DOCSLIB.ORG

Structure of Centromere Chromatin: from Nucleosome to Chromosomal Architecture

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structure of Centromere Chromatin: from Nucleosome to Chromosomal Architecture Chromosoma DOI 10.1007/s00412-016-0620-7 REVIEW Structure of centromere chromatin: from nucleosome to chromosomal architecture Thomas Schalch1 & Florian A. Steiner1 Received: 5 August 2016 /Revised: 9 November 2016 /Accepted: 10 November 2016 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract The centromere is essential for the segregation of Introduction chromosomes, as it serves as attachment site for microtubules to mediate chromosome segregationduringmitosisandmeiosis. The centromere is a conserved and essential feature of eukaryotic In most organisms, the centromere is restricted to one chromo- chromosomes that enables the equal segregation of genetic ma- somal region that appears as primary constriction on the con- terial into daughter cells during cell division. The centromere densed chromosome and is partitioned into two chromatin do- generally appears as primary constriction of mitotic chromo- mains: The centromere core is characterized by the centromere- somes, first described by Walther Flemming in 1882 specific histone H3 variant CENP-A (also called cenH3) and is (Flemming 1882). It was apparent early on that chromosomes required for specifying the centromere and for building the kinet- are segregated by attachment of microtubules to the primary ochore complex during mitosis. This core region is generally constriction. The kinetochore—the proteinaceous structure that flanked by pericentric heterochromatin, characterized by nucleo- links the chromosomes to the microtubules for the segregation of somes containing H3 methylated on lysine 9 (H3K9me) that are chromosomes—was described in the 1960s (Luykx 1965; bound by heterochromatin proteins. During mitosis, these two Brinkley and Stubblefield 1966; Jokelainen 1967)andhassince domains together form a three-dimensional structure that exposes been studied in great detail. The structure and organization of the CENP-A-containing chromatin to the surface for interaction with chromatin forming the centromere, however, have remained the kinetochore and microtubules. At the same time, this structure more obscure. One key feature of centromeric chromatin is the supports the tension generated during the segregation of sister incorporation of the histone H3 variant centromere protein A chromatids to opposite poles. In this review, we discuss recent (CENP-A), also called cenH3 (Earnshaw and Rothfield 1985; insight into the characteristics of the centromere, from the spe- Palmer et al. 1987; Talbert et al. 2012; Earnshaw et al. 2013; cialized chromatin structures at the centromere core and the Talbert and Henikoff 2013). CENP-A is an almost universally pericentromere to the three-dimensional organization of these conserved centromeric protein that plays a key role in specifying regions that make up the functional centromere. the centromere, where it replaces H3 in centromeric nucleosomes and is necessary for centromere function (McKinley and Cheeseman 2016). As is the case for CENP-A, many protein Keywords Centromere . CENP-A . Pericentromere . components of centromeric chromatin are conserved, but the Cohesin . Chromatin organization of CENP-A nucleosomes and the DNA sequences on which the centromere is established vary widely between taxa (Steiner and Henikoff 2015). DNA at the centromere is often * Thomas Schalch characterized by tandemly repeated sequence. Tandem repeat [email protected] monomer lengths vary between species but in many cases rough- * Florian A. Steiner ly correspond to nucleosomal units (Melters et al. 2013). These [email protected] repeats, however, are not required for centromere function, as neocentromeres can form in virtually any sequence context 1 Department of Molecular Biology, Sciences III, Institute of Genetics and Genomics of Geneva (iGE3), University of Geneva, (Scott and Sullivan 2014). Despite the divergence in DNA se- Geneva, Switzerland quence and CENP-A organization, centromeric chromatin can in Chromosoma most organisms be separated into two regions: the cen- of a human CENP-A-containing octamer with that of the H3- tromere core, marked by CENP-A nucleosomes, and a containing octamer revealed two major differences in the his- pericentromeric region, usually associated with heterochromatin. tone fold domain: CENP-A loop 1 protrudes from the CENP- Functional studies have shown that disruption of the specialized A nucleosome and exposes two extra amino acid residues chromatin in both regions leads to defects in chromosome seg- (Arg 