which provides a
substantive link in the pathway between Rho and cytoskeletal regulation (Ren et al.
1996). Inhibition of phosphatidyl inositol 4,5 bisphosphate 3-kinase (PIP3K) activity
blocks induction of membrane ruffling in Swiss 3T3 cells by PDGF and the insulin
receptor, both previously demonstrated to be mediated by Rac (Ridley et al. 1992). In
Saccharomycescerevisiae. a phosphatidylinositol kinase homolog, T0R2 interacts with
ROM2, a RhoGEF. which activates Rho I and Rho2 (Schmidt et al. 1997).
In yeast. OTP-bound Cdc42p complexes with Bnil. Bnil also binds actin. and
two actin associated proteins, profilin and Bud6p. All four of these proteins localize to
the tips of mating projections. Bni 1 is a member of the formin gene family . which
includes cvappwcc/AW (Emmons etal. 1995; Evangelista et al. 1997). Formins have roles
in the establishment of cell polarity, cytokinesis and vertebrate limb formation. Formins share two regions of sequence homology designated Formin Homology I (FHl) and
Formin Homology 2 (FH2) (Emmons et al. 1995; Evangelista et al. 1997). A pathway is proposed in which pheromone signal stimulates the OTP activation of Cdc42p which binds Bni 1 p. Bni 1 p interacts with profilin and Bud6. which leads to actin assembly and morphogenesis (Evangelista etal. 1997). Also, in Listeria monocytogenes, the vasodilator-stimulated phosphoprotein (VASP) binds profilin and is thought to increase availability of monomeric actin (Dutartre et al. 1996). WASP, the product of the
Wiskott-Aldrich syndrome locus, which interacts with Cdc42 and is involved in rho dependent actin polymerization, shares sequence homology with VASP (Symons 1996). 61
Rho may interact directly with the cytoskeleton. Rho Kinase, a serine-threonine
kinase which acts downstream of Rho, is required for stress fiber and focal adhesion
formation in fibroblasts (Amano et al. 1997; Leung et al. 1996). Rho Kinase stoichiometrically phosphorylates myosin light chains, which facilitates actin mediated activation of myosin ATPase (Amano et al. 1996; Kureishi et al. 1997). RhoA binds
both the myosin binding subunit of myosin phosphatase (MBS) and Rho Kinase which induces Rho-kinase to phosphorylate and inactivate MBS. This binding allows the increase of myosin light chain phosphorylation, activation of myosin, and polarization of actin/myosin bundles to form stress fibers (Kimura et al. 1996). Rho kinase has also been proposed as a candidate for cleavage furrow kinase, based on its ability to phosphorylate glial fibrillary acidic protein, an intermediate filament protein, at the same sites that are phosphorylated during cytokinesis in vivo. In vitro and in vivo, this phosphorylation inhibits filament formation, which is thought to be an essential step in cytokinesis (Kosako etal. 1997). Also, a rat and a human homolog of an unconventional myosin possesing an actin binding myosin head domain and a predicted
RhoGAP domain have been identified, presenting the possibility of a signal from the actin cytoskeleton to Rho (Reinhard et al. 1995; Wirth et al. 1996).
RHO PATHWAYS CONTROL CYTOSKELETAL CHANGES IN
MORPHOGENESIS
Rho pathways are important in orchestrating cell shape changes and movements in development and have been investigated in yeast and Drosophila. Both the Cdc42 and Rho pathways are involved in establishment of yeast cell polarity and cell wall biogenesis (Chant 1994; Chant 1996; Drgonova et al. 1996; Imaietal. 19%; Matsui andTohe 1992; Qadotaetal. 1996; Yamochietal. 1994). In Drosophila, homologs of 62
Rho. Rac I, Rac2, Cdc42 and a novel subfamily member, RhoL, have been identified
and their roles in development are being investigated (Harden et al. 1995; Hariharan et
al. 1995; Luo et al. 1994: Murphy and Montell 1996). Three RhoGEFs have been
reported, as well as one [IhoGAP and homologs of PAK, focal adhesion icinase (FAK),
Jun-N-Terminal Kinase (JNK), and a phosphoinositide 3-ldnase (PI-3K) (Barrett and
Settleman 1997; Fox and Hynes 1997; Guichard et al. 1997; Hou et al. 1997; Leevers
etal. 1997: Riesgo-Escovarand Hafen 1997; Soneetal. 1997; Werner and Manseau
1997). The Drosophila Rho genes have largely been identified through sequence similarity, so. except for a Rho recendy identified in a P-element screen, mutant alleles are not available for genetic experiments (Meyer and Parkhurst 1997). Nevertheless, studies using constitutively active and dominant-negative transgenes have demonstrated
that Rho proteins alter cell shape, influence cell motility, and regulate formation of actin based structure throughout Dro.wpAj/a development. A common finding is that changes seen with mutant Drac I or Dcdc42 are distinct, supporting the notion that different subclasses of Rho-like genes have separable functions and act in specific cells.
Rho Pathways are Important in Establishing Ceil Polarity
In yeast, budding cells organize their actin cytoskeleton in a polarized fashion with actin concentrated in the emergent bud. Likewise, pheromone signaling causes yeast cells to acquire a polarized morphology referred to as a "schmoo". The actin cytoskeleton and mating proteins are localized to projections in the cell surface that are aimed at the mating partner (Leberer et al. 1997). Cdc42p and its GEF, Cdc24p, are essential for these changes in cell polarity and morphology (Chant 1994; Chenevert et al.
1994; Li et al. 1995). Cdc42p and Cdc24p are localized to areas of polarized growth in the growing bud, and to the tips of the mating protrusions (Chant 1996). Yeast Rho I, 63
Rho3, and Rho 4 have also been rep>orted to be required for cell polarity and control of
bud growth (Imai et al. 1996; Matsui and Tohe 1992; Yamochi et al. 1994). In
mammalian cell lines. Cdc42 regulates polarization ofT helper cells toward antigen
presenting cells (Stowers 1995). Rholp, the RhoA homolog, has been shown to be
required for cell wall biogenesis and cell cycle progression. Rholp, which colocalizes
with cortical actin in the bud neck and growing bud tip, is involved in bud site selection
and has been shown to have two distinct extra-cytoskeletal roles in yeast cell wall
biogenesis (Drgonova et al. 1996; Qadotaetal. 1996). It transduces a protein kinase C
(PKC) mediated signal via a kinase cascade that regulates genes involved in cell wall
synthesis. It also acts directly as a regulatory subunit of beta( l-3)glucan synthase.
RhoGTPases Play Cell-type Specific Roles in Ovarian Development
Murphy and Montell investigated the role of Rho proteins on actin-driven events
in oogenesis and isolated a new member of the Rho family, RhoL (Murphy and Montell
1996). They misexpressed constitutively active and dominant negative Rho proteins
spatially and temporally during oogenesis. They used heat shock inducible transgenes to
test the effects of expression of these constructs during oogenesis, and used a UAS
promoter driven transgene in fly lines with Gal 4 expressed specifically in follicle cells,
in a specialized follicle cell called the border cell, and in other subsets of follicle cells at critical times in oogenesis. The changes seen with mutant Dracl or Dcdc42 are distinct, again suggesting that different subclasses of Rho-like genes have separable functions and act in specific cells during ovarian morphogenesis (Murphy and Montell 1996).
RhoL is involved in the cyto-architecture of both the germline nurse cells and the somatic follicle cells. The dominant-negative DrhoL transgene brings about multiple defects in the nurse cells. Nurse cells fuse and collapse, ring canals are aggregated. 64
nuclei condense, nurse ceils are multinucleate, and contacts between the nurse cell and
the follicle cells become disrupted. Dominant negative RhoL alters the follicle cells
surrounding the oocyte so that they become thick and irregular. Expression of
constitutively active DrhoL results in breakdown of subcortical actin in the nurse cells,
disruption of nurse cell/follicle cell contacts, and apoptosis of nurse cells (Murphy and
Montell 1996).
Both constitutively active and dominant negative Cdc42 completely reorganize
the nurse cell cytoskeleton. Cortical F-actin is disrupted, ring canals aggregate and are
also structurally disorganized, nurse cells collapse and fuse together, and some nurse
cells are multinucleate. Cdc42 does not influence the somatic follicle cells. Dracl is specifically required for initiation and maintenance of migration of the border cells. In wild-type border cells, dramatic reorganization of actin filaments occurs as migration is initiated. F-actin is formed and actin rich processes extend out from border cells
between the nurse cells, and filopodia-like structures are also formed. After migration is completed, there is only diffuse cytoplasmic and cortical staining of F-actin. Expression of the dominant negative Rac(Nl7) protein generally abolishes the presence of actin rich processes in between nurse cells. Border cell migration is arrested, and the degree of this arrest correlates with the level of transgene expression. No border cell migration defects are observed in this sytem when dominant negative RhoL and Cdc42 transgenes are used, suggesting that Racl has a specific role in the border cells (Murphy and
Montell 1996).
Drac I and Dcdc42 are required for transfer of the nurse cell cytoplasm to the oocyte. Dominant negative forms of all three of these Rho proteins prevent the formation of an actin cage that holds the nucleus in place, and consequently the ring canals become obstructed by nurse cell nuclei as the contents of the nurse cell are pushed through the 65 ring canal towards the oocyte. This obstruction produces a phenotype of very small eggs due to a failure of complete cytoplasmic transfer, similar to the phenotype seen in mutants of chickadee, the Drosophila homologue of profilin. Constitutively active
Cdc42 resulted in milder defects in the symmetry of the actin cage (Murphy and Montell 1996).
Rac Influences Epithelial Cell Shape Daring Embryogenesis
Harden et al. (1995) identified two fly genes DRacA and DRacB. homologous to mammalian Rac 1 and Rac2 (Harden et al. 1995). They expressed a dominant negative transgene of RacA during embryonic development and found that expression of a dominant negative Drac I in the embryo altered cell shapes and led to defects in dorsal closure, germband retraction and head involution. Specifically, they report that the defects in dorsal closure are due to disruption of cell shape changes in the lateral epidermis. As a result, the cuticle appears buckled. Patches of actin and myosin colocalize in the leading edge of the dorsal epidermis of the Drosophila embryo and changes in the shape of the dorsal epidermis are thought to be due to a localized accumulation of actin and myosin (Harden etal. 1995; Young etal. 1991). In dominant- negative embryos, Harding et al. observed dramatic reductions in actin accumulation along the membranes of the amnioserosa cells and the leading edge cells of the epidermis. There was a good correlation between the severity of the other heat shock induced effects such as dorsal closure defects and abnormalities in cell shape, and the loss of actin and myosin in the leading edge. They propose that DRacA may regulate changes in epidermal cell shape (Harden et al. 1995). Harden et al. also report the isolation and characterization of a Drosophila homolog of the serine/threonine kinase
PAK. DPAK which binds GTP-activated DracA and Drosophila Cdc42. DPAK is 66
involved in cytoskeletal remodelling in the leading edge of migrating epidermal cells
during dorsal closure, suggesting that it may be a downstream member of the DRac1
pathway (Harden et al. 1996).
Cdc42 and Rac Have Cell-type Specific Effects in Larval and Papal
Development
Investigation of the role of Dcdc42 and Dracl in morphogenesis of the wing disc finds that the two GTPases control separate aspects of epithelial morphology.(Eaton et al. 1995: Eaton etal. 1996). Expression ofdominant negative Dcdc(S89) or Dcdc(N 17) in subsets of cells in wing disc epithelial cells brings about severe shortening of elongated columnar (EC) cells. EC cells have a characteristic pattern of actin rearrangement where actin is concentrated basally. In the transgenically shortened cells, basal accumulation of actin does not occur. Normally. Dcdc42 protein is localized more abundantly in both the apical and basal region of the EC cells, suggesting that Dcdc42 promotes basal actin accumulation. In the adult wing, 30% of clones expressing the transgene on both the dorsal and ventral sides have wing blisters, indicating that Dcdc42 is involved in adhesion or apposition of the basal surfaces of the two epithelia. All hairs in clone cells are either stunted or absent, and Dcdc42(N17) prevented localized actin polymerization (Eaton et al. 1996). Expression of dominant negative Drac l(N 17) in a subset of cells in wing disc epithelial cells eliminates actin structures at adherens junctions, indicating that Drac I regulates actin assembly here. E-cadherin and beta- catenin (armadillo protein) are localized normally, suggesting that Dracl operates downstream or independently of these proteins. Adult wings are thinner due to a reduction of cells in the anterior compartment where Oracl(N 17) is expressed, which 67
together with examination of cell histology indicates that Dracl(Nl7) increases cell
death. Wing hairs on Drac I mutant cells have normal morphology but cells have
multiple hairs and hair associated actin, which typically is projected from where the cell
contacts its distal neighbors, accumulated in multiple sites of cell/cell contact.
Disruption of junctional actin and microtubules associated with the hair outgrowth side
were observed (Eaton et al. 1996). Expression of a constitutively active Dcdc42V12
transgene resulted in too much cell death to be informative (Eaton et al. 1995; Eaton et al. 1996).
Neuronal expression of constitutively active or dominant negative Drac I results
in defects in axon outgrowth in peripheral neurons, and expression in muscle precursors
results in defects in myoblast fusion to form multinucleate muscle cells. Other aspects of
muscle development, such as the overall patterning of myogenic precursors and muscle
specific gene expression are normal. Constitutively active Cdc42 also produces defects
in axon outgrowth that are distinct from those of mutant Dracl (Luo et al. 1994).
Drosophila RhoGEFs and RhoGAPS
In addition to the predicted RhoGEF I describe, two other Drosophila genes with this homology have been reported. Sone et al. isolated still life in a screen for loci that influence motor control, still life protein is found primarily in neurons and is located near the plasma membrane of synaptic terminals. Expression of a truncated still life construct, predicted to produce a constitutively active GEF, in synapses disrupted the nervous system. Motor terminal arborization was abnormal and axon elongation was disrupted. Expression of the construct in human KB cells brought about altered actin localization and membrane mffling (Sone et al. 1997). Barret and Settleman isolated a
RhoGEF as a dominant suppressor of a Rhol induced rough eye phenotype. Mutant 68
homozygotes failed to gastrulate and had severe defects in embryonic morphogenesis
(Barrett and Settleman 1997).
A Drosophila RhoGAP, RnRacGAP, was identified in the rotund locus by
sequence similarity. The rotund locus has been shown to be important for
morphogenesis of appendages during pupal development; however, there may be other
genes in this locus besides RnRacGAP (Guichard et al. 1997; Hoemann et al. 1996;
Kerridge andThomas-Cavtllan 1988). Experiments with overexpression of RnRacGAP
during cellularization produced dramatic alteration in cell shape. Cells which are
normally apical were flat and extended. These changes were concomitant with
abnormalities in the actin cytoskeleton. Actin was uniformly distributed instead of the
usual cortical organization. In pupae, overexpression of RnRacGAP brought about abnormalities in wing morphology, consisting of notches, disorganized margins, holes,
missing vein parts, elongated wings and extra crossveins, as well as forked bristles and defects in abdominal closure. Various defects were brought about by different critical
periods of overexpression (Guichard et al. 1997).
CONCLUSIONS
Rho signaling cascades have been shown to regulate morphogenetic cytoskeletal changes throughout Drojo/?/i//a development (Eaton et al. 1995; Harden etal. 1995;
Luoetal. 1994; Murphy and Montell 1996). RhoGEFs are activators of the Rho pathway and are hypothesized to differentially regulate functions mediated by the various
Rho-type proteins(Bokoch et al. 1994). I have identified a gene, DrtGEF, that has substantial sequence homology to RhoGEFs. mRNA transcripts from this gene are found throughout oogenesis and embryogenesis. In the embryo, mRNA is highly expressed in regions where cell shapes are changing and the cytoskeleton is likely to be undergoing reorganization, leading me to conclude that DrtGEF plays a role morphogenesis. 70
RESULTS
Isolation and Identification of a Drosophila RhoGEF Gene
In order to isolate the spir gene, I conducted a chromosomal walk in the 38C
region of the second chromosome. Complementation tests with deletion chromosomes
had been used to map spir to 38C5-6 (Fig. 3). I identified the region of the walk where
spir mapped to cytogenetically by hybridizing clones from the walk to polytene
chromosome, which I refer to as the 'spir region' (Fig. 4. p.38. Fig 5). In order to
identify restriction fragments from this region that might contain spir, I used reverse
northern analysis to identify genomic fragments expressed during oogenesis (Fig 5).
Southern blots of clones from the walk were screened with digoxygenein labeled cDNA
probes made from ovary mRNA. I isolated these fragments and used them to screen the
Tolias ovarian cDNA library. BlastP analysis of a partial sequence of one cDNA
(approximately 2{X) bp) revealed sequence similarity to a human ORF (accession #
435446) (Altschul et al. 19<50). ISREC (Swiss Institute for Cancer Research) prosite analysis of the human sequences identified putative RhoGEF. Pleckstrin Homology
(PH). SH3, and actin binding domains (Bairoch 1997a; Bairoch 1997b; Castrenaand
Saraste 1995; Nomura et al. 1994). The likely importance of such a protein in
Drosophila development led me to further study of this gene. Northern analysis using a probe made from the cDNA identifies a 3.8 kb transcript in ovary mRNA. TTiis cDNA was isolated using the 5.8 kb BamHI-NotI genomic fragment as a probe (Rg. 5) to screen the Tolias Drnsophlla ovarian cDNA library. I isolated cDNAs of three different lengths. 3.3 kb and 3.0 kb clones both contained a putative full-length reading frame.