80 and Gly 81), and the αN helix of CENP-A is about regation, but the mechanistic details of the interplay between the one turn shorter than in H3, which affects how DNA is two regions are not well understood. Here, we summarize recent wrapped around the CENP-A-containing nucleosome progress in understanding how the centromere core and the (Tachiwana et al. 2011;Roullandetal.2016). These findings pericentric region work together in establishing a three- are in line with experiments using chimeras of H3 and CENP- dimensional structure that enables attachment to microtubules A that identified a region covering loop 1 and α2 helix, termed via kinetochore complex and that supports the tension generated CENP-A targeting domain (CATD), as the main CENP-A during the segregation of chromosomes. domain to drive centromere localization and function (Black et al. 2004; Black et al. 2007). A series of recent papers have Characterization of the centromere core refined our understanding of how the CATD and additional residues of CENP-A interact with other centromeric proteins Centromere cores are defined by the presence of CENP-A. to mediate centromere establishment and function (Fig. 1a). The number of CENP-A nucleosomes varies between species Human CENP-A interacts with its histone chaperone from a single one that occupies ∼120 bp sequence in HJURP via CATD, and this interaction is essential for Saccharomyces cerevisiae to several hundred that are embed- targeting CENP-A to the centromere (Foltz et al. 2009; ded in megabases of satellite DNA in humans (Pluta et al. Fachinetti et al. 2015). Crystal structures of human and 1995; Furuyama and Biggins 2007;Aldrup-Macdonaldand S. cerevisiae HJURP/CENP-A/H4 heterotrimers revealed that Sullivan 2014; Bodor et al. 2014). Together with additional the CATD interacts with the N-terminal part of HJURP, while centromeric chromatin components, CENP-A nucleosomes the C-terminal domain of HJURP caps the DNA-binding re- create a permissive environment for centromere establishment gion of the CENP-A/H4 heterodimer, preventing formation of and maintenance and are involved in the formation of three- a (CENP-A/H4)2 tetramer and premature association with dimensional structures that link to kinetochores and serve as DNA (Zhou et al. 2011;Huetal.2011; Cho and Harrison capture devices for the mitotic microtubules. Recent research 2011)(Fig.1b). Six surface-exposed human CENP-A CATD has advanced our understanding of how CENP-A nucleo- residues (four in S. cerevisiae CENP-A) are the main drivers somes are able to define the centromere core and revealed of interaction, while binding of HJURP at the α1 helix re- new features of the centromere core chromatin that are essen- stricts the conformational flexibility of the CENP-A/H4 dimer tial for centromere function. (Zhou et al. 2011; Bassett et al. 2012;Zhaoetal.2016). In addition to the CATD, interaction with HJURP also involves CENP-A residues that specify the centromere serine 68 in the α1helix(Huetal.2011; Logsdon et al. 2015), which needs to be dephosphorylated for stable interaction (Yu CENP-A is conserved among virtually all eukaryotic lineages et al. 2015). These findings explain how CENP-A is discrim- and specifically marks the centromere. However, in contrast to inated from H3 for targeted incorporation at the centromere. other histone variants, there is little or no amino acid sequence Since interaction of HJURP with CENP-A is incompatible conservation outside the C-terminal histone fold domain, and the with DNA binding, HJURP has to dissociate from the N-terminal tails vary widely both in size and sequence (Malik CENP-A/H4 dimer for incorporation into the nucleosome, and Henikoff 2003). Despite this divergence, S. cerevisiae thereby making the CATD available for interaction with other CENP-A can complement human CENP-A, and distant plant factors (Fig. 1c). In most organisms, CENP-A serves as an CENP-As can complement Arabidopsis thaliana CENP-A, indi- epigenetic mark for the inheritance of centromeres during mi- cating that the functional features remain conserved (Wieland tosis and meiosis, and new CENP-A nucleosomes are recruit- et al. 2004;Ravietal.2010; Maheshwari et al. 2015). ed to sites of pre-existing CENP-A. For recent reviews on the The in vivo structure and composition of CENP-A nucle- regulation of CENP-A loading, refer to Nechemia-Arbely osomes remain a controversial area of research that has been et al. (2012), Stellfox et al. (2013), Müller and Almouzni extensively covered in other reviews, e.g., Quénet and Dalal (2014), McKinley and Cheeseman (2016), Chen and (2012), Henikoff and Furuyama (2012), Kurumizaka et al. Mellone (2016), and Nagpal and Fukagawa (2016). (2013), Padeganeh et al. (2013), Fukagawa and Earnshaw CENP-A specifies chromatin at the centromere core, but (2014), and Steiner and Henikoff (2015). In vitro, human centromere function also requires a set of proteins that form CENP-A is incorporated into an octameric nucleosome that the constitutive centromere-associated
Load more

Recommended publications
  • CENPT (NM 025082) Human 3' UTR Clone – SC200995 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC200995 CENPT (NM_025082) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: CENPT (NM_025082) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: CENPT Synonyms: C16orf56; CENP-T; SSMGA ACCN: NM_025082 Insert Size: 140 bp Insert Sequence: >SC200995 3’UTR clone of NM_025082 The sequence shown below is from the reference sequence of NM_025082. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC AGTGGCAACTCTGTCTTCCCTGCCCAGTAGTGGCCAGGCTTCAACACTTTCCCTGTCCCCACCTGGGGA CTCTTGCCCCCACATATTTCTCCAGGTCTCCTCCCCACCCCCCCAGCATCAATAAAGTGTCATAAACAG AA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_025082.4 Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008] Locus ID: 80152 This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • Gene Knockdown of CENPA Reduces Sphere Forming Ability and Stemness of Glioblastoma Initiating Cells
    Neuroepigenetics 7 (2016) 6–18 Contents lists available at ScienceDirect Neuroepigenetics journal homepage: www.elsevier.com/locate/nepig Gene knockdown of CENPA reduces sphere forming ability and stemness of glioblastoma initiating cells Jinan Behnan a,1, Zanina Grieg b,c,1, Mrinal Joel b,c, Ingunn Ramsness c, Biljana Stangeland a,b,⁎ a Department of Molecular Medicine, Institute of Basic Medical Sciences, The Medical Faculty, University of Oslo, Oslo, Norway b Norwegian Center for Stem Cell Research, Department of Immunology and Transfusion Medicine, Oslo University Hospital, Oslo, Norway c Vilhelm Magnus Laboratory for Neurosurgical Research, Institute for Surgical Research and Department of Neurosurgery, Oslo University Hospital, Oslo, Norway article info abstract Article history: CENPA is a centromere-associated variant of histone H3 implicated in numerous malignancies. However, the Received 20 May 2016 role of this protein in glioblastoma (GBM) has not been demonstrated. GBM is one of the most aggressive Received in revised form 23 July 2016 human cancers. GBM initiating cells (GICs), contained within these tumors are deemed to convey Accepted 2 August 2016 characteristics such as invasiveness and resistance to therapy. Therefore, there is a strong rationale for targeting these cells. We investigated the expression of CENPA and other centromeric proteins (CENPs) in Keywords: fi CENPA GICs, GBM and variety of other cell types and tissues. Bioinformatics analysis identi ed the gene signature: fi Centromeric proteins high_CENP(AEFNM)/low_CENP(BCTQ) whose expression correlated with signi cantly worse GBM patient Glioblastoma survival. GBM Knockdown of CENPA reduced sphere forming ability, proliferation and cell viability of GICs. We also Brain tumor detected significant reduction in the expression of stemness marker SOX2 and the proliferation marker Glioblastoma initiating cells and therapeutic Ki67.
    [Show full text]
  • Greg's Awesome Thesis
    Analysis of alignment error and sitewise constraint in mammalian comparative genomics Gregory Jordan European Bioinformatics Institute University of Cambridge A dissertation submitted for the degree of Doctor of Philosophy November 30, 2011 To my parents, who kept us thinking and playing This dissertation is the result of my own work and includes nothing which is the out- come of work done in collaboration except where specifically indicated in the text and acknowledgements. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. November 30, 2011 Gregory Jordan ii Analysis of alignment error and sitewise constraint in mammalian comparative genomics Summary Gregory Jordan November 30, 2011 Darwin College Insight into the evolution of protein-coding genes can be gained from the use of phylogenetic codon models. Recently sequenced mammalian genomes and powerful analysis methods developed over the past decade provide the potential to globally measure the impact of natural selection on pro- tein sequences at a fine scale. The detection of positive selection in particular is of great interest, with relevance to the study of host-parasite conflicts, immune system evolution and adaptive dif- ferences between species. This thesis examines the performance of methods for detecting positive selection first with a series of simulation experiments, and then with two empirical studies in mammals and primates.