The 3.3 kb clone had more of the 5' upstream region. A third 2.2 kb clone was 71
FIGURES: Genomic Map of the Region Containing DrtGEF. Transcripts found in ovaries are shown above the restriction map and include the Drosophila homologue of the Lupus Autoantigen (LA). Qones of genomic DNA in the region are indicated below the restriction map and include aTamkun cosmidclone (CI.7+6_3), fourTamkun phage clones (T5.8+91-1,75.8+2-1 and 75.8+5-4 and 76.2+1-1) and two PI (6-18 and 41-
63). B. BamHI; N, Notl. ovarian RlioGEF centromere transcript /V
B B B B B N 8 8 J I I 1 LJ \ I I
C6-3 X9-1 X2-1 X5-4 P1 6-18 PI 41-63 — 1 kb
-J N> 73
RGURE 6: DNA Sequence of DrtGEF. DNA and deduced protein sequence. Exon sequence is indicated by capital letters. Intron sequence is in lowercase. Asterisk indicates stop codon. 74
1-TTGCAGGCCCTGGTTTTCTAGGTTTCTATTTTGGTCGAGCGCTGTGTTTT 51- ATTTATGTTTGCCATGGGAAAAGAGAGTTGCTAAAAGTGCCTAAATACGT 101-GCACCTGGTTCACAAACGGGCGCTCCAACCAGTTGACCCCAGCCCCACGG 151- AATCGGCATATGAGTAAACAAGTATTTGAAAAAAATAGTGAGAGCAGTTC 201-AAATCGCGTCGGCCTAGAAAAGAAACCAAAAAATCGGGCAATAAATAGTG 2 51-AAAAGTGTGCTCCTTTTGCTATATAACCAATTGTGTATATATAATAACAA 3 01-GTGTGTGGATAAGTCGCGCAATCAACGAAACTTGGAAAACTAAACTATTA 3 51-GTCACTATTCTATTATTGCTCAACGAACGACAGGGAACAACAACAAACGG 4 01-ATCAACAAATGTTTGATAAAACGCAACGCAGCTGAAGgtgagcgaaaaac 4 51-taaagtggttaagaaaacccttcagacagcttggctgcaatatatctagc 501-cgtggaaatgaat caggttttccaataactgct cgtctggccaaaggtt c 5 51-agtggcatctgaaaattcaccccactatgcgtcatccaagtagaggca tc 6 0i-atagacatccccacaacggcagacacaatcaagccttcctataagaaccg 6 51-ccatgggtttttacatacatatatggcatatataataatagagcgggttt 7 0 l-tcttccttatttccccttgagattttaatatacccatactgctaaattct 751-tcatcgatgaagatatctcttacaagaagcatttagttgactgaattatt 801-gtttttttttttttttttttttttttttgtatttcaacactttcttt t aa 8 5i-gcaacatatttatatagaaaatctaatacatttttagacacatgacaaaa 901-tcctatttacgttaaaaacagtttcaatcgtttagtcccaacaaaggaca 9 51-tttaaagcttaaagctcaagaatacattttatgtaatgactcctgtactt 1001-tcggcacaactgttgttcaacttgctgctgctcgtgcaatagtaatttgt 1051-gccggtttctggagttcagaggtccgcctgcataatccattgggtcaata 1101-gcagggctcctcgtggggcatccgttccagctcctcccgaaaagcgtttg 1151-tttgctagcactcgctgcgaaagtaaaatgcactgccggacgacgacgga 1201-ggcacgttctgcctgccgctgcctgccgcatgccacctgcctcccggccc 12 51-caaactcccccattggattcccagaaccaacaagcatcattacccgaaca 1301-attttgaaccgctgccaagagaatttcctatgaaaggtggtggcaagctg 13 51-aatgcaaattcatgcttttctttactctcacatgatcttggtttcggcca 1401-ccaggtcaaaagcagtttgcaaaataaatagctaccctagaaaatattat 14 5l-ttaaatcaaattgaattatttcatggtttaaaaagttatatttgtttgta 1501-tatatttatgtggggaatgtgaaaaagtctagggtaagatctcgtcgaac 1551-cacttggctctttgcgccctatggttgttattcttacgctttaatgaaag 1601-catgttggcaatatctgtatgtgggcctgtgatttcccaaaacaaacatt 16 51-ggccgtcaaatcatgcgcctgattttcactcgtgtctgctgggaaaccgc 1701-gtttcttcatatttccgctgctgacctcgttcttggtgtgttggtgtcga 17 51-gaacagcggatccccacaagctattggaactcccactcgctcacctcttc 1801-ggtgtgcccacagccaccgatgacttcctcgccacgaagtatctataaat 1851-acggcgagcgacgcaatcaaactatattacgtccatatatctgaggaaat 19 01-gcatctcaagtggcggctgtgcagcctgtaaatctcggtattgacacatt 1951-gaagaggccttattgagtgcagttcggctgagctagtagggatagcgatt 2 001-cggatccggtcccgaccaggcagaactgcataaatttggtttgtctttgg 2 0 51-ctgactttgtttgtctttgccgctgactttgccaagcaaaacaatccact 2101-cgcctttcttttacatctctcgtctttgttgtttacgttccccagtgtcc 2151-cacgaaaataaacattcggtgatttgatttggggtgctcccctccgatgg 2 2 01-atgcgacgttttactcgccaaattgcgcatttccggaagcggcagggata 2 2 51-ttcatttgaatttcgccttcggcgacggatcgttaataaccgaaagagtt 2 3 01-gtctcttatactcagagagcgtgggcccggtgtatctgtatctgaaactt 2 3 51-gtatctgtatctgtatctggatatggggccgcatagccgatccgcgcggc 240l-gccatgtgcaagtttaatgaattaattaaaatttggttccgagagcttca 2 4 51-atggggtatgtatgcatctttgtatgtgcccacatatctgcgtgtgtgcc 2 5 01-gctcggtatctgcatttatgcatctgctcatctgacctccgatgcatcgt 75
2551- ttggagcaccaccacctacggaaatttga ttgtgcccggccatggactta ZSOl-aag-tgattt'cagggttaaacgaagcgaaggaaagtgacatacattcggct 26 5 l-tgggtttggcgctgcacttataaagcatattttttgccgacattctgatc 270l-tcggcagatttgaatacgaatattct:gtggaaaaaatatttagttcttgg 2 7 51-tcactctagctcaaaaattctccgtcggtctataagcttcaacatcttta 28 0 l-ttcagtagagtttacagttccagcctccttgtttgtctcagaatgaaagt 28 51-ctttgggttaaatttgatttatattctatcttaaattctaaaaatatgac 29 0 l-gaatttaacatttcctgaggccataatcccattaaaaccacaatgtgtgt 2951-cgcacgattctaaattttagattatacaagtctacacattccataaacgt 3 001-tt cctatgattcacgggcatata ttgtatgatcaacaggaaactgagcgg 3 051-aacaggtgaatttttctgaaataattctaaaatgcttgaatatgaagaag 3101-ttttcgattgatgactgaatccacaaacatggaagatctcacatccaata 3151-ggcaacccacatatattttggcacaaatatttttatgtggtttttttgaa 3 2 0 l-tagacaatacaaaagcacagcgagtgtcgcttatttctcaatgaaataca 3 25 l-attaagatcctcattttggaaacgcagatgaaaaggttgtccccggattc 3 3 0 l-atattttttgtcacatctctgttgatttttcatgaaaatatgcgatgtgt 3 3 5 l-ccggtcgaaaacgctcgcgtacatgtgaaaatatattcgaatctcctgcg 340 l-atccgacgagactctcagaaaatgactgcgagagtggcactttcggttgc 3451-ccgtggaaaattcgtctgccatatgtcgccagcttttcggtattttccgc 3501-ttttctcggcagtttcgctgaagcaatgaacgcgtgcggtgcatcgtctg 3 55 l-agagcagaaaaacggcgaaaaacgtcaaattgtcgtaccacaatttattg 3 6 0 l-tcgaaaaagtatatatcacccatctatacaaaagagtagcgggtatatgt 3 6 51-attcgagtgcctagatggcgaaaaagtgacattttaagaaattttcatgc 3 7 0 l-gtttgtgcaaccaaaacgtgaccttgccttagggaaatattctcatcagc 3 7 5 l-ctataaatcttgacaatctcatgagagcggtaataattcgtgaaaaacta 3 8 01-cacgttccagtttggcatatagaacttgcgatccgccaatatgtacactt 385 l-tcgtctgttttttatttttagtattctagaaaactatttgggcaaaataa 3901-accaagttgttcatatttttgcgtttactcattgcggcaatagcaaacaa 3 9 51-atgtgatgcatctatttttagaaaatatatcactttttaacattttcagt 4001-ccagaattgaatttttgcataaacataggaattcctatattaataaaagc 4051-acacgtcgcgctgccaattttaaatagtaccaacgaatagactaggctaa 4101-agacttttataaacgactttaaaaataatgacatccactaactagccccc 415 l-tagtgccactcatacaagagaccatttcaattaagctttggaatattggg 4 2 0 l-ggtttttgtgagtaacaatgtcgtaatataattttcgaggcattcgaaaa 4 2 51-tattgcgattttacttctttctatagatatctgatgtatagagtgcactt 4 3 0 l-gcctttagaatccaatgtgccaatcccatttccgtcaacgaaagtgttta 43 5 l-acgattgaatgaaatgttgatctcttaaagagttgttcgaacaaaccaaa 4401-t aaaaaaggtcgtaaatatttttagacgcgacgtggccgttgtttatgat 4 4 51-ttatatgttggcctgtcctgtccggctattcaaattgtttttatggcccg 4 501-aaaagtttttctttcacaatacgcgcgagtga tttttacccaattttt ta 4551-atggat cctcgcagcttgtgtgaccttggccatcgtgtagcgcacgagtt 4601-ttccagacacttgcagtaaactaggaaagaaaagccggaggggagtcgcc 4651-ggaaaagtgtcaagaaacttgcgcacgcgtttctcgacagatgttttcaa 4701-aatgttttcttctttggggccataattattgctcggctaattccaagagg 475 l-ctgaggaatgccgagcgatcgacgatgatgtagctcatcgctgcaataat 4 8 0 l-gcgtaggtgctgtatataacgagcgatatgctcacatatgctttttcatt 4 8 51-gagcaaattgcctggctgatgtttcaagttcaatacccatcgcctcgttt 49 0 l-cagTTGAATCAATCTAGTGCGGACTCGGATCAGCCCTGAACAATCCGATA 49 51-ATGGATCAGCCACTGGTGGTGCAGGCGGAGTACTCCTTCATGGGCAGCAA MDQPLVVQAEYSFMGS N 76
5001-TAACGACGGAGCTGTGCTTCCAGAAGGGCGATGTCATCACGGTTACCAGC NDGAVLPEGRCHHGYQR 5051-GCGAGGATGGTGGCTGGTGGGAGGGAACGCTGAACGATAAGACTGGCTGG EDGGWWEGTLNDKTGW 5101-TTTCCCAGCAACTATGTGAATGAGTGCAAGGTGCAGCTGCCTCTAACGGA FPSNYVNECKVQLPLTE 5151-GACCATGGCCGCCGGAGAGATCCAGGAGTATCGGTCTGTGGTGCTCAAGG TMAAGEIQEYRSVVLKD 5 2 01-ATCTGCTTGACTCGGAGCGCGCCCATGTGGCCGAGCTGCAGGGTCTGCTC LLDSERAHVAELQGLL 5 2 51-GAGAATTTCTTGGAGCCCATGCAACAGACGCAAATAttctctattctctg ENFLEPMQQTQI 5301-acataatttgaatataatctaaaagggcttcttctacagaCTCAGTCAG L S Q 53 51-GATGAGTACGCCCAGCTGATGTGTAACTTTGTAGAGATTGTGCGTACGCA DEYAQLMCNFVEIVRTH 5401-CGAGGATTTGCTTATCCAGATCGAGGAGTGCAACGATCGAGTGGGAAAAC EDLLIQIEECNDRVGKL 5451-TATTTCTCACCAGCGCCCCCTTGATGAAGAAGGTGCACCAGGCGTACTGC FLTSAPLMKKVHQAYC 5 5 01-GCTGCCCATCCAAAGGCCATTGTCATACTGGATAAGTACAAGtatgtgct AAHPKAIVILDKYK 5551-cctcgctttatatacatatattgtggtgttcaattgttaataaatataaa 56 01-tttttttctattccaaaagGACGAGCTGGAAAAGTATATGGAACGACAGG DELEKYMERQG 5 6 51-GCGCAGCCACTCCTGGATTACTTGTGCTCACGACGGGTCTATCAAAGCCC TAAPGLLVLTTGLSK P 5701-TTCCGGCGACTGGACAAATACTCGGCCATGCTGCAGGAGCTGGAGCGGCA FRRLDKYSAMLQELERH 5 7 51-TATGGAGAGCAGTCATCCGGATCGCGGCGACACCCAGCGGAGTGTTGCCG MESSHPDRGDTQRSVAV 5 8 01-TGTACAAAGACATAGCTGCCACCTGCTCGGCCACCCGTCGCCAAAAGGAG YKDIAATCSATRRQK E 5851-CTGGAGCTGCAAGTGCTCACGGGGCCAGTGCGTGGATGGCAGGGCCAAGA LELQVLTGPVRGWQGQ E 5 9 01-GCTGAGCACCCTCGGGGACATCATCCACATGGGCAGCGTTGCAGTTGGAG LSTLGDIIHMGSVAVGA 5951-CTGATCATCGCGACCGATACTTTGTGCTCTTCCCTCAAACATTGCTATTC DHRDRYFVLFPQTLLF 6001-CTTAGCGTTAGTCAGCGGATGAGTGCATTCATCTATGAGgtgggaaacac LSVSQRMSAFIYE 6051-aagcacaacatggcgaatttgtttgtaatctgttttcacacgcagGGCAA G K 6101-GCTACCCTTAACTGGGATCATAGTGAATCGCCTGGAGGACACGGATGCCC LPLTGIIVNRLEDTDAL 6151-TGAAGAACGCCTTTGAGATAAGCAGTCCCTTGATCGATCGCATTGTAGCA KNAFEISSPLIDRIVA 6201-GTTTGTCAGGGTCCGAATGAGGCCAACAAGTGGGTGGAGCTGCTCAATGC V CQGPNEANKWVELLNA 6251-CAATAATCCCAGCTTGCCGATGGGCATCAAACGGCAATTGAGTAACTTGA NNPSLPMGIKRQLSNLS 77
6 3 01-GCAACTCTTCGCTAGGACACCTAAATGCCGCGCATgtaagtagtatattt NSSLGHLNAAH 6 3 51-ctcctatatattcacctttattatcgtttcgttttggcgacactttaaac 6401-cgtgagcagctgagtcaaca tttgga 11 cacggggct actgcacgcga11 64 51-ctcgctgtgtgcctattactccagccccccgtgccatgtgcgacct.ct.cc 650 l-gtgtgactcttcccccaagcaattacccagcaacagctccgtacgccaa t 655 l-cttagtgctcactttgccaggcttgttaaaggcggcggactgaggagtgc 66 0 l-tatcgtaaagatgcttctgtatccgcaggctcgccagagcatcgatctca SSBl-aaaggattgcgttgcgcaaaaggcgttgtcacaaggcatctgcaaagtta 6701-aaagatctcaataccaatcaggattcggggcagtccgagttggaacgaca 6751-gaagatgattttttgcattcctgcgactcggatccgtttgaa t atgt gca 6801-gttttaccaaaacaagcggaacgattccatgtgcaactccacaggcacat 6851-tcgt:ggaccatggcacgggtgccaggaggcactgttcctctatcaacctc 6901-attaaa ttggattccgcggacacggacgaagttctagcgctcaacgagtt 69 51-aaaaaaggagtctcttgttataggatccagagcactaagagctttggctc 7001-ggaagtccacgactcgaaattccagtgtgcacacatccacggcaactttg 70 5 l-gagctaggtgtgggtggcagcatcacaaactgtgttgaggaagagccaat 7100-tcttaaggtcaagccatcgttctccctgcaacaacaaagttccgatgcga 7151-gttccatttttgcagctagattgggcggtgcattcaccgcctgcgagaat 7201-ctggccagtatgcctgatgatctcagcagggagtcgagtatccaagagcc 7 2 51-acccactcctctgccagcttcaccgacagaacggcacagcatgccgacca 7301-tatttgtgggcaatcggttcaaccacagcaaaaatacagaggtatatgta 7 3 5 l-ccgacgtggcgagatcgccaggaaatgcagaatcagagtgtggatgcgaa 7 4 01-gcaggatgaagagttgcactccagttccattgatctacccgccgcctgtc 7 4 51-tatctgctccggataaactgcaagcagaactactctacaattacgacgag 750l-atcctagaaaaacctctacagctgcatcgggagctaacgccctttccggg 7 5 5l-ccataatcttaactcggataagcgagtttcccacaaaagcgacagtccgt 7601-cgacaggaaatgcaaagacagatccaaatcttgccacaagaagtagttcc 7651-accaccgaactctgcatcgataccacttcaaaaaagcgcacaaccccgtc 7 7 01-agagagaagccgggattccattaggcgctgcattagctatcagttcctgc 77 5 l-agatgtccaatcgaccgccccctccaccaccgccacgcagggatccggat 78 01-ctacacttagacaccaaatgccgctgctgcgaaaactcccagtgtcccag 7851-tccgcgatcgagtgacagcggaatggctggcagttgcactattaca tcac 7901-cgga t ccgcccaatccggaatea tacttt cccatggaggccgcaggccac 79 51-gatttgctggataatgtggagccagagaggtttgatgtgtgcggaatgtt 8 0 01-cagagagaagttcctcactccggaggctactcaggatgttgttgatctat 8051-cagaggagcagcctcaact atcagatgaacccact acccct accaatcgc 8101-aaagaggaacctacttgcatcacctctgctcaagtgcaagtgaacacaag 8151-gagtatttttctgccctccagctcgagcatggatgagactaacaggaatg 8200- tcccagccaacaat atcct attt agctcgagttccgcggatcagttggaa 8251-ccgcaggccacctttcgctcggggatgtatgcgcactggtggaagaaaga 8 3 0 l-gcgccttccgccggaggtggtgcgtggcatagcccacgcctacaataaga 8351-gcttgccctccaaggactcaaaaga ttcgggat cggtgtgctccagctgc 8 4 01-ttctgttccctgggagctagcggttacagcgagggcgcactctactgctc 8451-ggtgtgccaaaactgtgcggact actacaacggcagtgtcaccagcacaa 8501-ccaacacgacgaccaccacatcatccgccagttgcccactgtgcagtgag 8 5 51-gacgagggcatgattgcccccacacacgactcgtcctcgctcgactgtcc 86 01-catatgtaatggccgcattgcttccggcgccgaagaaggcaagcaatccg 865 l-aaatggatcgacggccaggtaatctaaggattcctg-tcgaatgg-tatccg 8 7 01-gtttacctggctggcggcgtttgttccgtgcacgtgttacgtttgattgt 8751-tttgt:aaattcgttttgctctcatgttcaccaaattcaaaaatcccttat 78
8801-gctctaccagcaaccatttggccaaatgcagcacgtccaaaaaagtcatc 8 8 5l-acacattgcttcctcatcagcacatcctttgactaacccagtgcgagttc 8901-attatttgcccaaatttccaatggaattggtaataaaacaataagtaatg 89 5l-gcttttaaataaatttctttaaagaccagtctgaaataaacatttaaaat 9001-ttcatcaagtcaacaaatttattaaatgtgtaaataagtgaaactaaagc 9051-atatgatgtttgacttcaattaatatttgaatatgatgatttctgaattt 9101-tcggacttgcaaatggcattcaatgaacattggttctgtttttcctccct 9151-ccgctctgggcggtaatttcatccgtcgtaaagctaaacgaattacaaaa 9 2 01-cattaatctaacgctctacaacacaaaaattcgaaatgagaatgaaaatt 9 2 5l-acaaccaaaaaccaatcaaacgcattcgattcgatttgcttgctgcgctt 9301-aactcgctgcaggatttgcctgaaggattcacctgctgttgtacgttttc 9351-ttgttgctattgcaccgctgatcctgttgacggcgggccacatagagatt 9 4 01-ctttgattaaaactaacttacagtattttatgcgttaagattaaattaga 9451-gaaacacaaacactgttaaccagaacccttcatctcttgcattgtagATG M 9501 -TCGCCGCCATCAAGCCACATACTCCTACCGGCCGGCGGCTCCGCCAGCCA SPPSSHILLPAGGSASH 9551-CTCCCAGCAGCATCCCGGCCGGCAGCAGCAGCGGAGGGAGCCACAGCCAC SQQHPGRQQQRREPQPP 9601-CAGGGGTCTCCGGCCACCAACTCGATGTCGCATCACAAACGGAGCCAGTC GVSGHQLDVASQTEPV 9 6 51-GTTCAACCACCATCTCAGCTACAATCAGTACACGCCCACTCAGCCTCCAC VQPPSQLQSVHAHSAST 97 01-CACATCATCTGCATCCACCACAACCACCAAGTCTGCCAAGTCATCTGGGG TSSASTTTTKSAKSSGA 9751-CATCCGGCCCCAGATCAAGTTCAGCCCAGACACCAAACAGCAAGACAGCA SGPRSSSAQTPNSKTA 9801-GCTCCACTCCAGGCGTCATCCATGGACGCCAGTCCAGCAATTCAGGCAGC APLQASSMDASPAIQAA 9851-GGCACGAGCAGCGGCGGCAGCGGTGGGAATGGGGGTGCCAAGCGCAAGG A ARAAAAAVGMGVPSARK 9901-AAGGAAGCACAAAGgtgagaaattgagaccttactccgggatttgtatgt G S T K 9951-tttctacttactactcactccctgcctggttttctaaatttcccatcaca 10001-tattaatatttaaactaagcatcaaatgtgttttgcatctgcagGCTAAC A N 10051-TGGACCATCAGCTGCCTGCGACCCACGCCGCCGTTGCGACCCAGTTTATT WTISCLRPTPPLRPSLL 10101-GAATGCCACCAGCGGATCGGGAAGTGGCAGCGGTGGCAGCGGTGGCGGCG NATSGSGSGSGGSGGGG 10151-GCAGCAGCTCCAGCAATGCCCTGGCCAGCTACTGCAGCGGAAGGAAGAAC SSSSNALASYCSGRKN 102 01-CAGCCCACCTATGAGGAGGACGCCCTGGTGCTCCGGGTTTTCGAGGCCTA QPTYEEDALVLRVFEAY 10251-CTGTGCCGCCTATCAGAACAATGCCAGGAACACCATCCACTCGGggtaag CAAYQNNARNTIHSG 103 01-tggcgaagcccatcccagatgtgcttcatatagctgtaaggatttctatg 103 51-tgctcccgaaccaagtttgattataatttgctgaagaacaaaagctacaa 10401-cctgtttttcccaagttgcttatttacacccacactcacacacattatac 1045l-acagctgtataatcctcacacaaaacacagactcacttaagagttcagcc 10501-gctaaacaaaccacttatcattttgttggtttggttgctctataatttca 79
10551-tggttttattcacttttcacaaggcgttgcactataccaagaagaatttt 106 01-ccaaatttaatcaaaaatattgtaataggcttagttgaaccattaacttt 106 51-aagcttacgaattgttaaccagttaccaaattatgtttaagagaaaagat 10701-tgattttttggttgaaccattggccactgatttcgttttaagatcaacaa 10751-actcaactctgcaattggtgctaagcagcgaacaaaggaatccaaagttt 10801-ttgctttaaaagatgtcaattattctgtatctctatagctattatttgta 108 51-ttgacaaccattgaattcgaattactttgtttcttacttaaataaacatt 10901-atttttgttatcccattacccgtgtaaaccttagtttaatttattcttgc 10951-cgcctttcgtccgaactGccattcccaggctcacattatcctcatttcga 11001-ctaa tttgttaccattaacatcaagctgcacattctgtatat atgttgga 11051-tttttggtttaggtttttgctaaccattttgcacactcatcccacagtcc 11101-tgattcaactgcaactggtactgttgtggtcccctgctaatggtactggt 1115l-actatttcgggtatcctgtaggcgatttctatcctcggtgtcgtactcat 112 01-cattgtagaaaaacactatcattattctcatatccctgcttcattcacct 112 5l-tctccaccttcatttggttgttgtggttgtctcccttttggcgttgtgat 113 01-ccccttgcttttttgtttgggtctttggttctcattggtttcacccgttg 113 5l-tcgttgtcgttgttggtatttcgttttccgtttcttcaaatctcttcatt 114 01-tttctctctctctttattccactccgacctgatccaaaccgatctatata 11451-tagccttgcaaccctggaccccgtgtctgcccatccgcggtggcaagctg 11501-aaaacgagcaaaaccttctcgacctccaatccacagctgcctttcatagc 115 51-caatgtcggcaactcagcctacctcaatcagcaccagcagcagcatctgc 116 0l-agcagcagcacctgcagcagcaacacttgcagcagcaacatcttgcccag 116 5l-cagcaaccaggtcgtcagcactccgccggcagtttgaactcctcatttat 11701-ttggcgcgaggcgagcccgaacaacttcaacctatactccagttcggtgt 1175l-cctcctcgctgaatgcgacacctgcccaacgctactccttatccggaact 118 01-gcgggaggatcgacgtccatcaaggactaccagagagcgctctccgagga 118 51-gagggcaaccagaaagtctctgaatcgccttaaaagtggctttggttcgg 119 0l-gctacgacaatgtgtgtacatcacctctgctgccgaggaaaaacaaaccg 119 51-gcaccaaagttggtggcccagcagtcgtatcagagatccccgggaaacgc 12001-cacagccaccactatagtgaagccgaatccgccaggacacccaggacttt 12051-acgatcgccgcttgaaccgctcctttgagacctccacttcgcaccgctat 12101-gccgggtatggagcgggctacttgatgaattgcggcggagccttgcggac 12151-cagtacgctccagaggagcactccgcaactggccggtggtgaaagatccg 12201-atgacagcgatgtggagcgggaactgctgcggggtaatggagctgggccc 12251-acggccagtttggaacttaatcccgatggcagcaaacggcagtcgggcag 1230l-ctggtgttgcggtaattttgtgatgaagcagtggcgcaagatcaaccatg 12 3 51-tttgagtctgggcttggggcaccacccaccatgccttcatcaatcatccg 12401-catcacatcgcatccgcatatcgcatcccgccgctccagctccagataca 1245 l-gatacagatgctttgctttgaatgcgctctgtgtgcgaatctatattgat 125 01-ttttagttgatttactggctgcgcaaaagcttccaatgccacaagcctta 125 5i-gattctagaccagcgaactatatgaagttgtaagcgaatggccgattgac 1260 l-ttctgctcgctttgattgtcttagccttaagctgcgccttgatgtgtctg 12 651-cggtgaaattcggccaactgcctgaggttatattcaatgcatatcaggcg 12701-gccaagcgaatttcacggcacctagactgtaactagagtttgtgcttagc 12751-ttatattgacacctacacctaacttagcttattattaatatgtaatctgt 1280l-gaaaagacttggcgaaaaagcgactagtttagaagatgatgatgcttgcc 128 51-actgagtgcaactcctagttccgttttgaatttttatggaatttagttcg 12901-gcttaataagggcagtccttaaatttccgtccacgcgctaacgaattcta 129 51-tttttacgtggccaatcgagtgcggatcacaattttgccataggaattgc 13 001-ctaatagccatagtccaaactatctactagatatactcgtacttcctaat 13 051-gcatctgtgttcttggaggacgttgacctagtgagttttttattaaatgt 80
1310 l-ccgttacctgcctagcaagcaattaaatcaaagagtgtgcaatgtgtaat 13151-caaagagtgcgctttaagtgttagtcatagctagaatcagcaact:aaatc 13 20 l-aaagtaaccaactgttgtgcattattgatcgatggataaacgaacttatt 132 51-ttgtaagtgttttgtgtaacaaccaaattaactactatatgctcttaaa t 13 30 l-actattaaccagtttatacgtttgtactgtaattgagttgatatttgtcg 13351-acgcgaaagagggatggataactaaaggaatccaaacgaaccatgaataa 1340 l-aattctttacaagacgaatcttcctttgtttgtctatgtggttgtgtgct 13451-ttgttattaatagttatagcgataacttagatatacccttaaacttttag 13501-agtat cccat agattga tgtcctgtagtcggaagccctttgttt tggcac 135 51-cctagccatatgacatttaagatatacacttcttatattatccaagcaat 13 601-agcttatagtttatagtttttatcacttacgcctaaacatttttctacac 13 65 l-ctacacgatcatattttgtacattaccattaatccacccttcttcccatc 13701-cgatctctcgcacacaacactaacatattttgttctctgttcgattttct 13751-tttatccaccgaaacacacaccggcatgcagGCCTTGAAAACGAGGACAT L E N E D M 13801-GACCCCCACCCTGCGCCAACTGTGGACCGCCATCCGCCAGATGCAGCAGG TPTLRQLWTAIRQMQQD 13851-ACATGTCCCAGATCAAACTGCAGATCAATGAGGAGCGGGCCCTGCGAGCC MSQIKLQINEERALRA 13901-GATCTCCAACAGCTGCTCATGCAGCATTTGGAGACGAGCAGTGTGAGCAG DLQQLLMQHLETSSVSS 13951-CGGGGCCAACACCCCCAAGTGTTGACTATGCAAGTGACCGGAGGGTTCTG GANTPKC* 14001-GAGGGGATTCCTCGGTACCGATACATCGAAACAATACCCGCCGCTGCTTT 14051-TAGCTTTAATTCATTCTTAGACACTTTTACTTTGCATCTTCGGGGGGCAG 14101-TGGGTCAATTACCAAAAAATTATCTACATATGGACTTTGTAATCGTATAT 14151-GGATTGTATTTACCGAGTACTATTTATGTGTATGTATACTTGTACTTTGT 14201- AATCGTATATGGATTGTATTTACCGAGT ACTATTTATGTGTATGT ATACT 142 51-TGTGAACGGACAATATGCCAATTGTATGTAGTATTAACAAGCATCTGCTT 143 01-CTATCTTATTATCATGCGATCTATCAAAGAGGTTTCGGTATGTCTGAGAA 143 51-ATTTGCATGTTAGTCAAAAATACTTTGCAGATCGCATGCATAATTTGAAC 14401-TTCGGGCAAATTTAACAACATCGAACATCTGCTTATAGCCCATCAGAAC A 14451-TAAATAATTCGTTATAATGCCTAGATTTAATCTTCATTGTAAGAGCCTAG 14501-CACAACATGCATATTTTACTGGCATAGATTCTACACATATTAGACTT ATT 14551-GTATTTTACCTATTTTACGACGTTGCCGACCATGCAACTTTTGAGAGCTG 14601-CTTGTGTAAGTTATACGAATAGATAGACCCAGTTTTGATCTTAACTTTGA 14651-CGATGATTTCAAATGGACAATGCTACGAATAGATAGACCCAGTTTTGATC 14701-TTAACTTTGACGATGATTTCAAATGGACAATGCAAAATTATTAAAAATGT 14751-GCCAATACTTTAGTAAGATGCAGCAACGTACGAAGAATCGCTCAAAAAGT 14801-TGT ATTTACCGATTATACCTAGAACATTTATTGGATTAATATACACGCAC 14851- AGAAAATGTAAAWRAAAAAAAAAAARA 81 disregarded as it had sequences that did not match the 33 kb or the 3.0 kb clone, and northern analysis indicated that there was only one size transcript of DrtGEF. The DNA sequence is presented in Figure 6. The predicted coding region is 658 amino acids.
Also included is genomic sequence obtained from the Drosophila genome project sequencing of clone ds05187_l in the 38C region. Sequence analysis of the coding region using the ISREC Profile Scan Server indicates that this Drosophila gene has predicted RhoGEF. PH and SH3 binding domains. I named this gene Drosophilarho- type guanine exchange factor (DrtGEF).
The DrtGEF gene spans about 15 kb of genomic DNA and is situated between two other transcripts (Fig. 5). a Drosophila horaologue of the Lupus antigen and another which has not been characterized (Altschul et al. 1990: Bai et al. 1994). The genomic organization is shown in figure 7. There are eight exons. Exon 1 is located in the 5.8 kb BamHI-NotI genomic fragment, exons 2 through 5 are located in the 23 kb BamHI genomic fragment, and exons 6 through 8 are located in the 7.0 kb BamHI genomic fragment.
In a subsequent Blast search. I also identified a Mus musculus ORF,
Mmp85SPR (accession #2098782), a second Human ORF. HsfCIAA0142 (accession #
1469865) and a C. elegans ORF. CeKl IE4.4(accession # 1229084), which are highly similar to DrtGEF (Altschul et al. 1990: Wilson et al. 1994). Blast analysis also identifies Tiam-1. Drosophila still life, isif), and a RacGAP from Dictyostelium
Discoidium as having substantial similarity in the RhoGEF and PH domains (Habets et al. 1994: Ludbrook et al. 1997: Soneetal. 1997).
Further analysis of the uncharacterized genes using the ISREC profile scan server indicates that CeKl IE4.4 contains an SH3 and a RhoGEF domain, and that Mmp85SPR 82
FIGURE 7: Genomic Organization of DrtGEF. The 8 axons of DrtGEF are represented
by the shaded boxes. DrtGEF spans nearly 15 kb of the genome, so the larger introns
are not drawn to scale. Exon I is located in the 5.8 BamHI, NotI genomic fragment,
exons 2 through 5 are located in the 23 BamHI genomic fragment, and exons 6 through
8 are located in the 7.0 BamHI genomic fragment, as shown in Figure 6. i_ Ikb B=BamHI N=NotI
Direction of Transcription;
->
BB B IL I 1 <5.8BN 2.3 '7.0 B
('eniromerc 84
FIGURE 8: Comparison of Domain Structure of DrtGEF with Related Proteins.
Diagram showing the conserved spacing of putative SH3, RhoGEF and PH domains in proteins related to DrtGEF. Additional conserved sequences in the carboxy termini of
DrtGEF, HsORF, MmpSSSPR, and HsKIAA0142 are indicated in gray. The actin binding CH (calponin homology) domain of HsORF is also shown. 85
SH3 RlioGEF PH DrtGEF
Mmp85RS
EIsKlAA0142 \\w^-\ \\ "
CH HsORF
PH? CeKll4.4 86
and HsKIAA0142 both contain an SH3 domain, a RhoGEF domain and a PH domain
(Bairoch 1997a; Bairoch 1997b). The organization of these domains within these genes
is the same order as in DrtGEF, suggesting that these genes represent a family of
proteins with related functions (Hg. 8). Despite the fact that ISREC Profile Scan does
not identify a PH domain within CeKl 1E4.4, the corresponding protein sequence is
39% similar and 30% identical to the PH domain of DrtGEF (Table 2), and is also
similar to the PH domains of HsORF. Mmp85SPR. and HsKIAAQ142 (data not
shown). It is also notable that the ISREC Profile Scan Server did not identify the PH
domains of Dbl or Vav.
I used GCG PileUp to align the putative RhoGEF domains of DrtGEF with these
uncharacterized genes, as well as those of Tiam-1 and Dbl (Fig. 9) (Dolz 1994a). I
used GCG gap analysis to further compare amino acid similarity and identity within the
RhoGEF domain. These percentages are presented in Table 1. The RhoGEF domain of
DrtGEF is most similar to the RhoGEF domains of MmpSSSPR, HsKIAA0l42 and
HsORF. sharing 57-58% similarity and 43-46% identity. The RhoGEF domain of
DrtGEF is 49% similar and 38% identical to that of CeK 114.4. Of the previously
characterized RhoGEF proteins, the RhoGEF domain in DrtGEF is most like that in
murine Tiam-1, a protein that can confer invasiveness to T lymphomas and is thought to
activate Rac preferentially over Rho in fibroblasts (Habets et al. 1994; Michiels et al.
1995). The RhoGEF domain of DrtGEF and murine Tiam-1 share 49% homology and
35% identity.
I also compared the predicted amino acid sequences of the PH domains of
DrtGEF and the other genes as described above. An alignment of the putative PH
domain sequences of DrtGEF, CeKl IE4.4, HsORF and HsKIAA0142 is shown in
t i 87
RGURE 9: Sequence Alignnnent of the DrtGEF RhoGEF Domain with RhoGEF
Domains from Other Proteins. Sequence alignments were generated by GCG Rleup and similarities depicted using BoxShade (Dolz 1994a). The RhoGEF domain of DrtGEF is aligned with that of Dbl, Tiaml, CeKl IE4.4, HsORF and HsKIAA0l42 (Habets et al.
1994; Ron et al. 1988; Wilson et al. 1994). Residues that are identical to those of
DrtGEF are shaded black. Residues that are related to those of DrtGEF are shaded gray.
If fewer than three residues are identical or related, the column is white. dbl XVRB tlaml LMP Q! »TF L ODE caklltt44 TLBR hsorf CTVQ hskiaa0l42 SAN I drtgaf dbl QirBssllNSABAPs.. .ESQPCSQBRKDDFQ.IYA tlaml W.HKT sj c«kll«44 LEjpiEKLPKM hsorf ISKFPXMQB hakiaa0142 iTKLPSAQQ drtgaf |3 dbl 62 LLKSQL 3sISK^CKGSAL tiaml 69 ....Bv TAF PRQQBSST caklla44 98 KiaKQ RBYKB hsorf 98 XQHS hsklaa0142 98 drtgaf 92 dbl 102 tiaml 114 cakll«44 139 ELER_ _ _HPDRGDUQR TKDLMSTL R QKE hsorf 142 ELERHMES HPD TIDJjD R tjK h8klaa0142 142 elerhmeijSHSDRHD R "KE drtgaf 136 ELERHMESSHPDRGD RRQKE 89
RGURE 10: Sequence Alignment of the DrtGEF PH Domain with PH Domains from
Other Proteins. Sequence alignments were generated by GCG Pileup and similarities depicted using BoxShade (Dolz 1994a). The PH domain of DrtGEF is aligned with that of CeKl IB4.4, HsORF. and HsKIAA0l42 (Wilson et al. 1994). Residues that are identical to those of DrtGEF are shaded black. Residues that are related to those of
DrtGEF are shaded gray, [f fewer than three residues are identical or related, the column is white. Numerals indicate the relative amino acid positions of the putative ahelix in the carboxy region of the PH domain. c«kll«44 1 DR hsorf 1 RY" LF^ b«kiaa0142 1 RYjJ LFP drtg«C 1 IDRYN VLFPQ c«kll«44 58 TGGQVBHHVXLAK ABM VA1Z TP T haor£ 61 NNHrnn^LNRLZIl haklaa0142 61 ^QHL^^ffiHX.QKQTK drtgaf 57 I 2.MS67HV 10 II a-Helix 91
Table 1: Comparison of Predicted RhoGEF Domain Protein Sequences from other
RhoGEFs to the DrtGEF RhoGEF Domain. [ used GCG PileUp to align the putative
RhoGEF domains of DrtGEF with these uncharacterized genes, as well as those of
Tiam-1 and Dbl (Fig.9). [ used GCG gap analysis to further compare amino acid similarity and identity within the RhoGEF domain (Dolz 1994a).
Table 2: Comparison of predicted PH domain protein sequences from other RhoGEFs to the DrtGEF PH domain. I used GCG pileup to align the putative PH domains of
DrtGEF with these uncharacterized genes (Fig. 10). I used GCG gap analysis to further compare amino acid similarity and identity within the PH domain (Dolz 1994a). 92
Table 1: Comparison of Predicted RhoGEF Domain Protein Sequences from other RhoGEFs to the DrtGEF RhoGEF Domain.
Similaritv Identity
Mmp85SPR 58% 46% HsKIAA0142 57% 46% HsORF 58% 43% CeKllE44 49% 38% Tiaml 49% 35% Dbl 42% 31% Sif 38% 27% RacGAP RhoGEF "1" 36% 22% RacGAP RhoGEF "2" 34% 24% Vav 27% 14%
Table 2; Comparison of Predicted PH Domain Protein Sequences from other RhoGEFs to the DrtGEF PH Domain.
Similaritv Identity
HsKIAA0l42 58% 43% Mmp85SPR 56% 42% HsORF 55% 39% CeKllE44 39% 30% RacGAP 30% 20% 93
RGURE 11: Sequence Alignment of the DrtGEF SH3 Domain with SH3 Domains from
Other F*roteins. Sequence alignments were generated by GCG Pileup and similarities calculated using BoxShade (Dolz 1994a). The PH domain of DrtGEF is aligned with that of Vav, Dock, RacGAP, A. Castrellanii Myosin Heavy Chain IB, CeKl IE4.4,
HsORF. and HsKIAA0l42 (Garrity et al. 1996: Jung et al. 1989: Katzav et al. 1989:
Ludbrook et al. 1997: Wilson etal. 1994). Residues that are identical to those of
DrtGEF are shaded black. Residues that are related to those of DrtGEF are shaded gray.
If fewer than three residues are identical or related, the column is white. rPQKBPKRRAISKPPAGSTKYrGN.K. lY..G|I GWFPSNY ^gjDYS DrAGTMKK|KLHRRAQDKKIUlBLGLPKIKI.HRRAQDKKI TATlBV GWFP2Ni2 SaPYVH AIGTAW PQblsQTKQTITR11.ZL.|.|S SG. .|SV GWFPSNYirTQDCD VLD| MBW^KX'SrKKSDI_ RLBZVDRPASQPDj jRMig.QGQV GTOPISNY E LMD DVC _ |QGAgKLDQRKNKRYLLI.D . .J[^KH| VOWS G^PSNYV|kkbQp PWHX.PrKKDDKXVLl.. DI|S|B| • G KQG FP QYVIRIZAZ IPAKPQP LTrKBgDTZIVH.ra. KSGWQP NYV ^ M» A* gspP iBLSrDKDDIITIT.Q.Qj tgwfp32Y2N S8DI. 8H LS|CKgDIZYVT.R. TGWFPSNYVGE zISs L8TSKMDVIBVT.R. TGWFPSNYVKIETGWFPSNYVi^E jGAVfSPBSRCHHG Y. Q. KTGWF P SNYVNE 95
FIGURE 12: Sequence Alignment of the DrtGEF Carboxy Terminus with the Carboxy
Terminii of HsORF, Mmp85SPR, and HsKIAA0l42 (Wilson et al. 1994). Sequence alignments were generated by GCG Pileup and similarities depicted using BoxShade
(Dolz 1994a). Residues that are identical to those of DrtGEF are shaded black. Residues that are related to those of DrtGEF are shaded gray. If fewer than three residues are identical or related, the column is white. bsorf AT «W W Mr Mr AT «W «• #«• I.SKT •rlSTBgpR.. . mapSSaprmr 1 KVTgV|NPTX» TLPgHP HPaiH|TPHTT| hakl«a0142 1 xvt^GN:GNPTZKP TLP^P hpHhItphttI dztgaf 1 ssaSTQTQttxsjucs I PRSSSA QAflaAmAAAVGS haorf 30 .GPLKPPQIIKPj PPLRPSAAL |yKKRMg|YILKXSSKSPK|NKKri.lIKRKTB BuapSSaprnr 61 1IGP1.BPPPHP PPLRPSAALCYKB OLSKSPKIMKKQLPKRKPE haklaa0142 61 WGPLIPP PPLRPS^LCYKK DLSKSPKINKKBLPKRKPB drtgmt 61 VPSARKGSl PPLRPSLLNQTSGSGSgsggsggggssSSNABIA haorf 89 RKPSKIKYVll rQQGUGSST D8IPQVLLPBKKKL ninpSSaprar 114 RKPSD»r[_ KTRQTLISS ISAPQVLLPBBSKI haklaa0142 114 RKPSDBXrISi KTRQTLBSS B8APQVLLPBBBKI drtgaf 115 8Yi QPTY baorf 149 IIBBQRSNg(QTIB^KS BunpSSaprmr 174 ZVBBQKSNi• qtvEbksIvdI RKV haklaa0142 174 IVBXHKSN!( qtvEXKSIVDI dztgaf 149 ...MQZUS I I NBDmTP haorf Q|DXCZR|BasSKTSZLP* •mpSSaprar nmndpImdbRnl * haklaa0142 mmmdpIhdbQnl* dztgaf TgSVSgGQllQPKC* 97
Table 3: Comparison of Predicted SH3 Domain Protein Sequences to the DrtGEF SH3
Domain. I used GCG pileup to align the putative SH3 domains of DrtGEF with these
uncharacterized genes, as well as those of the Acanthamoeba Castallenii SH3 domain
(MysB_Acaca), RacGAP, DOCK and Vav (Fig. II). I used GCG gap analysis to further compare amino acid similarity and identity within the SH3 domain (Dolz 1994a).