    [Show full text]
  • How Does SUMO Participate in Spindle Organization?
    cells Review How Does SUMO Participate in Spindle Organization? Ariane Abrieu * and Dimitris Liakopoulos * CRBM, CNRS UMR5237, Université de Montpellier, 1919 route de Mende, 34090 Montpellier, France * Correspondence: [email protected] (A.A.); [email protected] (D.L.) Received: 5 July 2019; Accepted: 30 July 2019; Published: 31 July 2019 Abstract: The ubiquitin-like protein SUMO is a regulator involved in most cellular mechanisms. Recent studies have discovered new modes of function for this protein. Of particular interest is the ability of SUMO to organize proteins in larger assemblies, as well as the role of SUMO-dependent ubiquitylation in their disassembly. These mechanisms have been largely described in the context of DNA repair, transcriptional regulation, or signaling, while much less is known on how SUMO facilitates organization of microtubule-dependent processes during mitosis. Remarkably however, SUMO has been known for a long time to modify kinetochore proteins, while more recently, extensive proteomic screens have identified a large number of microtubule- and spindle-associated proteins that are SUMOylated. The aim of this review is to focus on the possible role of SUMOylation in organization of the spindle and kinetochore complexes. We summarize mitotic and microtubule/spindle-associated proteins that have been identified as SUMO conjugates and present examples regarding their regulation by SUMO. Moreover, we discuss the possible contribution of SUMOylation in organization of larger protein assemblies on the spindle, as well as the role of SUMO-targeted ubiquitylation in control of kinetochore assembly and function. Finally, we propose future directions regarding the study of SUMOylation in regulation of spindle organization and examine the potential of SUMO and SUMO-mediated degradation as target for antimitotic-based therapies.
    [Show full text]
  • Regional Centromeres of Fission Yeast
    HIGHLIGHTED ARTICLE GENETICS | INVESTIGATION Inner Kinetochore Protein Interactions with Regional Centromeres of Fission Yeast Jitendra Thakur, Paul B. Talbert, and Steven Henikoff1 Howard Hughes Medical Institute and Basic Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109 ABSTRACT Centromeres of the fission yeast Schizosaccharomyces pombe lack the highly repetitive sequences that make most other "regional" centromeres refractory to analysis. To map fission yeast centromeres, we applied H4S47C-anchored cleavage mapping and native and cross-linked chromatin immunoprecipitation with paired-end sequencing. H3 nucleosomes are nearly absent from the central domain, which is occupied by centromere-specific H3 (cenH3 or CENP-A) nucleosomes with two H4s per particle that are mostly unpositioned and are more widely spaced than nucleosomes elsewhere. Inner kinetochore proteins CENP-A, CENP-C, CENP-T, CENP-I, and Scm3 are highly enriched throughout the central domain except at tRNA genes, with no evidence for preferred kinetochore assembly sites. These proteins are weakly enriched and less stably incorporated in H3-rich heterochromatin. CENP-A nucleosomes protect less DNA from nuclease digestion than H3 nucleosomes, while CENP-T protects a range of fragment sizes. Our results suggest that CENP-T particles occupy linkers between CENP-A nucleosomes and that classical regional centromeres differ from other centro- meres by the absence of CENP-A nucleosome positioning. KEYWORDS Schizosaccharomyces pombe; CENP-A; CENP-C; CENP-T; CENP-I ENTROMERES are specialized sites on eukaryotic chro- repeats (Chikashige et al. 1989). The cnt + imrs form a central Cmosomes that are responsible for chromosome segrega- domain in each centromere that assembles kinetochore pro- tion during mitosis and meiosis.