Table 4: Comparison of Carboxy Terminii of Related Proteins to DrtGEF. I used
GCG pileup to align the carboxy terminii of DrtGEF with that of HsORF. HsKIAA0l42 and Mmp85SPR (Fig. 12). 1 used GCG gap analysis to further compare amino acid similarity and identity within the carboxy terminus (Dolz 1994a). 98
Table 3: Comparison of Predicted SH3 Domain Protein Sequences to the DrtGEF SH3 Domain
Similarity Identity
HsKIAA0142 55% 50% HsORF 55% 47% Mmp85SPR 53% 48% CeKllE44 45% 40% MysB_Acaca 44% 36% RacGAP 40% 25% Dock SH3 "T 36% 29% Vav SH3 "2" 36% 23% Dock SH3 -3" 30% 27% VavSH3"l" 28% 26% DockSH3"l" 26% 21%
Table 4: Comparison of Carboxy Terminii of Related Proteins to DrtGEF
Similarity Identity
HsORF 35% 27% Mmp85SPR 33% 27% HsKIAA0I42 32% 26% 99
Rgure 10. Similarity and identity of predicted amino acid sequences are presented in
Table 2. As before, the DrtGEF PH domain appears to be most similar to the PH domains of Mmp85SPR, HsFCIAA0142 and HsORF, sharing 55-58% similarity and
39-43% identity.
Blast Analysis identified a number of proteins as having sequence similarity to the DrtGEF SH3 domain (Altschul et al. 1990). These proteins include the
Acarahcimoehacastellanu myosin heavy chain IB, the Dictyosteliumdiscoidium
RacGAP described above. Drosophila Dreadlocks (dock), an SH2/SH3 adapter protein containing three SH3 domains, and the two SH3 domains in the carboxy terminus of the
RhoGEF Vav (Garrity etal. 1996; Jungetal. 1989: Katzavetal. 1989: Ludbrook etal.
1997). A sequence alignment of the SH3 domains from these proteins and DrtGEF. generated by GCG pileup. is presented in Figure 11. pages 89 and 90 (Dolz 1994a).
Similarity and identity of predicted amino acid sequences, determined using GCG Gap analysis, is presented in Table 3. pages 93 and 94. Again, the DrtGEF SH3 domain appears to be most similar to the SH3 domains of Mmp85SPR, HsKIAA0142 and
HsORF. sharing 53-55% similarity and 48-50% identity.
The similarity of DrtGEF with Mmp85SPR, HsKIAA0142 and HsORF extends through the carboxy terminus of DrtGEF. Comparison of the carboxy terminus of
DrtGEF with these proteins using GCG gap found 32-35% similarity and 26-27% identity (Fig. 12, pages 91 and 92: Table 4, pages 93 and 94)
DrtGEF mRNA is Abandant in Cells Undergoing Morphogenic Movements
To ask whether the Drosophila RhoGEF gene might have a role in ovarian or embryonic development, I performed in situ hybridization with a single stranded DNA 100
probe synthesized from the DrtGEF cDNA using unidirectional PGR and a 3' end
primer. DrtGEF ttiRNA is present throughout oogenesis in the germline-derived nurse
cells and the somatic follicle cells (Fig. 13, see also Stages of Oogenesis, Fig. 1). It is
present in the oocyte through stage 8. In stage 9 or later oocytes, the staining in the
oocyte is diminished. During early embryogenesis. DrtGEF mRNA is present
ubiquitously throughout the yolk (Fig. 14) (Stages are according to Campos-Ortega and
Hartenstein. 1985). In the cellular blastoderm. mRNA is still present in the yolk.
However, there is a ring of dense mRNA around the periphery at the time of cellularization (Fig. 15) and the transcript is localized to the basal part of the cells (Fig.
16). At gastrulation, embryonic stages 6-9. mRNA is most abundantly localized in or
near cells that appear to be involved in morphogenic movements, such as the ventral and cephalic furrows, midgut invaginations, and posterior plate (Fig. 17-19). These cells
undergo shape changes that are believed to be mediated by the actin cytoskeleton (Costa etal. 1993). Higher magnification of the posterior midgut invagination from Fig. 18 clearly shows that cells involved in the invagination are now columnar in shape, in contrast to the rounded cells in the area of the epithelium that is not involved in the invagination (Fig. 19). During germ band extension, stage 10. stain is concentrated in the mesoderm (Fig. 20). At stage 11, staining is concentrated in a line along the ventral neuroblasts, and is also present in the mesoderm and anterior and posterior midgut, and the hindgut (Rg. 21). At the later stages 13, and 15 (Fig. 22-23), the staining is also predominantly in the gut. and along the ventral nerve cord. lOl
FIGURE 13: Distribution of DrtGEF mRNA During Oogenesis. Anterior is to the left; the dorsal side is up. DrrGEFmRNA is present throughout oogenesis in the nurse cells and follicle cells, and is present in the oocyte through stage 8 of oogenesis. In stage 9 or later oocytes, at the right of the photo, mRNA is diminished. 102 103
FIGURE 14; Distribution of DrtGEF mRNA During Early Embryogensis. Anterior is to the left: the dorsal side is up. Early in embryogenesis, DrtGEF mRNA is ubiquitous. 104 105
FIGURE 15: Distribution of DnGEF mRNA in the Cellular Blastodenn. Anterior is the left; the dorsal side is up. In stage 5 of embryogenesis, the cellular blastoderm, message is ubiquitous with an intense ring of stain around the periphery. 106 107
RGURE 16: Subcellular Lx)caIization of DrtGEF mRNA in the Cellular Blastoderm.
Anterior is to the left; the dorsal side is up. Enlargement of the cellular blastoderm, stage 5 of embryogenesis. mRNA is localized to the basal part of the cells. Arrow indicates the base of the cells. 108 109
RGURE 17: Distribution of DrtGEF mRNA During Gastnilation. Anterior is to the left: the dorsal side is up. A. In stage 6, the early gastrula, there is dark staining alon the newly forming ventral furrow and posterior plate.
Ill
FIGURE 18: Distribution of DrtGEF mRNA During Gastrulation. Anterior is to the
left: the dorsal side is up. In the stage 7 gastrula, stain is concentrated at the ventral furrow, the posterior midgut invagination, and the cephalic furrow. 112 113
RGURE 19: Distribution of DrtGEF mRNA in Cell Undergoing Changes in Shape the Posterior Midgut Invagination. Anterior is to the left; the dorsal side is up.
Enlargement of the posterior midgut invagination is shown in Rgure 20. Stain is concentrated in cells undergoing shape changes.
115
RGURE 20: Distribution of DrtGEF mRNA During Germband Extension. Anterior is
to the left; the dorsal side is up. In stage 10, after the germband has extended, staining
is throughout the mesoderm. The stromodeal invagination (lower anterior) is also darkly stained. 116 117
FIGURE 21: Distribution of DrtGEF mRNA in a Stage 11 Embryo. Anterior is to the left: the dorsal side is up. mRNA is present in the mesoderm and the posterior midgut, which is now tucked into the interior of the embryo. Stain is also concentrated in a line along the ventral neuroblasts. 118 119
RGURE 22: Distribution of [>itGEF mRNA in a Stage 13 Embryo. Anterior is to left; the dorsal side is up. Staining is predominantly in the gut and the ventral nerve cord. 120 121
RGURE 23: Distribution of DrtGEF mRNA in Stage 15 Embryo. Anterior is to the
left; the dorsal side is up. Staining is predominantly in the gut and the ventral nerve cord. ; 122 123
DISCUSSION
I have identified a gene that contains predicted RhoGEF. Pleckstrin Homology,
and SH3 domains. Almost all Rho-type GEF identified have both a RhoGEF domain
and a PH domain with the PH domain immediately following the RhoGEF domain.
These tandem domains are often referred to as DH/PH domains. The DH domain is
required for Rho-type GEF activity, the PH domain is required for membrane or
c>toskeletal targeting, and both domains are required for transformation by activated
Rho-type GEFs (Han, Eva et al. 1994; Cerione and Zheng 1996). The PH domain may
serve to localize these proteins to the plasma membrane or the cytoskeleton. and to place
the GEF activity in a functionally significant position. The remaining sequences are
usually divergent, with other functional domains such as SH3. Src homology 2 (SH2). a
second PH, or actin binding domains at various locations. These domains are found in
different combinations in a diverse array of signal transduction proteins and are
considered modular protein binding domains that are distinct from the catalytic regions of
the protein. It is thought that they mediate critical interactions with components of the
plasma membrane, signaling pathways, or the cytoskeleton (Cerione and Zheng 1996:
Cohen et al. 1995).
DrtGEF is very similar in sequence, and in the order and spacing of domains, to four genes that were identified from the databases and have not yet been characterized
(Fig. 8). Like DrtGEF, they have an SH3 domain, followed by a DH/PH domain. Two of these genes, a mouse gene designated Mmp85SPR and a human gene designated
HsKIAAO 142. appear to be homologues of DrtGEF. Like DrtGEF. the SH3 domain is in the amino-most part of the protein, with no additional amino terminus (Fig. 8).
Homology between DrtGEF and these proteins extends throughout the protein into the 124
carboxy terminus. Respectively. Mmp85SPR and HsKIAAO142 share 53% and 55%
similarity and 48% and 50% identity with DrtGEF in the SH3 domain (Fig. 11, Table
3). 58% and 57% sequence similarity and 46% identity with DrtGEF in the RhoGEF domain (Fig.9. Table 1), 56% and 58% similarity and 42% and 43% identity with
DrtGEF in the PH domain (Fig. 10. Table 2). and 33% and 32% similarity and 27% and
26% identity in the carboxy terminus (Rg. 12. Table 4). Mmp85SPR and HsKIAA0142 share 98% protein sequence similarity and identity with each other. They are both 647
AA and the domains are spaced identically. A second human gene, designated HsORF. has an actin binding CH (calponin homology) domain in the amino terminus, followed by the SH3, and DH/PH domains. The predicted AA sequence shares 55% similarity and 47% identity with DrtGEF in the SH3 domain. 58% similarity and 43% identity in the RhoGEF domain. 55% similarity and 39% identity in the PH domain, and 35% similarity and 27% identity in the carboxy terminus. The C. elegans gene, CeKl 14.4. also has additional sequences in the amino terminus not found in DrtGEF or in the mammalian homologues. These sequences do not contain a CH domain. CeKl 14.4 shares similarity with the SH3 domain (Fig. 11). RhoGEF domain (Fig. 9). and PH domain of DrtGEF (Fig. 10); however. ISREC prosite predicts an SH3 and RhoGEF domain but no PH domain for CeKl 14.4. ISREC prosite does not predict a PH domain following the DH domain in Dbl or Vav either. The AA alignment in PH domains is not as obvious as those of SH3. RhoGEF/DH, or other domains, therefore, PH domains are more difficult to predict (Shaw 1996). Comparing the protein sequence of DrtGEF with corresponding sequences in CeKl 14.4 shows that the two proteins share 45% similarity and 40% identity in the SH3 domain, 49% similarity and 38% identity in the RhoGEF domain, and 39% similarity and 30% identity in the PH domain (Tables 1,23.4). Of the 125 previously characterized RhoGEF proteins, the RhoGEF domain in DrtGEF is most like that in Tiam-l. sharing 49% similarity and 35% identity.
The DrtGEF Pleckstrin Homology Domain
The amino acid sequence of PH domains is diverse and thus they are not as easily recognized as SH2 and SH3 domains. A more refined description may be that the
PH domain is a characteristic arrangement of classes of amino acids rather than a consensus sequence. The protein structures have been solved for a number of PH domains and the core structures are almost superimposable (Downing et al. 1994:
Fushman etal. 1995: Lemmonetal. 1996: Shaw 1996: Timmetal. 1994: Yoonetal.
1994). Putative ligand-binding clefts, however, appear to be hypervariable, suggesting that the ligands mediating the function of PH domains are diverse (Gibson et al. 1994).
The N-terminal 85 AA of the domain has many large hydrophobic, turn promoting and negatively charged AA that assemble into seven antiparallel beta strands. The two sets of four and three beta strands form an orthogonal fold. At the C-terminus, an amphiphilic alpha helix closes off one end of this beta barrel or beta sandwich. At position 6 within the alpha helix there is almost invariably a Trp residue, and one or two negatively charged residues in the positions preceding the Trp, and a large polar residue at position
10 (in the case of HsORF and DrtGEF it is Leu). This region never contains helix- breaking Pro residues (Shaw 1996). DrtGEF and related proteins adhere to this consensus. Sequences that correspond to the C-terminal alpha helix are indicated in figure 11. 126
The DrtGEF Src Homology 3 Domain
Src Homology 3 (SH3) domains are conserved functional modules of 50 to 70
AA that have been demonstrated to modulate interactions between proteins and are
ultimately involved in a wide range of biochemical responses influencing cell
proliferation, shape, polarity, differentiation and metabolism (Gout et al. 1993: Mayer
and Baltimore 1994: Musacchio et al. 1992: Pawson and Gish 1992: Renetal. 1993:
Schlessinger 1994). SH3 domains recognize a specific target sequence, a 9-12 AA motif
that is abundant in prolines and hydrophobic residues. A number of studies suggest that
they provide specificity to protein-protein interactions (Gout etal. 1993: Limetal. 1994:
Ren et al. 1993). In some cases, the SH3 domain/ligand interaction has been shown to
modulate enzymatic activity (Gout et al. 1993: Mayer and Baltimore 1994: Pleimanet
al. 1994). Other work suggests that SH3 domains can direct protein targeting to
specific structures of the cytoskeleton. The SH3 domain of PLC gamma localized to
microfilaments while the SH3 domain of the GRB2 adapter protein localized to membrane ruffles. An investigation of the cellular distribution PLCy and GRB2
constructs in fibroblasts indicates that SH3 domains have a role in translocation of
proteins to plasma membrane, the cytoskeleton and other subcellular locations (Bar-Sagi et al. 1993). Deletion or mutation in SH3 domains can enhance oncogenic activities of
the host protein (Seidel-Dugan et al. 1992).
The structures of a number of SH3 domains (including Src, PLCy. spectrin, fyn,
Icr, and p85) have been determined. The SH3 domain ligand binds to a flat hydrophobic region on the surface of the SH3 domain (Schlessinger 1994). Ligand binding can occur in two opposing orientations with different ligand consensus sequences for each orientation (Feng et al. 1994: Mayer and Eck 1995: Ricklesetal. 1995). SH3 domain binding to their respective ligand is very specific. While most SH3 binding proteins 127
contain Pro rich regions in the recognition sequence, each SH3 domain recognizes
ligands with distinct sequences (Mayer and Eck 1995; Sparks etal. 1996). Practically
all proteins containing a single SH3 domain and no SH2 domain are microfilament
associated proteins, such as vinculin. fodrin. ezrin. spectrin, radixin. zyxin and cortactin
(Bretcher 1993). SH3 domains are found on several RhoGEFs including Dbs. Vav.
Tim. the HsORF. DrtGEF. C. elegans GEF. as well as the RhoGAPs. Bem3 and
CeGAP( Adams et al. 1992: Chan etal. 1994: Lamarche 1994: Shaw 1996: Werner
and Manseau 1997: Whitehead et al. 1995a). The function of SH3 domains on these
proteins is not known.
The DrtGEF SH3 domain is moderately similar to an SH3 domain from the A. casrrellanii myosin heavy chain IB SH3 domain. Dicryostelium RacGAP. all three SH3 domains of the Drosophila Dock SH2/SH3 adapter protein which is required for neural patterning, and both SH3 domains in the C-terminus of the RhoGEF. Vav (Garrity et al.
1996: Jung et al. 1989: Katzav et al. 1989: Ludbrook et al. 1997). Neither the precise function nor the ligand of these SH3 domains has been demonstrated. However. Vav. which has two SH3 domains flanking an SH2 domain in the carboxy terminus, binds to the Crk/Grb adapter, which consists largely of two SH3 domains also flanking an SH2 domain, through dimerization of the SH3 domains (Ye and Baltimore 1994).
Association of proto-oncogenic Vav protein with the focal contact protein zyxin requires the most C-terminal SH3 domain (Hobert et al. 1996). DrtGEF is 59% similar and 50% identical to the specified AA in an SH3 consensus sequence proposed by Musacchio et al. (Musacchio et al. 1992). 128
A Specific Role for DrtGEF in early development may be inferred from the presence of DrtGEF transcript daring Oogenesis and Embryonic
Development
DrtGEF mRNA is present throughout oogenesis in the germline-derived nurse cells and the somatic follicle cells (Hg. 13). Z>rG£'FmRNA is present in the oocyte through stage 8. In stage 9 or later oocytes, the staining in the oocyte is diminished. In later stage oocytes, the vitelline membrane is laid down, preventing stain from entering the oocyte. RhoGTPases have been shown to influence many microfilament based events during oogenesis. Montell and Murphy found that constitutively active or dominant-negative forms of RhoL and Dcdc42 disrupted the nurse cell cyto-architecture. causing profound effects. Drac was specifically required for border cell migration
(Murphy and Montell 1996). DrtGEF may regulate RhoL. Dcdc42, and or Drac.
Alternately. DrrGEF mRNA may be supplied to the oocyte for translation and use during embrj'ogenesis.
DrtGEF mRNA is abundant and ubiquitous in early embryos (stages 1-5) and the actin cytoskeleton is involved in several key events in early embryogenesis (Fig. 14). The stages of embryogenesis are as decribed by Campos-Ortega. After fertilization, a series of rapid nuclear divisions occur, producing a syncytium. At this time, the actin cytoskeleton is involved in the axial expansion, or redistribution of the nuclei along the
A/P axis. A network of actin filaments links the actin based cell cortex to the middle of the embryo where the nuclei are located. During the ninth division, several nuclei migrate to the posterior end of the embryo where they become enveloped in plasma membrane forming the pole cells, progenitors of the germline. At division 10, nearly all of the other nuclei migrate to the periphery of the embryo. This migration is largely microtubule based. After the 13th division, membrane furrows encircle them, resulting in a cellular 129 blastoderm of about 6,000 cells. Several actin structures appear to be involved in this process. Actin filaments form a band between each nucleus and the plasma membrane, which later forms the cleavage furrows (Sullivan and Theurkauf 1995). At the time of the
I3th nuclear division when cellularization occurs (stage 5 of embryogenesis). a concentrated ring of DrtGEF mRNA is visible around the periphery in addition to the ubiquitous stain, and DrfGEFmessage is localized to the basal part of the cells (Fig. 15,
16). Drac and Dcdc42 are also localized basally within cells at the cellular blastoderm stage.
DrtGEF is highly expressed in tissues that invaginate during gastrulation. At the time of gastrulation. the single cell layer of the cellular blastoderm invaginates at the anterior, posterior and ventral midline, resulting in a new body that is organized into ectoderm, endoderm and mesoderm (Costa et al. 1993). Diverse cell mechanisms are used to achieve the cell movements involved in this reconstruction. Cells elongate. shorten, and undergo localized cell constriction and expansion, polarized mitosis, and rearrangement. Gastrulation in Drosophila begins in the ventral region of the embryo as soon as cellularization in that region is complete. Dark staining for DrtGEF mRNA can be seen in the ventral region of the embryo at this point, (shown for a later stage. Fig.
17). The embryo invaginates along the ventral midline producing a tube inside the embryo. Eventually, the tube disperses, and the cells form a single mesodermal layer. At the same time, lateral anterior cells fold in to form the cephalic furrow, which has concentrated DrtGEF stain (This can be seen at a later stage in Fig. 17). The posterior end of the embryo invaginates, bringing the pole cells, progenitors of the germline, and the posterior endoderm into the interior of the embryo, which later forms the posterior midgut and hindgut. Dark staining can be seen at the posterior plate, or presumptive posterior midgut invagination, in the stage 6 embryo (Fig. 17), and in the posterior 130
midgut invagination in the stage 7 embryo (Fig. 18). An enlargement of the posterior
midgut invagination is shown in figure 19. Stain for DrtGEF mRNA is concentrated in
cells undergoing shape changes. Work to characterize the cellular mechanisms
responsible for gastrulation suggests that at least two distinct strategies are involved in
furrow formation. The ventral furrow, posterior midgut invagination and anterior midgut
invagination seem to arise from a similar series of changes in cell shape. Rrst cells in the
region that will invaginate flatten apically. the central most cells then undergo apical
constriction and elongate. Fmally, the central-most cells shorten. These concerted shape
changes draw the central cells inward, resulting in an invagination. Microfilament based
apical constriction appears to be a primary mechanism for creating invagination (Costa et
al. 1993; Ettonsohn 1985: Fristrom 1988). Cells may elongate due to constriction of
microfilaments along one axis (Ettonsohn 1985; Fristrom 1988). Localization of actin
and myosin seems to be required for cell elongation and apical constriction (FGehart et al.
1990; Wametal. 1984; Young etal. 1991; Young etal. 1993). Treatments with
cytochalasin have been demonstrated to arrest or reverse invagination of cell layers
(Ettonsohn 1985). The Drosophila zipper gene, which encodes a conventional non-
muscle myosin has been shown to be necessary for proper dorsal closure, a process that
requires movement of a cell sheet, and cells undergo the characteristic cell shape changes
of apical constriction and elongation (Young et al. 1993).
In a process called germband extension, the cells of the germband migrate around
the posterior pole to the dorsal side of the animal (Costa et al. 1993). The exterior cells then coalesce towards the ventral midline, forming a structure known as the germband.
The posterior midgut invagination is transported anteriorly so that it abuts the cephalic furrow, and then is tucked into the interior of the embryo. Endoderm also invaginates at the anterior, producing a strucmre called the stromodeal invagination, that later forms the 131 anterior midgut. Staining is seen throughout the mesoderm and in the stromodeal invagination (Fig. 20). In the later stages of embryogenesis. the germband retracts to its original position. At stage 11. staining is concentrated in a line along the ventral neuroblasts, and is also present in the mesoderm and anterior and posterior midgut, and the hindgut (Rg.2l). At stages 13-15. DrtGEF mRNA staining is seen most intensely in the gut and the ventral nerve cord (Fig. 22-23). Cell intercalation is believed to be responsible for the morphogenic movements in germband extension (Costa et al. 1993).
This appears to be the same cellular mechanism involved in Drosophila imaginal disc eversion and is also seen in Xenopus, fish and sea urchin gastrulation (Fristrom and
Fristrom 1975: Keller and Hardin 1987). While it is highly probable that the cytoskeleton plays an integral role in cell intercalation, there has been no work done to characterize it.
The Drosophila RhoGTPases studied are expressed throughout development and transcript is distributed uniformly throughout embryogenesis, however. Racl is expressed at higher levels in the mesoderm, central nervous system and the primordial hindgut in germband extended embryos (Luoetal. 1994; Murphy and Montell 1996).
The role of ElhoGTPases in gastrulation has not been investigated, however. Barret and
Settleman recently isolated a GEFfor Drhol that is required for gastrulation (Barrett and
Settleman 1997). A rho-like GTPase. DCdc42. was found to have a role in the elongation of polarized epithelial cells in wing discs, which suggests that Cdc42 may have a role in the elongation of cells during gastrulation (Eaton et al. 1995). A guanine exchange factor for yeast Cdc42. Cdc24. has been identified, but it is not a homologue of
DrtGEF (Cerione and Zheng 1996).
By analogy with other proteins having sequence similarity with DrtGEF, and by examination of its mRNA expression pattern, DrtGEF may have a role in regulation of cytoskeletal events in early development. One difficulty in interpreting mRNA 132 localization studies is that protein localization may be different. It would also be very informative to be able to investigate the cytoskeleton of DrtGEF mutant embryos. Further genetic and DrtGEF localization studies will help clarify the role of DrtGEF in cytoskeletal regulation. 133
GENERAL DISCUSSION AND FUTURE DIRECTIONS
DrtGEF is a putative RhoGEF that is abundantly expressed in morphogenic
tissues during gastrulation. Several lines of evidence suggest that in the Rho
superfamily, GEFs and GAPs, rather than RhoGTPases, may be the key regulators of
Rho pathways. There is a great diversity of RhoGEFs and RhoGAPs relative to
RasGEFs and RasGAPs (Bokoch etal. 1994; Lamarche 1994; Tapon and Hall 1997).
Unlike RasGEFs, each RhoGEF binds a different region of its cognate RhoGTPase
(Bokoch etal. 1994, Park etal. 1994; Quilliam et al. 1996; Quilliam et al. 1994, Li and
Zheng 1997). The catalytic function of RhoGEFs appears to be separable from the
RhoGTPase binding interaction (McColIam et al. 1995, Cerione and Zheng 1996).
Furthermore, while the cytoskeletal phenotypes of activated RhoGEFs are similar to the
effects of activation of their RhoGTPases, RhoGTPases do not transform cells as readily
as their GEFs, indicating that RhoGEFs may be regulating other cellular functions
(Khosravi-Faretal. 1994; Prendergast and Gibbs 1994; Qiuetal. 1997; Symons
1996). RhoGTPases have been shown to have separable and cell specific activites,
however, the RhoGTPases DRacl, DRac2, Rho, and Cdc42 are uniformly expressed in
Drosophila embryos (Harden et al. 1995; Luoetal. 1994, Eaton et al. 1996, Murphy and Montell, 1996). DrtGEF transcripts are concentrated in morphogenic tissues which suggests that DrtGEF could be responsible for activating a specific Rho pathway in these cells. This idea is supported by the fact that another RhoGEF, still life, is also differentially expressed. It is transcribed only in a subset of cells of the CNS and has been shown to regulate specific actin based neurogenic events in Drosophila embryos
(Sone et al. 1997). On the basis of this evidence, I propose the model that DrtGEF is a 134
molecular switch, influencing gastmlation and other cytoskeleton driven events in early
development.
Two genes, foldedgastrulation (fog) and concertina (da) have been identified as
specifically necessary for gastmlation in Drosophila, and are candidates for upstream
regulators of DrtGEF. Mutations in either result in failure of the ventral furrow and
posterior midgut invaginations to form, fog encodes a putative signaling protein and eta
encodes a G-alpha like protein (Costa et al. 1993; Parks and Wieschaus 1991). Certain
trimeric GTPases regulate the actin cytoskeleton. and there is evidence that Rho GTPases may be a component of this pathway. The alpha subunits of Gq and Gi i, closely
colocalize with actin (Ibarrondo et al. 1995). Inactivation of RhoGTPases abolished Galphai2 and G alpha 13 mediated stress fiber formation in Swiss 3t3 cells, and
heterotrimeric GTPases cytoskeletal reorganization in mast cells (Buhl et al. 1995:
Norman et al. 1994). Cdc42 is required for heterotrimeric G protein directed
transduction of the mating pheromone signal (Leberer et al. 1997). Interestingly, the aa
transcript is localized very similarly to the DrtGEF transcript. At the cellular blastoderm
stage, it is restricted to the basal part of the cells. During gastmlation, it is localized to
regions that invaginate. During germband extension, it is most heavily concentrated in
the mesoderm.
Drosophila homologues of Phophoinositide 3-kinase (PI3K) Jun-N-Tenninal
kinase (JNK), Jun. focal adhesion kinase, merlin and moesin have been isolated (Hou et al. 1997; McCartney and Fehon 1996). Any of these proteins could be involved in the
putative DrtGEF regulation of cytoskeletal events (Fox and Hynes 1997; Hou et al.
1997; Leeversetal. 1997; Riesgo-Escovar and Hafen 1997).
Of final interest, the yeast formin family protein. Bni 1 interacts with Cdc42 and
yeast profilin, and the mammalian formin family protein, pl40mDia, interacts with RhoA 135
and mammalian profilinCEvangelistaetal. 1997; Watanabe 1997). Perhaps the
Drosophila formin, Capu, which also interacts with profilin, plays a role in the Dcdc42
or Drho1 pathways.
There are several fundamental questions that emanate from this work:
1. What is the function of DrtGEF? Does DrtGEF catalyze GDP/GTP exchange on a
RhoGTPase leading to manipulation of the cytoskeleton? Does it have other functions
apart from GEF activity?
2. Upon which RhoGTPase does DrtGEF act? What are the upstream and downstream
members of this Rho signaling pathway?
3. What are the functions of the PH and SH3 domains? Deletion studies and analysis of
point mutations indicate that both the RhoGEF and PH domain are needed for
transformation. Presumably the PH domain is used to anchor the RhoGEF to the plasma
membrane. This idea is supported by substitution experiments performed with LFC
(Shaw), however work with Dbl suggests that the PH domain targets the protein to the
cytoskeleton (Zheng et al. 1996). Proteins bearing a single SH3 domain, such as such
as vinculin. fodrin, ezrin, spectrin, radixin, zyxin and cortactin are associated with
microfilaments. Two previously characterized RhoGEFs have a single SH3 domain,
however, reported work has not addressed its function.
4. What is the molecular mechanism of RhoGTPase/RhoGEF regulation of the cytoskeleton? 136
5. What is the role of DrtGEF in Drosophila oogenesis and embryogenesis?
I would like to suggest the following approaches towards answering these
questions:
Create and analyze DrtGEF mutants.
For example. P element-induced alleles could be generated and isolated by
mobilizing a nearby P element, and screening for hits in the DrtGEF gene using inverse
PGR. Egg chambers and embryos homozygous for a null or hypomorphic allele could
be examined for alterations in the actin cytoskeleton and localization of actin associated
proteins. While it would still be useful to examine cytoskeletal defects in older mutant animals. I am particularly interested in the role of the cytoskeleton during oogenesis and gastrulation. One caveat to this scheme is that DrtGEF may be a maternal effect gene and a late embryonic or larval lethal. If this is the case, mosaic egg chambers can be constructed. This classical approach will reveal whether DrtGEF indeed influences the cytoskeleton and whether DrtGEF is required for oogenesis and embryogenesis.
Microscopic analysis of actin structure and localization of actin associated protein localization may also suggest molecular mechanisms for actin regulation. Loss of function alleles can also be used for epistatic ordering of the pathway. Small deletions disrupting only one of the domains could be very useful in determining function of the various domains. Excision of a P-element can leave a deletion, however, it is not likely that it would be confined to one domain. 137
Identify proteins that interact with DrtGEF asing a yeast two-hybrid
screen.
The GEF domain would be predicted to interact with its cognate RhoGTPases,
and would also support the hypothesis that DrtGEF has GEF activity. The two-hybrid
interaction trap has been used successfully to study binding of Ras and it's GEF Cdc25
(Mostellar et al. 95). and Glutathione-Sepharose-inimobilized GST-Rho fusion proteins can be used to precipitate Dbl and other RhoGEFs, suggesting that the interaction
between RhoGEFs and their GTPases is stable enough to be detected in a yeast two-
hybrid system (Hart and Powers 1995: Miki 1995).
PH domains have been shown to interact with Gbeta gamma proteins using yeast two-hybrid and other tests. Likewise, SH3 domains bind certain proline rich regions.
Identification of proteins that interact specifically with either the DrtGEF PH or SH3 domain would indicate the function of that domain. It may also suggest other functions for DrtGEF apart from GEF activity. Both PH domains and SH3 domains have been implicated to interact with the cytoskeleton. Identification of cytoskeletal proteins that bind these domains would help elucidate the mechanism of cytoskeletal regulation.
Examination of DrtGEF Protein Localization
Antibodies can be generated using synthetic peptide or fusion proteins.
Intracellular localization of DrtGEF can then be studied with immunoflourescence staining and confocal microscopy. DrtGEF may associate with actin structures or with proteins associated with these structures, which would suggest mechanisms for actin regulation. 138
Analysis of Cytoskeletal Changes from Constitntively Active DrtGE
Constitutively active forms of Ost, Vav, Dbl and other ElhoGEF are produced by amino-terminal truncation of the proto-oncogene. The amino-termini of these proteins are quite different, and unlike the modifications made to generate constitutively active and dominant-negative GTPases. the mechanism for this constitutive activity is not understood. Nevertheless, deletion of the SH3 domain of DrtGEF may produce a constitutively active form of the protein. Mis-expression of such a protein would be useful for asking if DrtGEF can alter c>toskeletal structures. A constitutive active gene can also be used to order genes in a pathway on the basis of epistasis. CHAPTER 3; MATERIALS AND METHODS 140
MATERIALS AND METHODS
Chromosomal Walking
la order to isolate genomic clones progressing distally from the entry point in the
38C region to the portion of the region predicted to containing spir. a restriction map was
made of each clone, and the most distal fragment was isolated and used to screen a
library to find the adjacent clone. 1 used several libraries: the Maniatis phage library, the
Tamkun phage library and the Tamkun cosmid library, as well as several Drosophila
genome project PI phage that mapped to 38C to complete my walk. Library screening is
discussed below. PI phage DNA were isolated using Qiagen Maxi fteps. Clones were
mapped relative to deficiency breakpoints using in situ hybridization to polytene
chromosomes, as discussed below.
Screening Genomic and cDNA phage libraries
Phage were first titered. then plated to a density of about 10,000 PFU/plate
together with host cells and soft agar on large 150 mm X 15 mm petri dishes. The
Maniatis library was constructed into lambda Charon 4 and the Tamkun library was
constructed into lambda EMBL3. I used C600 cells as the host for both of these phage.
For the Tolias Ovarian cDNA library, I used Y1090 cells as the host. Plaques were
lifted with nitrocellulose filters, the DNA was denatured with NaOH and cross linked by
baking at SCC for two hours. Filters were hybridized with radio labeled probe. Probes were constructed by random priming. The hybridization mixture contained 50% formamide, 5X SSC, 0.1% SDS, 1 mM EDTA, 10 mM Tris pH 8.5, 5X Denhardts, and 100 ^g/ml Salmon Sperm DNA. Rlters were hybridized for 18 to 20 hours and then washed in 5X SSC, 0.2% SDS at 65''C. three times for 20 minutes. Rlters were 141 exposed to Kodak XAR film overnight. Positives were plaque purified, and DNA was isolated by large scale PEG precipitation.
Screening the Tamknn Cosmid Library
The Tamkun Cosmid library was plated at a density of3.000 CFU/plate on sterilized Magnagraph nylon filters that were placed atop agar plates containing 30 ug/ml ampicillin. After tiny colonies were apparent, about 12 hours growth at 37°C, the filters were duplicated, and the masters were grown on agar plates containing 30 ug/ml ampicillin for 3-5 hours at 37°C. while the duplicates grown on plates containing 30 ug/ml ampicillin for 4-6 hours, then transferred to agar plates containing 100 ug chloramphenicol. 30 ug/ml ampicillin at37°C overnight.
The library was screened similarly to the phage library, except that the hybridization mix also contained 5% dextran sulfate and filters were washed using 2X
SSC. Autoradiographic film was exposed for 24 to 48 hours.
In Situ Hybridizations to Poiytene Chromosomes
Chromosomal squashes were prepared from the salivary glands of third instar larva as described in the Rubin Lab Methods Book (Laverty 1990). Chromosomal squashes were hybridized at 65°C with biotinylated probe, which was synthesized using nick translation, according to the Rubin Lab Methods Book, or at 45°C with digoxygenenin labeled probe, which was synthesized with 1 |ig of DNA using random priming as described by de Frutos et al. (de Frutos et al. 1989). 142
Reverse Northern Analysis
Digoxygenin labeled cDNA was made from ovary polyA RNA using AMV
reverse transcriptase. These probes were hybridized to southern blots of subcloned
genomic DNA. FYobe should hybridize to fragments containing transcription units.
RFLP Analysis
Genomic DNA was isolated from flies homozygous or hemizygous
(mutant/deficiency) forspir. and from control chromosomes, or from flies heterozygous
for spir. DNA was digested with BamHI, EcoRI, Hindlll, Xhol or Xbal, separated
electrophoretically on 0.7% or 1.0% agarose slab gels, and blotted onto nitrocellulose.
DNA was crosslinked to the nitrocellulose by baking at 80°C or by using a Stratalinker
UV apparatus. Probes to genomic fragments containing transcription units were made
using random priming and digoxygenin label. Blots were hybridized as described in the
Boehringer Mannheim Genius System User's Guide for Filter Hybridization.
Northern Blotting
Poly(A"^) mRNA was isolated using the protocol of Jowett. and Northern blots were made using the procedure of Sambrook et al. loading 2 ug of Poly( A+) mRNA per
lane (Jowett 1986; Sambrook et al. 1989). Probes were synthesized from I jigofDNA
using the random priming described in the Genius System Users Guide. Alternatively, single stranded DIG-labeled DNA probes were synthesized with unidirectional PGR using primers from the 3' end of the full length cDNA. Blots were hybridized as described in the Boehringer Mannheim Genius System User's Guide for Biter
Hybridization. 143
Sequencing
I performed the sequencing of the cDNAs. DNA sequencing was performed using a US Biochemical Sequenase kit. cDNAs were subcloned into Bluescript
(Stratagene) and M13 forward and reverse primers were used to sequence the ends of the cDNAs. Primers for the remainder of the cDNA were designed from sequenced portions.
DNA sequencing of genomic DNA from spir mutant alleles was perfomed by
Steve Emmons. Genomic DNA from homozygous or hemizygous spir mutant flies was amplified and then sequenced using the Sequenase PCR Product Sequencing Kit (US
Biochemical).
Genomic sequence was obtained from the Drosophila genome project, sequence ds05187_l, PI d54.
Sequence Analysis
Sequences were analyzed for similarity to known sequences using BlastP
(Altschul et al. 1990). Predicted protein motifs were identified using the Swiss
PROSITE database of protein motifs (Bairoch 1997a; Bairoch 1997b). Internet access to Swiss PROSITE is available at http://ulrec3.unil.ch/software/PFSCAN_form.html.
The GCG version 9 sequence analysis programs were used to manage and analyze the sequence data (Dolz 1994a; Dolz 1994b; Dolz 1994c; Dolz I994d).
Sequences were compared using the GCG version 9 programs bestfit and gap. Gap weight was set at 12 and length weight was set at 4 for both bestfit and gap. The sequence comparison table was GenRunData:blosum62.cmp. Two exceptions were the analysis of the carboxyterminus. where gap weight was set at 9 and length weight was 144 set at 2, and the comparison of the RhoGEF domain of Dbl, where gap weight was set at
9 and length weight was set at I.
Multiple sequence alignments were constructed using GCG pileup. Gap weights and length weights were set as above.
Whole-mount tissue in situ hybridizations
RNA transcripts were localized in ovaries and embryos using the method of
Tautz and Pfeifle with Dig-labeled DMA probe synthesized as described above (Tautz and Pfeiffle 1989). Embry os were first dechorionated using 50% bleach. For both ovaries and embryos, tissues were dehydrated in methanol, rehydrated, digested briefly with Proteinase K. and hybridized overnight at 45°C in 50% formamide. 5X SSC. 100 ug/ml salmon sperm DMA. 50 ug/ml heparin and 0.1% Tween 20. Probes were synthesized as described in Northern Analysis. 145
REFERENCES
Abrams, C. S., H. Wu, W. Zhao, E. Belmonte, D. Wliite and L. F. Brass (1995). "Pleckstrin inhibits phosphoinositide hydrolysis intiated by G-protein-coupled and growth actor receptors." Journal of Biological Chenustrv 27 0: 14485-14492.
Adams, J. M., H. Houston, J. Allen, T. Lints and R. Harvey (1992). "The hematopoietically expressed vav proto-oncogene share homology with the dbl GDP-GTP exchange factor, the bcr gene and a yeast gene (Cdc24) involved in cytoskeltal organization.'" Oncogene 7: 611-618.
Akam. M. (1987). "The molecular basis for metameric pattern in the Drosophila embrvo." Development 101: 1-22.
Altschul. S. P.. W. Gish, W. Miller. E. Myers and D. Lipman (1990). "Basic local alignment search tool." Journal of Molecular Biology 215: 403-410.
Amano. M.. K. Chihara. K.. Kimura. Y. Fukata. N. Nakamura. Y. Matsuura and K. Kaibuchi (1997). "Formation of Actin Stress Fibers and Focal Adhesion Enhanced by Rho-Kinase." Science 275(Feb. 18): 1308-1311.
Amano, M., M. Ito, K. Kimura, Y. Fukata, K. Chihara. T. Nakano, Y. Matsuura and K. Kaibuchi (1996). "Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase)." The Journal of Biological Chemistry 271(34): 20246-20249.
Apgar. J. R. (1994). "Polymerization of actin in RBL-2H3 cells can be triggered through either the IgE receptor or the adenosine receptor but different signaling pathways are used." Molecular Biology of the Cell 5(3): 313-322.
Apgar. J. R. (1995). "Activation of protein kinase c in rat basophilic leukemia cells stimulates increased production of phosphatidylinositol 4-phosphate and phosphatidylinositol 4,5 bisphosphate: correlation with actin polymerization." Molecular Biology of the Cell 6( 1): 97-108.
Aspenstrom, P., U. Lindberg and A. Hall (1996). "Two GTPases, Cdc42 and Rac, bind directly to a protein implicated in the immunodeficiency disorder Wiskot-Aldrich syndrome." Current Biology 6( 1): 7075.
Bai, C., Z. Li and P. P. Tolias (1994). "Developmental characterization of a Drosophila RNA-binding protein homologous to the human systemic lupus erythematosus- associated La/SS-B autoantigen." Molecular and Cellular Biology 14: 5123-5129.
Bairoch, A. (1997a). "The PROSITE database, its status in 1997." Nucleic Acids Research 2 5(1): 217-221.
Bairoch, A. (1997b). "The SWISS-PROT protein sequence database: its relevance to human molecular medical research." J Mol Med 7 5(5): 312-313. 146
Bar-Sagi, D., D. Rotin, A. Batzer, V. Mandiyan and J. Schlessinger (1993). "SH3 domains direct cellular localization of signaling molecules." Cell 7 4: 83-91.
Barrett, K. and J. Settleman (1997). Identification of a Rho 1-specific guanine pucleotide exchange factor required for embryo morphogenesis in Drosophila. Drosophila Annual Research Conference, Chicago, Genetic Society of America.
Berbelo, P. D., D. Drechsel and A. Hall (1995). "A conserved binding motif defines numerous candidate target proteins for both cdc42 and rac GTPases." Journal of Biological Chemistry 270: 29071-29074.
Berleth, T.. M. Burri. G. Thoma, D. Bopp, S. Richstein, G. Frigerio, M. Noll and C. Nusslein-Volhard (1988). 'The role of localization of bicoid RNA in organizing the anterior pattern of the Drosophila embryo." The EMBO Journal 7(6): 1749-1756.