    [Show full text]
  • Of 33 Microtubule Attachment and Centromeric Tension Shape
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.11.944694; this version posted February 12, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Microtubule attachment and centromeric tension shape the protein architecture of the human kinetochore Alexander A. Kukreja,1 Sisira Kavuri,2 Ajit. P Joglekar1,2* 1Department of Biophysics, University of Michigan, Ann Arbor, MI 48108, USA 2Department of Cellular & Developmental Biology, University of Michigan, Ann Arbor, MI 48108, USA *Correspondence: [email protected] Summary The nanoscale protein architecture of the kinetochore, a complex protein machine, plays an integral role in the molecular mechanisms underlying its functions in chromosome segregation. However, defining this architecture in human cells remains challenging because of the large size and compositional complexity of the kinetochore. Here, we use Förster Resonance Energy Transfer to reveal the architecture of individual kinetochore-microtubule attachments in human cells. We find that the microtubule-binding domains of the Ndc80 complex cluster at the microtubule plus-end. This clustering occurs only after microtubule attachment, and it increases proportionally with centromeric tension. Surprisingly, this clustering is independent of the organization and number of centromeric receptors for Ndc80. Moreover, Ndc80 clustering is similar in yeast and human kinetochores despite significant differences in their centromeric organizations. These and other data suggest that the microtubule-binding interface of the human kinetochore behaves like a flexible “lawn” despite being nucleated by repeating biochemical subunits.
    [Show full text]
  • Oxidized Phospholipids Regulate Amino Acid Metabolism Through MTHFD2 to Facilitate Nucleotide Release in Endothelial Cells
    ARTICLE DOI: 10.1038/s41467-018-04602-0 OPEN Oxidized phospholipids regulate amino acid metabolism through MTHFD2 to facilitate nucleotide release in endothelial cells Juliane Hitzel1,2, Eunjee Lee3,4, Yi Zhang 3,5,Sofia Iris Bibli2,6, Xiaogang Li7, Sven Zukunft 2,6, Beatrice Pflüger1,2, Jiong Hu2,6, Christoph Schürmann1,2, Andrea Estefania Vasconez1,2, James A. Oo1,2, Adelheid Kratzer8,9, Sandeep Kumar 10, Flávia Rezende1,2, Ivana Josipovic1,2, Dominique Thomas11, Hector Giral8,9, Yannick Schreiber12, Gerd Geisslinger11,12, Christian Fork1,2, Xia Yang13, Fragiska Sigala14, Casey E. Romanoski15, Jens Kroll7, Hanjoong Jo 10, Ulf Landmesser8,9,16, Aldons J. Lusis17, 1234567890():,; Dmitry Namgaladze18, Ingrid Fleming2,6, Matthias S. Leisegang1,2, Jun Zhu 3,4 & Ralf P. Brandes1,2 Oxidized phospholipids (oxPAPC) induce endothelial dysfunction and atherosclerosis. Here we show that oxPAPC induce a gene network regulating serine-glycine metabolism with the mitochondrial methylenetetrahydrofolate dehydrogenase/cyclohydrolase (MTHFD2) as a cau- sal regulator using integrative network modeling and Bayesian network analysis in human aortic endothelial cells. The cluster is activated in human plaque material and by atherogenic lipo- proteins isolated from plasma of patients with coronary artery disease (CAD). Single nucleotide polymorphisms (SNPs) within the MTHFD2-controlled cluster associate with CAD. The MTHFD2-controlled cluster redirects metabolism to glycine synthesis to replenish purine nucleotides. Since endothelial cells secrete purines in response to oxPAPC, the MTHFD2- controlled response maintains endothelial ATP. Accordingly, MTHFD2-dependent glycine synthesis is a prerequisite for angiogenesis. Thus, we propose that endothelial cells undergo MTHFD2-mediated reprogramming toward serine-glycine and mitochondrial one-carbon metabolism to compensate for the loss of ATP in response to oxPAPC during atherosclerosis.
    [Show full text]
  • Mechanism of Ant1-Induced Human Diseases and Stress Signaling
    MECHANISM OF ANT1-INDUCED HUMAN DISEASES AND STRESS SIGNALING Item Type Dissertation Authors Liu, Yaxin Rights Attribution-NonCommercial-NoDerivatives 4.0 International Download date 09/10/2021 19:50:21 Item License http://creativecommons.org/licenses/by-nc-nd/4.0/ Link to Item http://hdl.handle.net/20.500.12648/1772 MECHANISM OF ANT1-INDUCED HUMAN DISEASES AND STRESS SIGNALING Yaxin Liu A Dissertation in Department of Biochemistry and Molecular Biology Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Graduate Studies of State University of New York, Upstate Medical University. Approved Date Abstract Mechanism of Ant1-induced Human Diseases and Stress Signaling Yaxin Liu Xin Jie Chen Adenine nucleotide translocase (Ant) is a mitochondrial inner membrane protein, the primary function of which is to mediate the ADP/ATP exchange across the inner membrane. Missense mutations in Ant1, the skeletal muscle- and heart-specific isoform, induce human disorders including autosomal dominant Progressive External Opthalmoplegia (adPEO), cardiomyopathy and myopathy. Several models were proposed to interpret the pathogenesis of mutant Ant1-induced diseases, but no consensus has been reached. Our lab has previously found that mutant Aac2, the homolog of Ant1 in yeast, causes cell death due to the mitochondrial biogenesis defect. In the present study, we provided biochemical evidence supporting the idea that the mutant Aac2 proteins are misfolded, which derails the proteostasis on the inner membrane. We found that the assembly and stability of multiple protein complexes on the inner membrane are affected, including those involved in mitochondrial respiration and protein transport.