Boguski, M. and F. McCormick (1993). "Proteins regulating Ras and its relatives." Nature 366: 643-654.
Boivin. D.. D. Bilodeau and R. Beliveau (19%). "Regulation of cytoskeletal functions by Rho small GTP-binding proteins in normal and cancer cells." Can J Physiol Pharmacol 7 4: 801-810.
Bokoch. G. M.. B. P. Bohl and T. H. Chuang (1994). "Guanine nucleotide exchange regulates membrane translocation of Rac/Rho GTP-binding proteins." Journal of Biological Chemistry 269(50): 31674-31679.
Bonnefoy-Berard, N.. A. Munchi, I. Yron. S. Wu, T. L. Collins, M. Deckert. T. Shalom-Barak, L. Giampa, E. Herbert, J. Hermandez, et al. (1996). "Vav: Function and regulation in hematopoietic cell signalling." Stem Cells 14: 250-268.
Boswell, R. E. and A. P. Mahowald (1985). "rudor, A gene required for assembley of the germ plasm in Drosophila melanogaster." Cell 4 3: S^-104.
Boswell, R. E., M. E. Prout and J. C. Steichen (1991). "Mutations in a newly identified Drosophila melanogaster gene, mago nashi, disrupt germ cell formation and result in the formation of mirror-image symmetrical double abdomen embryos." Development 113: 373-384.
Bourne, H. R., D. A. Sanders and F. McCormick (1990). "The GTPase superfamily: a conserved switch for diverse cell functions." Nature 348: 125-131. Bretcher, A. (1993). "Microfilaments and membranes." Current Opinion in Cell Biology 5: 653-660.
Brittnacher, J. G. and B. Ganetzky (1984). "On the components of segregation distortion in Drosophila melanogaster. III. Nature of Enhancer of SD." Genetics 107(3): 423-434.
J 147
Buhl, A. M.. N. L. Johnson. N. Dhanasekaran and G. Johnson (1995). "Gaj,and Gttj^ stimulate rho-dependent stress fiber formation and focal adhesion assembly." Journal of Biological Chemistry 2 7©(October 20): 24631-24634.
Burgering, B. M. and P. J. Coffer (1995b). "FVotein kinase B (c-Akt) in phosphatidyIinositol-3-OH kinase signal transduction." Nature 376: 599-602. Castrena, J. and M. Saraste (1995). "Does Vav bind to F-actin through a CH domain?" bhljS Letters 374: 149-151.
Campos-Ortega, J.A. and V. Hartenstein (1985) The embryonic Development of Drosophila Melanogaster. Springer-Verlag, Berlin.
Cerione, R. and Y. Zheng (1996). 'The Dbl family of oncogenes." Current Opinion in Cell Biology 8: 216-222.
Chan. A., E. McGovem, G. Catalan©, T. Reming and T. Miki (1994). "E.xpression cDNA cloning of a novel oncogene with sequence similarity to regulators of small GTP- binding proteins." Oncogene 9: 1057-1063.
Chant. J. (1994). "Cell polarity in yeast." Trends in Genetics 10(9).
Chant, J. (1996). "Generation of Cell Polarity in Yeast." Current Opinion in Cell Biology 8(4): 557-565.
Chant, J. and L. Stowers (1995). "GTPase Cascades Choreographing Cellular Behavior Movement, Morphogenesis, and More." Cell 81(April 7): 1-4.
Chenevert, J., N. Valtz and I. Herskowitz (1994). "Identification of genes required for normal pheromone-induced cell polarization in Saccharomxces cerevisiae." Genetics 136: 1287-1297.
Chong, L. D., A. Traynor-Kaplan, G. M. Bokock and M. A. Schwartz (1994). "The small GTP-binding protein rho regulates a phosphatidylinositol 4-phosphate 5-kinase in mammalian cells." Cell 7 9(November, 4): 507-513.
Cifuentes, M. E., T. Delaney and J. J. Rebecchi (1994). "D-myo-inositol 1,4,5- trisphosphate inhibits binding of phospholipase C-gammal to bilayer membranes." Journal of Biological Chemistry. 269: 1945-1948.
Cifuentes, M. E., L. Honkanen and M. J. Rebecchi (1993). "Proteolytic fragments of phosphoinositide-specific phopholipaseC-gamma1." Journal of Biological Chemistry 268: 11586-11593.
Clark, I., E. Giniger, H. Ruohola-Baker, L. Y. Jan and Y. N. Jan (1994). "Transient posterior localization of a kinesin fusion protein reflects anteroposterior polarity of the Drosophila oocyte." Current Biology 4(4): 289-300. 148
Clark, I. E., L. Y. Jan and Y. N. Jan (1997). "Reciprocal localization of Nod and kinesin fusion proteins indicates microtubule polarity in the Drosophila oocyte, epithilium, neuron and muscle." Development 124: 461-470.
Cohen, G. B., R. Ren and D. Baltimore (1995). "Modular Binding Domains in Signal Transduction Proteins." CeU 80(January 27): 237-248.
Cooley, L. and W. E. Theurkauf (1994). "Cytoskeietal functions during Drosophila oogenesis." Science 266(October 28): 590-596.
Costa, M., D. Sweeton and E. Wieschaus (1993). Gastrulation in Drosophila: Cellular Mechanisms of Morphogenetic Movements. The Development of Drosophila melanoeaster. M. Bate and A. Martinez Arias. Plainview, New York, Cold Spring Harbor Laboratory Press. 1: 425-466.
Davis, L. H. and V. Bennet (1994). "Identification of two regions of betagamma spectrin that bind to distinct sites in brain membranes." Journal of Biolooical Chemistry 269: 4409-4416. de Frutos. R., K. Kimura and K. Peterson (1989). "In situ hybridization of Drosophila polvtene chromosomes with digoxigenin-dUTP labeled probes." Trends in Genetics 5(9): 1-2.
Debant. A., C. Serra-Pages, K. Seipel, S. Obrien, M. Tang. S. Park and M. Streuli (1996). "The multidomain protein Trio binds the LAR transmembrane tyrosine phosphatase, contains a protein kinase domain, and has separate rac-specific and rho- specific guanine nucleotide exchange factor domains." Proc. Natl. Acad. Sci. 9 3: 5466- 4571.
Dieckmann, D.. A. Abo, C. Johnston. A. Segal and A. Hall (1994). "Interaction of Rac with p67phox and regulation of phagocytic NADPH oxidase activity." Science 265: 531-533.
Divecha, J. and R. F. Irvine (1995). "Phospholipid Signalling." Cell 8 0(January 27): 269-278.
Dolz, R. (1994a). "GCG: production of multiple sequence alignment." Methods Mol Biol 24: 83-99.
Dolz, R. (1994b). "Fragment Assembly Programs." Methods Mol Biol 24: 9-23.
Dolz, R. (1994c). "GCG: Translation of DNA sequence." Methods Mol Biol 2 4: 65-82.
Dolz, El. (1994d). "(JCG: Displaying restriction sites and possible translations in a DNA sequence." Methods Mol Biol 2 4: 47-55.
Downing. A. K., P. Driscoll. I. Gout, K. Salim. M. Zvelebil and M. Waterfield (1994). "Three-dimensional solution structure of the pleckstrin homology domain from dvnamin." Current Biology 4( 10): 884-891. 149
Drgonova, J., T. Drgon, K. Tanaka, R. Kollar. G. Chen, R. A. Ford. C. S. M. Chan, Y. Takai and E. Cabib (1996). "Rhol, a yeast protein at the interface between cell polarization and morphogenesis." Science 272(April 12): 277-281.
Driever, W. and C. Niisslein-Volhard (1988a). "The bicoid protein determines position in the Drosophila embryo in a concentration-dependent manner." Cell 5 4: 95-104.
Driever, W. and C. Niisslein-Volhard (1988b). "A gradient of bicoid protein in Drosophila embryos." CeU 5 4(July 1): 83-93.
Driever, W. and C. Niisslein-Volhard (1989). "The bicoid protein is a positive regulator of hunchback transcript in the early Drosophila tvabxwo.'"' Nature 337(Januarv 12): 138- 143.
Dutartre, H., J. Davoust, J. Gorvel and P. Chavrier (1996). "Cytokinesis arrest and redistribution of actin-cvtoskeleton regulatory components in cells expressing the Rho GTPase CDC42Hs." Journal of Cell Science 109: 367-377.
Eaton, S., P. Auvinen, L. Luo, Y. N. Jan and K. Simons (1995). "CDC42 and Racl Control Different Actin-dependent Processes in the Drosophila Wing Disc Epithelium." Journal of Cell Biology 13( 1): 151-164.
Eaton, S.. R. Wepf and K. Simons (1996). "Roles for Racl and Cdc42 in planar polarization and hair outgrowth in the wing of Drosophila." The Journal of Cell Biology 135(5): 1277-1289.
Emmons, S., H. Phan, J. Calley, W. Chen, B. James and L. Manseau (1995). "cappuccino, a Drosophila maternal effect gene required for poarity of the egg and embryo, is related to the vertebrate limb deformirv locus." Genes and Development 9: 2482-2494.
Ettonsohn, C. A. (1985). "Mechanism of epithelial invagination." The Quarterly Review of Biology 6 O(September): 289-307.
Eva, A. and S. A. Aaronson (1985). "Isolation of a new human oncogene from a diffuse B-cell lymphoma." Nature 316(July 18): 273-275.
Eva, A., G. Vecchio, M. Diamond, S. R. Tronick, S. Ron, G. M. Cooper and S. A. Aaronson (1987). "Independently activated dbl oncogenes exchibit similar yet distinct structural alterations." Oncogene 1: 355-360.
Eva. A., G. Vecchio, C. D. Rao, S. R. Tronick and S. A. Aaronson 0988). "The predicted DBL oncogene product defines a distinct class of transforming proteins." Proc. Natl. Acad. Sci. 85: 2061-2065.
Evangelists, M., K. Blundell, M. Longtine, C. Chow, N. Adams, J. Pringle, M. Peter and C. Boone (1997). "Snip, a yeast formin linking Cdc42p and the actin cytoskeleton during polarized morphogenesis." Science 276(April 4): 118-122. 150
Fasano, O., D. Bimbaum, L. Edlund, J. Fogh and M. Wigler (1984). "New human transforming genes detected by a tumerogencity assay." Mol. Cell. Biol. 4: 1695-1705. Feig, L. A. (1994). "Guanine-nucleotide exchange factors: a family of postive regulators of Ras and related GTPases." Current Opinion in Cell Biology 6: 204-211.
Feng, S., J. K. Chen. H. Yu, J. A. Simon and S. L. Schreiber (1994). "Two binding orientations for peptides to the Src SH3 domain: development of a general model for SH3-ligand interactions." Science 266(November 18): 1241-1247.
Ferguson, K. M., M. A. Lemmon, J. Schlessinger and P. B. Sigler (1995). "Structure of the High Affinity Complex of Inositol Trisphosphate with a F^ospholipase C Pleckstrin Homology Domain." Cell 8 3(December 15); 1037-1046.
Ferrandon. D., L. Elphick. C. Nusslein-Volhard and D. St. Johnston (1994). "Staufen protein associates with the 3'UTR of bicoid mRNA to form particles that move in a microtuble-dependent manner." Cell 79: 1221 -1232.
Ferro-Novick, S. and R. Jehn (1994). "Vesicle fusion from yeast to man." Nature 370: 191-193.
Forristall. C.. M. Pondel, L. Chen and M. S. King (1995). "Patterns of localization and cytoskeletal association of two vegetally localized RNAs. Vgl and Xcat-2." Development 121: 201-208.
Fox, G. and R. O. Hynes (1997). Drosophila focal adhesion kinase. 38th Annual Drosophila Research Conference. Chicago, Genetics Society of America.
Freeman. J., A. Abo and J. Lambeth (1996). "Rac "insert region" is a novel effector region that is implicated in the activation of NADPH oxidase, but not PAK65." Journal of Biological Chemistry 271(33): 19794-19801.
Fristrom, D. (1988). "The Cellular Basis of Epithelial Morphogenesis. A Review." Tissue and Cell 2 0(5): 64S690.
Fristrom, D. and J. Fristrom (1975). "The mechanism of evagination of imaginal discs of Drosphilamelanogaster. 1. General considerations." Developmental Biology 43: 1- 23.
Frohman, M. A. and A. J. Morris (1996). "Phospholipid signalling: Rho is only arf the story." Current Biology 6(8): 945-947.
Frohnhofer. H. G. and C. Niisslein-Volhard (1986). "Manipulating the anteroposterior pattern of the Drosophila embryo." J. Embrvol. EXP. Morphol. 9 7: 169-179.
Fushman, D.. S. Cahill, M. A. Lemmon, J. Schlessinger and D. Cowbum (1995). "Solution structure of pleckstrin homology domains of dynamin by heteronuclear NMR spectroscopy." Proc. Natl. Acad. Sci. USA 92: 816-820. 151
Garrity, P.. R. Rao, I. Salecker, J. McGlade, T. Pawson and S. L. Zipursky (1996). "Drosophila Photoreceptor Axon Guidance and Targeting Requires the Dreadlocks SH2/SH3 Adaptor Protein." CeU 85: 639-650.
Gavis, E. R. (1995). "Gurken meets torpedo for the first time." Current Biology S( 11): 1252-1254.
Gibson, T. J., M. Hyvonen, A. Musaccion, M. Saraste and E. Bimey (1994). "PH domain: the first anniversary." TIBS 19(September): 349-353.
Gips, S. J., D. E. Kandzati and P. J. Goldschmidt-Clermont (1994). "Growth factor receptors, phospholipases. phospholipid kinases and actin reorganization." Seminars in Cell Biology 5(3 V. 201-201.
Glaven, J.. I. Whitehead, T. Nomanblhoy, R. Kay and R. Cerione (1996). "Lfc and Lsc oncoproteins represent two new guanine nucleotide exchange factors for the Rho GTP- binding protein." Journal of Biological Chemistry 271(44): 27374-27381.
Glotzer. J., R. Saffrich, M. Glotzer and A. Ephrussi (1997). "Cytoplasmic flows localize injected oskar RNA in Drosophila oocytes." Current Biology 7: 326-337.
Gonzalez-Reyes. A., H. Elliot and D. St. Johnston (1995). "Polarization of both major body axes in Drosophila by gurken-torpedo signalling." Nature 37 5(June 22): 654-658.
Gonzalez-Reyes, A. and D. St. Johnston (1994). "Role of Oocyte Position in Establishment of Anterior-Posterior Polarity in Drosophila." Science 2 66(October 28): 639-642.
Gout. I., R. Dhand. I. Hiles, M. Fry, g. Panayotou, P. Das, O. Truong, N. Tott, J. Hsuan, G. Booker, et al. (1993). **The GTPase dynamin binds to and is activated by a subset of SH3 domains." Cell 7 5: 25-36.
Guichard, A., E. Bergeret and R. Griffm-Shea (1997). "Overexpression of RnRacGAP in DrosophilanielanogasterAQK^\BX&s cytoskeletal organization in cellularising embryos and induces discrete imaginal phenotypes." Mechanisms of Development 6 1: 49-62.
Gulbins, E., K. M. Coggeshal, G. Baier, D. Telford, C. Langlet, G. Baier-Bitterlich, N. Bonnefoy-Berard, P. Bum, A. Witinghofer and A. Altman (1994). "Direct stimulation of Vav guanine nucleotide exchange activity for ras by phorbol esters and diglycerides." Molecular and Cellular Biology 14(7): 4749-4758.
Gutzeit, H. (1986). "The role of microtubules in the differentiation of ovarian follicles during vitellogenesis in Drosophila." Roux's Archive of Develpmental Biology 195: 173-181.
Habets, G. G. M., E. H. M. Scholtes, D. Zuydgeest, R. A. van der Kammen, J. C. Stam, A. Bems and J. G. Collard (1994). "Identification of an Invasion-Inducing Gene, Tiam-1, That Encodes a Protein with Homology to GDP-GTP Exchangers for Rho-like Proteins." CeU 7 7(May 20): 537-549. 152
Hall. A. (1992). "Ras-Related GTPases and the Cytoskeleton." Molecular Biology of the CeU3(May): 475-479.
Harden, N., J. Lee, H. Y. Loh, Y. M. Ong, I. Tan, T. Leung, E. Manser and L. Lim (1996). "A Drosophila homolog of the Rac- and Cdc42-activated Serine/threonine kinase FAX is a potential focal adhesion and focal complex protein that colocalizes with dynamic actin structures." Molecular and Cellular Biology 16(5): 1896-1908.
Harden, N., H. Y. Loh, W. Chia and L. Lim (1995). "A dominant inhibitory version of the small OTP-binding protein Rac disrupts cytoskeletal structures and inhibits developmental cell shape changes in Drosophila.'" Development 121: 903-914.
Hariharan, I. K., K. Hu, A. Asha, A. Quintanilla, R. M. Ezzell and J. Settleman (1995). "Characterization of rho GTPase family homologues in Drosophila melanogaster-. overexpressing Rhol in retinal cells causes a late developmental defect." The EMBQ Journal 14(2): 292-302.
Harlan, J. E.. P. J. Hajduk, H. S. Yoon and F. S. W. (1994). "Pleckstrin homology domains bind to phosphatidylinositiol 4,5-bisphosphates." Nature 37 l(September8): 168-170.
Hart, M. and S. Powers (1995). •*Ras-Cdc25 and Rho-Dbl binding assays: complex formation in vitro." Methods Emzvmol 255: 129-135.
Hart, M. J., A. Eva, T. Evans, S. A. Aaronson and R. A. Cerione (1991). "Catalysis of guanine nucleotide exchange on the Cdc42Hs protein by the dbl oncogene product." Nature 35 4( November 28): 311-314.
Hart. M. J., A. Eva, D. Zangrilli, S. A. Aaronson, T. Evans. R. A. Cerione and Y. Zheng (1994). "Cellular transformation and guanine nucleotide exchange activity are catalyzed by a common domain on the dbl oncogene product." Journal of Biological (Themistrv 269: 62-65.
Hartwig. J. H.. G. M. Bokock, C. L. Carpenter, P. A. Janmey, L. A. Taylor, A. Toker and T. P. Stossel (1995). "Thrombin receptor ligation and activated Rac uncap actin filament barbed ends through phosphoinositide synthesis in permeabilized human platelets." Cell 82: 643-653.
Hawkins, P. T., A. Eguinoea, R. G. Qiu, d. Stokoes, F. T. Cooke, R. Walters, S. Wennstrom. L. Claesson-Welsh, T. Evans and M. Symons (1995). "PDGF stimulates an increase in GTP-Rac via activation of phosphoinoside 3-kinase." Current Biology 5(4): 393-403.
Hay, B., L. Y. Jan and Y. N. Jan (1988). "A Protein Component of Drosophila Polar Granules is Encoded by vasa and Has Extensive Sequence Similarity to ATP-Dependent Helicases." Cell 5 5: 577-587.
Hays, T. S., M. E. Porter, M. McGrail, P. Grissom, P. Gosch, M. T. fuller and J. R. Mcintosh (1994). "A cytoplasmic dynein motor in Drosophila. Identification and localization during embryogenesis." J. Cell Science 107: 1557-1569. 153
Hess, J., a. Ross, R. Qiu, M. Symons and J. Exton (1997). "Role of Rho family protein in phospholipase D activation by growth factors." Journal of Biological Chemistry 2 72(3): 1615-1620.
Hill, C. S., J. Wynne and R. Treisman (1995). 'The rho family GTPases RhoA, Racl, and Cdc42Hs regulate transcriptional activation by SRF." Cell 81: 1159-1170.
Hirata, K., A. Kikuchi, T. Sasaki, S. Kuroda, K. Kaibuchi, Y. Matsuura, H. Seki, K. Saida and Y. Takai (19^). "Involvement of rho p21 in the GTP-enhanced calcium ion sensitivity of smooth muscle contraction." Journal of Biological Chemistry 267: 8719- 8722.
Hobert, O., S. J., M. Beckerle, A. Ullrich and B. Jallal (1996). "SH3 domain- dependent interaction of the proto-oncogene product Vav with the focal contact protein zyxin." Oncogene 12: 1577-1581.
Hoemann. C., E. Bergeret, A. Guichard and R. Griffin-Shea (1996). "Alternative splicing of the RnRacGAP gene." Gene 168: 135-141.
Horii. Y.. J. F. Beeler, K. Sakaguchi. M. Tachibana and T. Miki (1994). "A novel oncogene, ost, encodes a guanine nucleotide exchange factor that potentially links Rho and Rac signaling pathways." The EMBO Journal 13(20): 4776-4786.
Hou, X., E. Goldstein and N. Perrimon (1997). Drosophila Jun integrates signals from both the JNK and MAPK pathways but is selectively used by the two si^al transduction pathways in different celt types. 38th Annual Drosophila Research Conference, Chicago, Genetics Society of America.