    [Show full text]
  • Complete Genomic and Epigenetic Maps of Human Centromeres
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.12.452052; this version posted July 19, 2021. The copyright holder has placed this preprint (which was not certified by peer review) in the Public Domain. It is no longer restricted by copyright. Anyone can legally share, reuse, remix, or adapt this material for any purpose without crediting the original authors. Complete genomic and epigenetic maps of human centromeres Nicolas Altemose1, Glennis A. Logsdon2*, Andrey V. Bzikadze3*, Pragya Sidhwani4*, Sasha A. Langley1*, Gina V. Caldas1*, Savannah J. Hoyt5,6, Lev Uralsky7,8, Fedor D. Ryabov9, Colin J. Shew10, Michael E.G. Sauria11, Matthew Borchers12, Ariel Gershman13, Alla Mikheenko14, Valery A. Shepelev8, Tatiana Dvorkina14, Olga Kunyavskaya14, Mitchell R. Vollger2, Arang Rhie15, Ann M. McCartney15, Mobin Asri16, Ryan Lorig-Roach16, Kishwar Shafin16, Sergey Aganezov17, Daniel Olson18, Leonardo Gomes de Lima12, Tamara Potapova12, Gabrielle A. Hartley5,6, Marina Haukness16, Peter Kerpedjiev19, Fedor Gusev8, Kristof Tigyi16,20, Shelise Brooks21, Alice Young21, Sergey Nurk15, Sergey Koren15 , Sofie R. Salama16,20, Benedict Paten16,34, Evgeny I. Rogaev7,8,22,23, Aaron Streets24,25, Gary H. Karpen1,26, Abby F. Dernburg1,27,20, Beth A. Sullivan28, Aaron F. Straight4, Travis J. Wheeler18, Jennifer L. Gerton12, Evan E. Eichler2,20, Adam M. Phillippy15, Winston Timp13,29, Megan Y. Dennis10, Rachel J. O'Neill5,6, Justin M. Zook30, Michael C. Schatz17, Pavel A. Pevzner31, Mark Diekhans16, Charles H. Langley32, Ivan A. AleXandrov8,14,33†, Karen H. Miga16,34† 1-34 Affiliations are listed at the end (page 22) † Corresponding authors: Ivan A. Alexandrov, [email protected] ; Karen H. Miga, [email protected] * Co-second authors contributed equally.
    [Show full text]
  • A Microrna Program Regulates the Balance Between Cardiomyocyte Hyperplasia and Hypertrophy and Stimulates Cardiac Regeneration
    ARTICLE https://doi.org/10.1038/s41467-021-25211-4 OPEN A microRNA program regulates the balance between cardiomyocyte hyperplasia and hypertrophy and stimulates cardiac regeneration Andrea Raso1,12, Ellen Dirkx1,12, Vasco Sampaio-Pinto1,2, Hamid el Azzouzi1,3, Ryan J. Cubero 4,5, Daniel W. Sorensen6, Lara Ottaviani1, Servé Olieslagers1, Manon M. Huibers 7, Roel de Weger7, Sailay Siddiqi8, Silvia Moimas 9, Consuelo Torrini9, Lorena Zentillin9, Luca Braga9, Diana S. Nascimento 2, Paula A. da Costa Martins 1,10, Jop H. van Berlo 6, Serena Zacchigna 8, Mauro Giacca 9,11 & ✉ Leon J. De Windt 1 1234567890():,; Myocardial regeneration is restricted to early postnatal life, when mammalian cardiomyo- cytes still retain the ability to proliferate. The molecular cues that induce cell cycle arrest of neonatal cardiomyocytes towards terminally differentiated adult heart muscle cells remain obscure. Here we report that the miR-106b~25 cluster is higher expressed in the early postnatal myocardium and decreases in expression towards adulthood, especially under conditions of overload, and orchestrates the transition of cardiomyocyte hyperplasia towards cell cycle arrest and hypertrophy by virtue of its targetome. In line, gene delivery of miR- 106b~25 to the mouse heart provokes cardiomyocyte proliferation by targeting a network of negative cell cycle regulators including E2f5, Cdkn1c, Ccne1 and Wee1. Conversely, gene- targeted miR-106b~25 null mice display spontaneous hypertrophic remodeling and exag- gerated remodeling to overload by derepression of the prohypertrophic transcription factors Hand2 and Mef2d. Taking advantage of the regulatory function of miR-106b~25 on cardio- myocyte hyperplasia and hypertrophy, viral gene delivery of miR-106b~25 provokes nearly complete regeneration of the adult myocardium after ischemic injury.
    [Show full text]
  • Supplemental Information Supplemental Fig. S1. CENPT Is
    Supplemental information Supplemental Fig. S1. CENPT is not recovered under native conditions. N- ChIP-seq merged pairs for CENPA, CENPT, H3 and Input (top, from GEO GSE60951 (Henikoff et al. 2015) and paired-end reads for 3 biological replicates of CENPT (bottom) were mapped to the indicated 340-bp α-satellite dimers. Each column of four profiles is scaled to the maximum peak. The relative scale is the area of the CENPA, CENPC or H3 profile (top) or the CENPT1, CENPT2 or CENPT3 profile (bottom) divided by the area of the D5Z1 profile, where the numbers reflect the product of the total sequence abundance times the enrichment. Supplemental Fig. S2. CENPA, CENP- C and CENPT are cross-linked to same α-satellites. The X-ChIP profiles of CENPT with two different antibodies (Abcam and Bethyl) on centromeric α-satellites are highly similar to each other and to those of CENPA and CENPC. Supplemental Fig. S3. Fragment ends from X-ChIP (top four panels) and native bottom panel) datasets were mapped to the Cen1-like consensus and DXZ1 sequences. The CENPB box region is indicated by the magenta box. Supplemental Fig. S4. Fragment length distribution of Sequential ChIP datasets on Cen1-like α-satellites. A 100 100 90 90 80 80 70 70 60 Chr1_7340 60 Chr1_11321 50 Chr1_17109 50 40 ChrX_7340 40 ChrX_10470 30 ChrX_17119 30 20 ChrX_11321 20 10 10 0 % of total centromere α-satellite 0 100 95 90 85 80 75 70 65 60 % iden6ty threshold B DNA sequence divergence CENPA nucleosomes H3 nucleosomes CENPA occupancy CENPA Domain CENPA domains H3 OR H3 CENPA CENPA Supplemental Fig.
    [Show full text]
  • Genome-Scale Detection of Positive Selection in 9 Primates Predicts Human-Virus Evolutionary Conflicts
    bioRxiv preprint doi: https://doi.org/10.1101/131680; this version posted April 27, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Genome-scale detection of positive selection in 9 primates predicts human-virus evolutionary conflicts Robin van der Lee1,*,^, Laurens Wiel1,2, Teunis J.P. van Dam1,#, Martijn A. Huynen1 1Centre for Molecular and Biomolecular Informatics, 2Department of Human Genetics, Radboud Institute for Molecular Life Sciences, Radboud university medical center, Nijmegen, The Netherlands *Correspondence: [email protected] ^Current address: Centre for Molecular Medicine and Therapeutics, Department of Medical Genetics, BC Children’s Hospital Research Institute, University of British Columbia, Vancouver, Canada #Current address: Theoretical Biology and Bioinformatics, Department of Biology, Faculty of Science, Utrecht University, The Netherlands bioRxiv preprint doi: https://doi.org/10.1101/131680; this version posted April 27, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract Hotspots of rapid genome evolution hold clues about human adaptation. Here, we present a comparative analysis of nine whole-genome sequenced primates to identify high-confidence targets of positive selection. We find strong statistical evidence for positive selection acting on 331 protein-coding genes (3%), pinpointing 934 adaptively evolving codons (0.014%).
    [Show full text]