Hulskamp, M., C. Schroder, C. Efeifle, H. Jackie and T. Diethard (1989). "Posterior segmentation of the Drosophila embryo in the absence of a maternal posterior organizer gene." Nature 338(April 20): 629-632.
Hyvonen. M., M. J. Macias, M. Nilges, H. Oschkinat, M. Saraste and M. Wilmanns (1995). "Structure of the binding site for inositol phosphates in a PH domain." The EMBO Journal 14( 19): 4676-4^5.
Ibarrondo, J., D. Joubert, M. N. Dufour, A. Cohen-Solal, V. Homburger, S. Jard and G. Guillon (1995). "Qose association of the alpha subunits of G^ and G,, G proteins with actin filaments in WRKi cells: Relation to G protein-mediated phospholipase C activation." Proc. Natl. Acad. Sci. 9 2(August): 8413-8417.
Imai, j., A. Toh-e and Y. Matsui (1996). "Genetic analysis of the Saccharomyces cerevisiae RH03 gene, encoding a Rho-type small GTPase, provides evidence for a role in bud formation." Genetics 142: 359-369.
Ingham, P. (1988). "The molecular genetics of embryonic pattern formation in Drosophila^ Nature 335: 25-34. 154
Inglese. J., W. J. Koch, K. Tauhara and R. J. Lefkowitz (1995). "GPy interactions with PH domains and Ras-MapK signaling pathways." Trends in Biochemal Science 20(ApriI): 151-156.
Ingley, E. and B. A. Hemmings (1994). "Pleckstrin homology (PH) domains in signal transduction." J. Cell Biochem 56: 436-443.
Irish, v., R. Lehmann and M. Akam (1989). 'The Drosophila posterior-group gene nanos functions by repressing hunchback activity." Nature 338(April 20): 64^64
Jalink, K., J. van Corven, T. Hengeveld, N. Morii, S. Naruraiya and W. Moolenaar (1990). "Inhibition of Isophosphatidate- and thrombin induced neurite retraction and neuronal cell rounding by ADP ribosylation of the small GTP-binding protein Rho." Journal of Cell Biology 126: 801-810.
Jowett, T. (1986). Preparations of Nucleic Acids. Drosophila: a Practical Approach. Washington. DC. IRL Press. 1; 275-286.
Jung. G- C. Schmidt and J. Hammer (1989). "Myosin I heavy-chain genes of Acanthamoebacastellanii-. cloning of a second gene and evidence for the existence of a third isoform." Gene 8 2: 269-280.
Kanematsu. T. e. a. (1992). "Putative inositol 1,4.5 triphosphate binding proteins in the rat brain cytosol." Journal of Biological Chemistry 2 67: 6518-6525.
Katzav, S., Martin-Zanca and M. Barbacid (1989). "Vav. a novel human oncogene derived from a locus ubiquitously expressed in hematopoietic cells." The EMBQ Journal 8(8): 2283-2290.
Keller, R. and J. Hardin (1987). "Cell behaviour during rearrangement: evidence and speculations." J. Cell Science Supplement 8: 369-393.
Kerridge, S. and M. Thomas-Cavillan (1988). "Appendage morphogenesis in Drosophila: a developmental smdy of the rotund (m) gene." Rouxs Archive of Developmental Biology 197: 19-26.
Khosravi-Far, R., M. Chrzanowska-Wodnicka, P. A. Solski, A. Eva, K. Burridge and C. J. Der (1994). "Dbl and Vav mediate transformation via mitogen-activated protein kinase pathways that are distinct from thos activated by oncogenic ras." Molecular and Cellular Biology 14: 6848-6857.
Kiehart, D. P., A. Ketchum, P. Younr, D. Lutz, M. R. Alfenito, X. Chang. M. Awobuluyi, T. C. Pesacreta, S. Inoue, C. T. Stewart, et al. (1990). "Contractile Proteins in Drosophila Development." Annals of the New York Academy of Science 582: 233-251.
Kimura, K.. M. Ito, M. Amano, K. Chihara, Y. Fukata. M. Nakafuku, B. Yamamori, J. Feng. T. Nakano, K. Okawa, et al. (1996). "Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase)." Science 2 7 3(July 12): 245-248. 155
King. R. C. (1970). Ovarian development in Drosophilamelanogaster. New York. Academic FYess.
King, R. C., J. D. Cassidy, O. P. Rousset and A. Rousset (1982). The Formation of Clones of Interconnected Cells during Gametogenesis in Insects. Insect Ultrastnicture. R. C. King and Akai, Plenum Publishing Corporation. 1: 3-31.
Kirchhausen, T. and F. S. Rosen (1996). "Disease mechanism: unravelling Wilskott- Aldrich syndrome." Current Biology 6: 676-678.
Kishi. K.. T. Sasaki, S. Kuroda, T. Itoh and Y. Takai (1993). "Regulation of cytoplasmic division of Xenopus embryo by rho p2l and its inhibitory GDP/GTP exchange protein {rho GDI)." Journal of Cell Biology 120(5): 1187-1195.
Knowles, B. and L. Cooley (1994). "The specialized cytoskeleton of the Drosophila egg chamber." Trends in Genetics 10: 235-241.
Koch, W. J.. J. Inglese. W. C. Stone and R. J. Lefkowitz (1993). "The Binding Site for the p-y subunits of heterotrimeric G proteins on the beta-adrenergic receptor kinase." Journal of Biological Chemistry 268(April 15): 8256-8260.
Konishi, H., S. Kurada and U. Kikawa (1994). "The pleckstrin homology domain of RAC protein kinase associates with the regulator domain of protein kinase C p." Biochem Biophvs Res Commun 205: 1770-1775.
Konishi, H., H. Matsuzaki, M. Tanaka, Y. Ono, C. Tokunaga, S. Kuroda and U. Kikkawa (1996). "Activation of RAC-protein kinase by heatshock and hyperosmolarity stress through a pathway independent of phosphatidylinositol 3-kinase." Proc. Natl. Acad. Sci. USA 9 3: 7639-7643.
Konrad, K. D., L. Enstrom, N. Perrimon and A. P. Mahowald, Eds. (1985). Genetic analysis of oogenesis and the role of maternal gene expression in early development. Developmental Biology, Plenum Publishing Corporation.
Kosako, H., M. Amano, M. Yanagida, K. Tanabe, Y. Nishi, K. Kaibuchi and M. Inagaki (1997). "Phosphorylation of glial fibrillary acidic protein at the same sites by cleavage furrow kinase and Rho-associated kinase." Journal of Biological Chemistry 272: 10333-10336.
Kureishi, Y., S. Kobayashi, M. Amano, K. Kimura, H. Kanaide, T. Nakano, K. Kaibuchi and M. Ito (1997). "Rho-associated Kinase directly induces smooth muscle contraction through myosin light chain phosphorylation." Journal of Biological (Jiemistry 2 7 2(19): 12257-12260.
Kwak, J. Y. (1995). "RhoA and a cytosolic 50-kDa factor reconstitute GTP y S- dependent phospholipase D activity in human neutrophil subcellular fractions." Journal of Biological Chemistry 270: 270^-27098. 156
Lamarche. N. a. H.. A. (1994). "GAPs for rho-related GTPases." Trends in Genetics 10(12): 436^M0.
Lamaze, C., H. Chuang, J. Terlecky, G. Bococh and S. Schnaid (1996). "Regulation of receptor-mediated endocytosis by Rho and Rac." Nature 382: 177-179.
Larochelle, D., K. Vithalani and a. De Lozanne (1996). "A novel member of the rho family of small GTP-binding proteins is specifically required for cytokinesis." The Journal of Cell Biology 133(6): 1321-1329.
Laudanna, C., J. J. Campbell and E. C. Butcher (1996). "Role of Rho in chemoattractant-activated leukocyte adhesion through integrins." Science 271: 981-983.
Laverty, T. (1990). Chromosome in situ hybridization using biotin labeled probes. Methods Book. The Rubin Lab. 1: 26-32.
Leberer. E., D. Thomas and M. Whiteway (1997). "Pheromone signalling and polarized morphogenesis in yeast." Current Opinion in Genetics and Development 7: 59-66.
Leevers. S.. D. Weinkove, L. MacDougaL E. Hafen and M. Waterfield (1997). Molecular and functional characterisation of the E)rosophila Phosphoinosited3-kinase. Dp 110.38th Annual Drosophila Research Conference, Chicago, Genetic Society of America.
Lehman, R. and C. NUsslein-Volhard (1986). "Abdominal segmentation, pole cell formation and embryonic polarity require the localized activity of oskar. a maternal gene \n Drosophila.'' Cell 47(October 10): 141-152.
Lehman, R. and C. Nusslein-Volhard (1991). "The maternal gene nanos has a central role in posterior pattern formation of the Drosophila embryo." Development 112: 679- 691.
Lemmon. M. A., K. M. Ferguson and J. Schlessinger (1996). "PH Domains: Diverse Sequences with a Common Fold Recruit Signaling Molecules to the Cell Surface." Cell 8S(May3l, 1996): 621-624.
Leung, T., X. Chen, E. Manser and L. Lim (1996). "The pl60 RhoA-binding kinase ROKa is a member of a kinase Family and is involved in the reorganization of the cytoskeleton." Molecular and Cellular Biology 16( 10): 5313-5327.
Li, R. and Y. Zheng (1997). "Residues of the Rho family GTPases Rho and Cdc42 that specify sensitivity to Dbl-like guanine nucleotide exchange factors." The Journal of Biological Chemistry 2 7 2(8): 4671-4679.
Li, R., Y. Zheng and D. G. Drubin (1995). "Regulation of cortical actin cytoskeleton assembly during polarized cell growth in budding yeast." Journal of Cell Biology 128: 599-615.
Lim. W., F. Richards and R. Fox (1994). "Structural determinants of peptide-binding orientation and of sequence specificity in SH3 domains." Nature 3 7 2: 375-379. 157
Lombardo, C. R., S. A. weed, S. P. Kennedy, B. G. Forget and J. S. Morrow (1994). "P II spectrin (fodrin) and p I epsilon2-spectrin (muscle) contain NH2- and COOH- terminal membrane association domains (MADl and MAD2)." Journal of Biological Chemistry 269: 292I2-292I9.
Ludbrook, S., J. Eccleston and M. Strom (1997). "Cloning of a rhoGAP homolog from Dictyostelium discoideum." J. Biol. Chem. 27 2: 15682-15685.
Luo, L., Y. J. Liao, L. Y. Jan and Y. N. Jan (1994). "Distinct morphogenetic functions of similar small GTPases: Drosophila Drac1 is involved in axonal outgrowth and myoblast fusion." Genes and Develooement 8( 15): 1787-1802.
Mabuchi, I., Y. Hamaguchi, H. Fujimoto, N. Morii, M. Mishima and S. Narumiya (1993). "A rho-like protein is involved in the organisation of the contractile ring in dividing sand dollar eggs." Zygote 1(November): 325-331.
Madaule, P., T. Furuyashiki, T. Reid, T. Ishizaki, G. Watanabe, N. Morii and S. Narumiya (1995). "A novel partner for the GTP-bound forms of rho and rac." FEBS Letter 377: 243-248.
Mahajan-Miklos, S. and L. Cooley (1994). "Intercellular cytoplasm transport during Drosophila oogenesis." Developmental Biology 16S: 336-351.
Manseau. L., J. Calley and H. Phan (1996). ''Profilin is required for posterior patterning of the Drosophila oocyte." Development 122: 2109-2116.
Manseau, L. J. and T. Schiipbach (1989). "cappucino and spire: Two unique maternal- effect loci required for both the anteroposterior and dorsoventral patterns of the Drosophila embryo." Genes and Development 3: 1437-1452.
Marhoul, J. F. and T. Adams (1995). "Identification of developmental regulatory genes in Aspergillus nidulans by overexpression." Genetics 139: 537-547.
Marshall, C. J. (1995). "Specificity of Receptor Tyrosine Kinase Signaling: Transient versus Sustained Extracellular Signal-Regulated FGnase Activation." Cell 8 ©(January 27): 179-185.
Matsui, Y. and A. Tohe (1992). "Yeast Rho3 and Rho4 ras superfamily genes are necessary for bud growth and their defect is suppressed by a high dose of bud formation genes Cdc42 and Beml." Molecular and Cellular Biology 12( 12): 5690-5699. Mayer, B. and D. Baltimore (1994). "Signalling through SH2 and SH3 domains." Trends in Cell Biolo°y 3: 8-13.
Mayer. B. and M. Eck (1995). "Minding your p's and q's." Current Biology 5(4): 364- 367.
McCartney, B. and R. Fehon (1996). "Disctinct cellular and subcellular patterns of expression imply disctinct function for the Drosophila homologues of moesin and the neurofibromatosis 2 tumor suppressor. Merlin." The Journal of Cell Biology 133(4): 843-852. 158
McCollam, L., L. Bonfini, C. A. Karlovich, B. R. Conway. L. M. Kozma, U. Baneijee and M. P. Czech (1995). "Functional roles for the pleckstrin and Dbl homology regions in the ras exchange factor Son of sevenless." The Journal of Biological Chemistry 270(July7): 15954-15957.
McCormick, F. (1993). "The GTPase superfaniily." Ciba Foundations 176: 1-5. Meyer, M. and S. Parkhurst (1997). Mutations in the Rho small GTPases result in morphooenetic and segmentation defects during embrvogenesis. 38th Annual Drosophila Research Conference, Chicago. Genetic Society of America.
Michiels, F., G. G. M. Habets, J. C. Stam, R. A. van der Kanunen and J. G. Collard (1995). "A role for Rac in Tiaml-induced membrane ruffling and invasion." Nature 375(May 25): 338-340.
Micklem. D. R. (1995). "mRNA localisation during development." Developmental Biolooy 172: 377-395.
Miki, T. (1995). "interaction of Ect2 and Dbl with Rho-related GTPases." Methods in Enzvmolooy 2 56: 90-99.
Miki, T., C. L. Smith, J. E. Long, A. Eva and T. P. Fleming (1993). "Oncogene ect2 is related to regulators of small GTP-binding proteins." Nature 362( April 1): ^2-465. Morii, N. and S. Nakamiya (1992). "Ras oncogene-related small molecular weight GTP- binding protein, rho gene produced and botulinum C3 ADP-ribosyltransferase." Nippon YakurigakuZasshi 99: 191-203.
Mowry, K. L. (1996). "Complex formation between stage-specific oocyte factors and a Xenopus mRNA localizaaiton element." Proc. Natl Acad. Sci. USA 9 3: 14608-14613.
Munn, K. and R. Steward (1995). 'The anterior-posterior and dorsal-ventral axes have a common origin in Drosophila melanogaster." BioEssavs 17( II): 920-922.
Murata, Y. and R. Wharton (1995). "Binding of F^imilio to Maternal hunchback mRNA is required for Posterior patterning in Drosophila embryos." Cell 8 0(March 10): 747- 756.
Murphy and D. Montell (1996). "Cell type specific roles for Cdc42, Rac and RhoL in Drosophila Oogenesis." Journal of Cell Biology. 133(3): 617-630.
Musacchio, A., T. Gibson, B. Lehto and M. Saraste (1992). "SH3-an abundant protein domain in search of a function." FEBS Letters 307: 55-61.
Nakamura, T., M. Asano, N. Sindo-Okada, S. Nishimura and Y. Monden (1996). "Qoning of the RhoB gene from the mouse genome and characterization of its promoter region." Biochemical and Biophysical Research Communications 2 26(3): 688-94.
Narumiya, S. (1996). "The small GTPase Rho: cellular functions and signal transduction." Journal of Biochemistry (Tokvo) 120: 215-228. 159
Neuman-Silberberg, F. S. and T. Schiipbach (1993). "The Drosophila dorsoventral patterning gene gurken prcxiuced a dor^ly localized RNA and encodes aTGFa-like protein." Cell 75: 165-174.
Neuman-Silberberg, F. S. and T. Schiipbach (1994). "Dorsoventral axis formation in Drosophila depends on the correct dosage of the gene gurken."" Development 120:2457- 2463.
Newmark, P. A. and R. E. Boswell (1994). "The mago nashi locus encodes an essential product required for germ plasm assembly in Drosophila"" Development Supplement 120(5): 1303-1313.
Nishida, H. (1994). "Localization of determinants for formation of the anterior-posterior axis in eggs of the ascidian Halocynihia roretzi." Development 120: 3093-3104.
Nishiki, T., S. Noarumiya, N. Morii, M. Yamamoto, M. Fujiwara, Y. Kamata, G. Sakaguchi and S. Kozald (1990). "ADP-ribosylation of the rho/rac proteins induces growth inhibition, neurite outgrowth and acetylsholine esterase in cultured PC-12 cells." Biochemical and Biophysical Research Communication 167: 256-272.
Nobes, C. and A. Hall (1994). "Regulation and function of the Rho subfamily of small GTPases." Current Opinion in Genetics and Development 4: 77-81.
Nobes, C. D. and A. Hall (1995). "Rho, Rac, and Cdc42 GTPases Regulate the Assemble of Multimolecular Focal Complexes Associated with Actin Stress Fibers. Lamellipodia, and Filopodia." Cell 81: 53-62.
Nobes, C. D., P. Hawkins, L. Stephens and A. Hall (1995). "Activation of the small GTP-binding proteins rho and rac by growth factor receptors." Journal of Cell Science 108: 225-233.
Nomura, N., N. Miyajima, T. Sazuka, A. Tanaka, Y. Kawarabayashi, T. Nagase, K. Ishikawa, T. Seki and S. Tabata (1994). "Prediction of the coding sequences of unidentified human genes. I. The coding sequence of 35 genes deduced by anaoysis of randomly sampled cDNA clones from human immature myeloid cell line KGl." DNA Research 1: 27-35.
Norman, J. C., L. S. Price, A. J. Ridley, A. Hall and A. Koffer (1994). "Actin Filament Organization in Activated Mast Cells Is Regulated by Heterotrimeric and Small GTP-binding Proteins." Journal of Cell Biology 126(4'>: 1005-1015.
Nusrat, A., M. Giry, J. R. Turner, S. P. Colgan, C. A. Parkos, D. Came, E. Lemichez, P. Boquet and J. L. Madara (1995). "Rho protein regulates tight junctions and perijunctional actin orgaization in polarized epithelia." Proc. Natl Acad. Sci.. USA 9 2: 5027-5031.
Niisslein-Volhard, C., H. G. Frohnhofer and R. Lehmann (1987). "Determination of anterioposterior polarity in Drosophila."" Science 2 3 8: 167S1681. 160
Ohguchi, K., Y. Banno. S. Nakashima and Y. Nozawa (1995). "Activation of membrane-bound phosphoUpase D by protein kinase C in HL60 cells: synergistic action of a small GTP-binding protein RhoA." Biochem Biophvs Res Corrunun 211: 306-311.
Otto, B., A. Steusloff, 1. Just, K. Actories and G. Pfitzer (1996). "Role of Rho proteins in carbachol-induced contractions in intact and permeabilized guinea-pig intestinal smooth muscle." Journal of Physiology 496(2): 317-329.
Park, W., R. Mosteller and D. Broek (1994). "Amino acid residues in the CDC25 guanine nucleotide exchange factor critical for interaction with Ras." Molecular & Cellular Biology 14d2'): 8117-8122.
Parks, S. and E. Wieschaus (1991). "The Drosophila Gastrulation Gene concertina Encodes a Galpha-like Protein." Cell 6 4: 447-4^.
Paterson, H. F., A. J. Self, M. D. Garrett, I. Just. K. Aktories and A. Hall (1990). "Microinjection of recombinant p21 rho induces rapid changes in cell morphology." The Journal of Cell Biology 111: IC)01-1007.
Pawson. T. (1995). "Protein-tvrosine kinases. Getting down to specifics." Nature 373(6514): 477-478.
Pawson. T. and G. Gish (1992). "SH2 and SH3 domains: from structure to function." Cell 7 1: 359-362.
Peppelenbosch, M., L. Tertoolen, A. d Vries-Smits, R. Qiu. L. M'rabet, M. Symons. S. de Laat and J. Bos (1996). "Rac-dependent and -independent pathways mediate growth factor-induced Ca2+ influx." The Journal of Biological Chemistry 2 71( 14): 7883-7886.
Pitcher, J. A., J. Inglese, J. B. Higgins, J. L. Arriza. P. J. Casey, C. Kim, J. L. Benovic, M. M. Kwatra, M. G. Caron and R. J. Lefkowitz (1992). "Role of P-y subunits of G proteins in targeting the P-adrenergic receptor kinase to membrane-bound receptors." Science 2S7(August 28): 1264-1267.
Pleiman, C., W. Hertz and J. Combier (1994). "Activation of phosphatidylinositol-3' kinase by Src-family kinase SH3 binding to the p85 subunit." Science 259: 1157-1161. Pokrywa, N. J. and E. C. Stephenson (1^5). "N^crotubules are a general component of mRNA localization systems in Drosophila oocytes." Developmental Biology 167: 363- 370.
Poki^ka, N. J. and S. Stephenson (1991). "Microtubules mediate the localization of bicoid RNA during Drosophila oogenesis." Development 113: 55-66.
Prendergast, G. C. and J. B. Gibbs (1994). "Ras regulatory interactions: Novel targets for anti-cancer intervention." BioEssavs 16(3): 187-191. 161
Qadota. H., C. P. Python, S. B. Inoue. M. Arisawa, Y. Anraku, Y. Zheng, T. Watanabe, D. E. Levin and Y. Ohya (1996). "Identification of yeast Rholp GTPase as a regulatory subunit of 13-beta-glucan synthase." Science 27 2(April 12): 279-281.
Qiu, R., A. Abo, R. McCormick and M. Symoms (1997). "Cdc 42 regulates anchorage- independent growtht and is necessary for Ras transformation." Molecular and Cellular Biologv 17; 3449-3458.
Quilliam, L., M. Hisaka, S. Zhong, A. Lowry, R. Mosteller, J. Han, J. Drugan, D. Broek, S. Campbell and C. Der (1996). "Involvement of the switch 2 domain of Ras in its interaction with guanine nucleotide exchange factors." The Journal of Biological Chemistry 271(19): 11076-11082.
Quilliam. L.. K. Kato, K. rabun, M. Hisaka, S. Huff, S. Campbell-Burk and C. Der (1994). 'identification of residues critical for Ras( 17N) growth-inhibitory phenotype and for Ras interaction with guanine nucleotide exchange factors." Molecular & Cellular Biologv 14(2): 1113-1121.
Reid, T.. T. Furuyashiki, T. Ishizaki. G. Watanabe, N. Watanabe, K. Fujisawa, N. Morii, P. Madaule and S. Narumiya (1996). "Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, PKN and rhophilin in the FUio-binding domain." Journal of Biological (Themistrv 271: 13556-13560.
Reinhard, J., A. A. Scheel, D. Diekmann, A. Hall, C. Ruppert and M. Bahler (1995). "A novel type of myosin implicated in signalling by rho family GTPases." TheEMBO Journal 14(4): 697-704.
Ren, R., B. Mayer, P. Cicchetti and D. Baltimore (1993). "Identifiction of a ten-amino acid proline-rich SH3 binding site." Science 259: 1157-1161.
Ren, X. D., B. M. Bokoch, A. Traynor-Kaplan, G. H. Jenkins, R. A. Anderson and M. A. Schwartz (1996). "Physical association of the small GTPase rho with a 68-kDa Phosphatidylinositol 4-Phosphate 5-Kinase in Swiss 3T3 cells." Molecular Biologv of the Cell 7(March): 435-442.
Rickles, R. J., M. Botfield, X. Zhou, P. Henry, J. Brugge and M. Zoller (1995). "Phage display selection of ligand residues important for Src homology 3 domains binding specificity." Proc. Natl. Acad. Sci. USA 9 2: 10909-10913.
Ridley, A. and A. Hall (1994). "Signal transduction pathways regulating Rho-mediated stress fibre formation: requirement for a tyrosine kinase." The I^IBO Journal 13( 11): 2600-2610.
Ridley, A. J. and A. Hall (1992). 'The small STP-binding protein rho regulates the assemble of focal adhesions and actin stres fibers in response to growth factors." Cell 7 0( Auggust 7): 389-399.
Ridley, A. J., H. F. Paterson, C. L. Johnston, D. Diekmann and A. Hall (1992). "The small GTP-binding protein rac regulates growth factor-induced membrane ruffling." Cell 70:401^10. 162
Riesgo-Escovar. J. and E. Hafen (1997). The iun-N-terminal kinase and Dpp signaling pathways in Drosophila during dorsal closure. 38th Annual Drosophila Research Conference, Chicago, Genetics Society of America.
Ron, D.. G. Graziani, S. A. Aaronson and A. Eva (1989). '"The N-terminal region of proto-dbl down regulates its transforming activity." Oncogene 4: 1067-1072.
Ron, D., S. Tronick, S. Aaronson and A. Eva (1988). "Molecular cloning and characterization of the human dbl proto-oncogene: evidence that its overexpression is sufficient to transform NIH3T3 cells." EMBO Journal 7: 2465-2473.
Ron. D.. M. Zannini, M. Lewis. R. B. Wickner, L. T. Hunt, G. Graziani. S. R. Tronick, S. A. Aaronson and A. Eva (1991). "A region of proto-dbl essential for its transforming activity shows sequence similarity to a yeast cell cycle gene CDC24 and the human breakpoint cluster gene, bcr." The New Biolopjst 3(4): 372-379.
Roth. S.. F. S. Neuman-Silberberg, G. Barcelo and T. Schupbach (1995). "comichon and the EGF receptor signaling process are necessary for both anterior-posterior and dorsal-ventral pattern formation in Drosophila." Cell 8 KJune 16): 967-978.
Rothman, J. E. (1994). "Mechanisms of intracellular protein transport." Nature 372: 55- 62.
Ruohola, H., K. A. Bremer. D. Baker. J. R. Swedlow, L. Y. Jan and Y. N. Jan (1991). "Role of neurogenic genes in establishment of follicle cell fate and oocyte polarity during oogenesis in Drosophila." Cell 66(August 9): 433-449.
Rush, M., G. Drivas and P. D'Eustachio (1996). "The small nuclear GTPase Ran: how much does it run?" Bioessavs 18: 103-112.
Sah, v.. M. Hoshijima. K. Chien and J. Brown (1996). "Rho is required for Gaq and a 1-adrenergic receptor signaling in cardiomyocytes. Dissociation of Ras and Rho pathways." J. Biol. Chem. 271(49): 3118S31190.
Sambrook, J., E. F. Fritsch and T. Maniatis (1989). Molecular Cloning. AI .ahoratorv manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press.
Sazer, S. (1996). 'The search for the primary function of the RanGTPase continues." Trends in Cell Biology 6: 81-85.
Schlessinger, J. (1994). "SH2/SH3 signalling proteins." Current Opinion in Genetics and Development 4: 25-30.
Schmidt, A., M. Bickle, T. Beck and M. Hail (1997). "The yeast phosphatidylinositol kinase homolog T0R2 activates RHOl and RH02 via the exchange factor R0M2." Cell 88: 531-542. 163
Schmidt, M., C. Rumenapp, C. Bienek. J. Keller, C. von Eichel-Streiber and K. Jakobs (1996). "lohibition of receptor signaling to phospholipase D by Clostridium difficile toxin B. role of Rho proteins." Journal of Biolopcal Chemistry 271: 2422-2426.
Schiipbach, T. and E. Wieschaus (1986a). "Germline autonomy of maternal-effect mutations altering the embryonic body plan of Drosophila'" Developmental Biolooy 113:443-448.
Schiipbach, T. and E. Wieschaus (1986b). "Maternal-effect mutations altering the anterior-posterior pattern of the Drosophila embryo." Roux's Archive of Developmental biology. 195: 302-317.
Seidel-Dugan, C., B. Meyer and S. B. Thomas, J. (1992). "Effects of SH2 and SH3 deletions on the functional activities of wild-type and transforming variants of c-Src." Molecular and Cellular Biologv 12: 1835-1845.
Shaw, G. (1996). "The pleckstrin homology domain: an intriguing multifunctional protein module." BioEssavs 18( 1): 35-46.
Shinjo. K., J. G. Koland, M. J. Hart, V. Narasimhan. D. I. Johnson, T. Evans and R. A. Cerione (1990). "Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): Identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein Cdc42." Proc. Natl. Acad. Sci. USA 8 7: 9853- 9857.
Siegel, v.. T. A. Jongens, L. Y. Jan and Y. N. Jan (1993). "pipsqueak, an early acting member of the posterior group of genes, affects vasa level and germ cell-somatic cell interaction in the developing egg chamber." Development 119: 1187-1202.
Sone, M., M. Hoshino, E. Suzuki, S. Kuroda, K. Kaibuchi, H. Nakagoshi. K. Saigo. Y. Nabeshima and C. Kama (1997). "Still life, a protein in synaptic terminals of drosophila homologous to GDP-GTP exchangers." Science 2 7 5(January 24): 543-546.
Sparks, A. B., J. E. Rider, N. G. Hoffman, D. M. Fowlkes, L. A. Quilliam and B. K. Kay (1996). "Distinct ligand preferences of Src homology 3 domains from Src, Yes, Abl, Cortactin, p53bp2, PLCy, crk, and Grb2." Proc. Natl. Acad. Sci. USA 9 3: 1540- 1544.
Spradling, A. C. (1993a). Developmental Genetics of Oogenesis. The Development of DrosophilamelanoBoster. M. Bate and A. Matinez Arias. Plainview, New York, Cold Spring Harbor Laboratory Press. 1: 1-70.
Spradling, A. C. (1993b). "Germline Cysts: Communes that work." Cell 7 2(March 12): 649-651.
St. Johnston, D. (1993). Pole plasm and the posterior group genes. The development of Drosophila melanoBoster. M. Bate and A. Martinez Arias. Plainview, New York, Cold Spring Harbor laboratory press. 1: 325-364. 164
St. Johnston, D., D. Beuchle and C. Niisslein-Volhard (1991). "'staufen, a gene required to localize maternal RNAs in the Drosophila egg." Cell 6 6: 51-63.
St. Johnston, D., W. Driever, T. Berleth and S. a. N.-V. Richstein, C. (1989). •'Multiple steps in the localization of bicoid mRNA to the anterior pole of the Drosophila oocyte." Development 107 Supplement: 13-19.
Stephenson, E. C. and N. J. Pokrywka (1992). "Localization of bicoid message during Drosophila Oogenesis." Current Topics in Developmental Biologv 2 6: 23-33.
Stowers, L. (1995). "Regulation of the polarization of T cells toward antigen-presenting cells by Ras-related GTPase CDC42/." Proc Natl Acad Sci USA 9 2( 11): 5027-5031.
Strome, S. and W. B. Wood (1983). "Generation of asymmetry and segregation of germ line granules in early C. elegans embryos." Cell 3 5: 15-25.
Stroumbakis, N.D., Z., Li and P. Tolias (1994) RNA- and Single- Stranded DNA- binding (SSB) Proteins Expressed During Drosophila Melanogaster Oogenesis: a Homolog of Bacterial and Eukaryotic Mitochondrial SSBs. Gene 143:171-177
Struhl, G. (1989). "Differing strategies for organizing anterior and posterior body pattern in Drosophila embryos." Nature 338(April 27): 741-744.
Sullivan, W. and W. E. Theurkauf (1995). "The cytoskeleton and morphogenesis of the early Drosophila embryo." Current Biologv 7: 18-22.
Swalla. B. and W. Jeffery (1995). "A maternal RNA localized in the yellow crescent is segregated to the laral muscle cells during ascidian development." Developmental Biologv 170: 353-364.
Symons, M. (1996). "Rho family GTPases: the cytoskeleton and beyond." Trends Biochem Sci 2 l(May): 178-181.
Symons, M. (1996). "Wiscott-Aldrich syndrome protein, a novel effector for the GTPase Cdc42Hs, is implicated in actin polymerization." Cell 8 4(March 8): 723-734.
Takai, Y., T. Sasaki, K. Tanaka and H. Nakanishi (1995). "Rho as a regulator of the cytoskeleton." Trends in Biochemical Science 20(227-231).
Tamkun, J. W., R. Deuring, M. P. Scott, M. Kissinger, A. M. Pattucci, T. C. Kaufman and J. A. Kennison (1992). '^brahma: a regulator of drosophila homeotic genes structurally related to the yeast transcriptional activator SNT^SWI2." Cell 6 8: 561-572.
Tanaka, M. S. (1985). "Poly (L-proline)-binding proteins from chick embryos are profilin and profilactin." Eur. J. Biochem. 151: 291-297.
Tapon. N. and A. Hall (1997). "Rho, Rac, and Cdc42 GTPases regulate the organization of the actin cytoskeleton." Current Opinion in Cell Biologv 9: 86-92. 165
Tautz, D. and C. Pfeiffle (1989). "A non-radioactive in situ hybridzation protocol for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene Chromosoma 9 8: 81-85.
Theurkauf. W., S. Smiley, M. Wong and B. Alberts (1992). "Reorganization of the cytoskeleton during Drosophila oogenesis: implications for axis specification and intercellular transport." Development 115: 923-936.
Theurkauf, W. E., B. M. Alberts, Y. N. Jan and T. A. Jongens {1993). "A central role for microtubules in the differentiation of Drosophila oocytes." Development 118: 1169- 1180.
Timm, D-, K. Salim, I. Gout, L. Guruprasad and M. Waterfield (1994). "Crystal structure of the pleckstrin homology domain from dynamin." Nature Structural Biologv 1(11): 782-788.
Tominaga, T.. K. Sugie. M. Hirata, N. Morii, J. Fukata, A. Uchida, H. Imura and S. Narumiya (1993). "Inhibition of PMA induced, LFA-1 dependent lymphocyte aggregation by ADP ribosylation of the small molecular weight GTP binding protein, rho." The Journal of Cell Biology 129(6): 1529-1537.
Touhara, K., J. Inglese. J. Pitcher, G. Shaw and R. J. Lefkowitz (1994). "Binding of G Protein P-y-Subunits to Pleckstrin Homology Domains." Journal of Biological Chemistry 2 6 9( April 8): 10217-10220.
Urich, M., M. Senften. P. Shaw and K. Ballmer-Hofer (1997). "A role for the small GTPase Rac in polyomavirus middle-T antigen-mediated activation of the serum response element in cell transformation." Oncogene 14: 1235-1241.
Van Aelst, L., J. T. and D. Bar-Sagi (1996). "Identification of a novel rac 1-interacting protein involved in membrane ruffling." EMBO Journal 15: 37788-3786.
Van Leeuwen. F. N., R. A. Van der Kammen, G. G. M. Habets and J. G. Collard (1995). "Oncogenic activity of TiamI and Racl in NIH3T3 cells." Onco°ene 11: 2215- 2221.
Vincent, S., P. Jeanteur and P. Fort (1992). "Growth-Regulated Expression of rhoG, a New Member of the ras Homolog Gene Family." Molecular and Cellular Biology 12(7): 3138-3148.
Wang, C. and R. Lehmann (1991). "Nanos is the localized posterior determinant in Drosophila." Cell 6 6(August 23): 637-647.
Wang, D., R. Shaw, M. Hattori, H. Arai. K. Inoue and G. Shaw (1995). "Binding of pleckstrin homology domains to WT>40/beta-transducin repeat containing regions of the P-subunit of trimeric G-proteins." Biochem. Biohphvs. Res. Commun. 203: 622-629. 166
Wang. D., R. Shaw, J. Winkelmann and G. Shaw (1994). "Binding of PH domains of P-adrenergic receptor kinase and p-spectrin to WD40/p-transducin repeat containing region os the p-subunit of trimeric G-proteins." Biochem. Biophvs. Res. Commun. 203: 29-35.
Warn, R. M., R. Magrath and S. Webb (1984). "Distribution of F-Actin during Cleavage of the Drosophila Syncytial Blastoderm." The Journal of Cell Biolooy 98(January): 156-162.
Wassarman, D. A., M. Therrien and G. M. Rubin (1995). "The Ras signaling pathway in Drosophila." Current Opinion in Genetics and Development. 5: 44-^.
Watanabe, G.. Y. Saito, P. Madaule, T. Ishizaki, K. Fujisawa, N. Morii, H. Mukai, Y. Ono. A. Kakizuka and S. Narumiya (1996). "Protein kinase N (PKN) and PKN-related protein Rhophilin as targets of small GTPase Rho." Science 271: 645-648.
Watanabe. N., et al. (.1997). "pI40mDia, a mammalian homolog of Drosophila diaphahous, is a target protein for Rho small GTPase and is a ligand for profilin." The EMBO Journal 16( 11): 3044-3056.
Wennstrom, S. (1994). "Activation of phosphoinositide i-kineise is required for PDGF- stimulated membrane mffling." Current Biology 4(5): 385-393.
Werner, L. and L. Manseau (1997). " A Drosophila gene with predicted RhoGEF, Pleckstrin Homology and SH3 domains is highly expressed in invaginating tissues." Gene 187: 107-114.
Whitehead, 1., H. Kirk and R. Kay (1995b). "Retroviral transduction and oncogenic selection of a cDNA encoding Dbs, a homolog of the Dbl guanine nucleotide exchange factor." Oncogene 10: 713-721.
Whitehead, I.. H. Kirk, C. Tognon, G. Trigo-Gonzalez and R. Kay (1995a). "Expression cloning of Ifc, a novel oncogene with structural similarites to guanine nucleotide exchange factors and to the regulatory region of protein kinase C." Journal of Biological Chemistry 270(31): 18388-1^95.
Wilson, R., R. Ainscough, K. Anderson, C. Baynes, M. Berks, J. Bonfield, J. Burton, M. Connell, T. Copsey, J. Cooper, et al. (1994). "2.2 MB of contiguous nucleotide sequence from chromosome III of C. elegans." Nature 368: 32-38.
Wirth, J. A., A. Jensen, P. Post, W. Bement and M. Mooseker (1996). '*Human myosin-IXb, an unconventional myosisn with a chimerin-like rho/rac (^TPase-activating protien domain in its tail." Joumal of Cell Science 109: 653-661.
Wu, J., S. Katzav and A. Weiss (1995). "A functional T-cell receptor signaling pathway is required for p95vav activity." Molecular and Cellular Biology 15(8): 4337-4346. 167
Xu, G., G. Janseo, D. Thomas, C. Hollenberg and M. Ramezani Rad (1996). "SteSOp sustains mating pheromone-induced signal transduction in the yeast Saccharomyces cerevisiaer Molecular Microbiolooy 20: 773-783.
Yagisawa, H. (1994). "Expression and characterization of an inositol 1,4,5- trisphosphate binding domain of phosphatidylinositol-specific phospholibase C- gammal.'' Journal of Biological Chemistry 269: 20179-20188.
Yamochi, W., K. Tanaka, H. Nonaka, A. Maeda, T. Musha and Y. Takai (1994). "Growth Site Localizaiton of Rho I Small GTP-binding Protein and Its Involvement in Bud Formation in Saccharomvces cerevisiae" The Journal of Cell Biolooy 125(5): 1077-1093.
Yao, L., Y. Kawakami and T. Kawakami (1994). "The pleckstrin homology domain of Brutons tyrosine kinase interacts with protein kinase C." Proceedings of the National Academy of Science. USA 9 I: 9175-9179.
Ye. Z. S. and D. Baltimore (1994). "Binding of Vav to Grb2 through dimerization of Src homology 3 domains." Proc. Natl. Acad. Sci. USA 91: 12629-12633.
Yisraeli. J.. S. Sokol and D. Melton (1990). "A two-step model for the localization of maternal mRNA in Xenopus oocytes: involvement of microtubules and microfilaments in the translocation and anchoring of Vgl mRNA." Development 108: 289-298.
Yoon, H. S., P. J. Hajduck. A. M. Petros. E. T. Olejnicjak, R. P. Meadows and S. W. Fesik (1994). "Solution structure of a pleckstrin-homology domain." Nature 3 69( June 23): 672-675.
Young, P. E., T. C. Pesacreta and D. FGehart (1991). "Dynamic changes in the distribution of cytoplasmic myosin during Drosophila embryogenesis." Development 111: 1-14.
Young, P. E., A. M. Richman, A. S. Ketchum and D. P. Kiehart (1993). "Morphogenesis in Drosophila requires nonmuscle myosin heavy chain function." Genes and Development 7: 29-41.
Zeller, R., L. Jackson-Grusby and P. Leder (1989). "The limb deformity gene is required for apical ectodermal ridge differentiation and anteropostrior limb pattern formation." Genes and Development 3: 1481-1492.
Zerial and Stemmark (1993). "Rab GTPases in vesicular transport." Current Opinion in Cell Biology S: 613-620.
Zhang, C., M. Schmidt, C. Von Eichel-Streiber and K. Jakobs (1996). "Inhibition by toxin B of inositol phosphate formation induced by G protein-coupled and tyrosine kinase receptors in N IE-115 neuroblastoma cells: involvement of Rho proteins." Molecular I^armacologv 5 9: 864-869. 168
Zheng, J., S. M. Cahill, M. A. Lemmon, D. Fushman, J. Schlessinger and D. Cowburn (1996). "Identification of the binding site for ascidic phospholipids on the PH domain of dynamin: Implications for stimiulation of GTPase activity." Journal of Molecular Biology 2SS: 14-21.
Zheng, Y., R. Cerione and A. Bender (1994). "Control of the yeast bud-site assembly GTPase Cdc42. Catalysis of guanine nucleotide exchange by Cdc24 and stimulation of GTPase activity by Bem3." Toumal nf Biological Chemistry 269(4): 2369-2372.
Zheng, Y., D. Zangrilli, R. Cerione and A. Eva (1996). "The Pleckstrin Homology domain mediates traiisformation by oncogenic Dbl through specific intracellular targeting." The Journal of Biological Chemistry 271(32): 19017-19020.
Zigmond, S. H. (1996). "Signal transduction and actin filament organization." Current Opinion in Cell Biology 8: 66-73.