DOCSLIB.ORG

How Does SUMO Participate in Spindle Organization?

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
How Does SUMO Participate in Spindle Organization? cells Review How Does SUMO Participate in Spindle Organization? Ariane Abrieu * and Dimitris Liakopoulos * CRBM, CNRS UMR5237, Université de Montpellier, 1919 route de Mende, 34090 Montpellier, France * Correspondence: [email protected] (A.A.); [email protected] (D.L.) Received: 5 July 2019; Accepted: 30 July 2019; Published: 31 July 2019 Abstract: The ubiquitin-like protein SUMO is a regulator involved in most cellular mechanisms. Recent studies have discovered new modes of function for this protein. Of particular interest is the ability of SUMO to organize proteins in larger assemblies, as well as the role of SUMO-dependent ubiquitylation in their disassembly. These mechanisms have been largely described in the context of DNA repair, transcriptional regulation, or signaling, while much less is known on how SUMO facilitates organization of microtubule-dependent processes during mitosis. Remarkably however, SUMO has been known for a long time to modify kinetochore proteins, while more recently, extensive proteomic screens have identified a large number of microtubule- and spindle-associated proteins that are SUMOylated. The aim of this review is to focus on the possible role of SUMOylation in organization of the spindle and kinetochore complexes. We summarize mitotic and microtubule/spindle-associated proteins that have been identified as SUMO conjugates and present examples regarding their regulation by SUMO. Moreover, we discuss the possible contribution of SUMOylation in organization of larger protein assemblies on the spindle, as well as the role of SUMO-targeted ubiquitylation in control of kinetochore assembly and function. Finally, we propose future directions regarding the study of SUMOylation in regulation of spindle organization and examine the potential of SUMO and SUMO-mediated degradation as target for antimitotic-based therapies. Keywords: mitosis; spindle; microtubule-associated proteins; SUMO; SUMO-targeted ubiquitin ligases 1. The Biological Context During mitosis, the microtubule (MT) cytoskeleton reorganizes to assemble the mitotic spindle that will capture chromosomes via their kinetochores and segregate them equally into two daughter cells. Compared to interphase, mitotic microtubules are shorter and more dynamic; they are nucleated from γ-tubulin complexes either at centrosomes or along pre-existing MTs [1]. Away from centrosomes, MT nucleation requires Ran-dependent liberation of spindle assembly factors such as TPX2, HURP, or NuSAP, together with augmin complexes that are assembled along preexisting microtubules [1–5]. At kinetochores, microtubules interact with several microtubule-associated proteins (MAPs, including microtubule-dependent motors), and appear as cold-resistant MT bundles called kinetochore-fibers (k-fibers) [6]. The latter are also stabilized along their length by microtubule connectors containing the scaffold protein clathrin, or the MAPs TACC3 and XMAP215 [7]. Interaction between kinetochores and microtubules is highly dynamic in order to correct erroneous attachment, and ensure chromosome bi-orientation before sister chromatids separate toward the two spindle poles [8]. This is achieved by a rapid turnover of phosphorylation/dephosphorylation events that are mainly catalyzed by Aurora-B kinase and the counteracting phosphatases [9]. Once chromosomes are separated, the spindle midzone is further bundled by MAPs, that crosslink microtubules thus becoming less dynamic [10]. Control of MT dynamics and spindle organization during mitosis has long been known to be downstream of the kinase CDK1-Cyclin B that generates a phosphorylation cascade regulating Cells 2019, 8, 801; doi:10.3390/cells8080801 www.mdpi.com/journal/cells Cells 2019, 8, x FOR PEER REVIEW 2 of 18 Cells 2019, 8, 801 2 of 20 counteracting phosphatases [9]. Once chromosomes are separated, the spindle midzone is further bundled by MAPs, that crosslink microtubules thus becoming less dynamic [10]. the MAPsControl at play of duringMT dynamics mitosis and [11 spindle]. This organization cascade culminates during mitosis in metaphasehas long been and known ends to with be the ubiquitin-dependentdownstream of the degradation kinase CDK1-Cyclin of cyclin B Bthat and generates securin, a aphosphorylation sister chromatid cascade cohesion regulating inhibitor the [12]. MAPs at play during mitosis [11]. This cascade culminates in metaphase and ends with the While these two types of post-translational modifications (phosphorylation and ubiquitylation) have ubiquitin-dependent degradation of cyclin B and securin, a sister chromatid cohesion inhibitor [12]. been extensively studied in this context, much less is known regarding modifications by the SUMO While these two types of post-translational modifications (phosphorylation and ubiquitylation) have proteinbeen (Figure extensively1; for studied a review in seethis [context,13]). This much is indeedless is known surprising, regarding since modifications SUMO has beenby the first SUMO isolated in theprotein context (Figure of spindle-related 1; for a review mechanismssee [13]). This is either indeed in surprising, Ran regulation since SUMO or kinetochore has been first function isolated [14 –17]. In addition,in the context there of is spindle-related accumulating mechanisms evidence that either numerous in Ran regulation mitotic motors,or kinetochore MAPs, function and kinases [14– are SUMOylated.17]. In addition, The there purpose is accumulating of this review evidence is to that summarize numerous information mitotic motors, and MAPs, discuss and thekinases possible molecularare SUMOylated. mechanisms The involving purpose of SUMO this review in mitotic is to summarize spindle organization. information and discuss the possible molecular mechanisms involving SUMO in mitotic spindle organization. FigureFigure 1. The 1. The SUMO SUMO pathway pathway [13 [13,18,19].,18,19]. SimilarSimilar to ubiq ubiquitylation,uitylation, the the SUMO SUMO conjugation conjugation pathway pathway leadsleads to formation to formation of an of isopeptide an isopeptide bond bond between between the the C-terminal C-terminal carboxyl carboxyl of theof the 11kDa 11kDa protein protein SUMO and anSUMO"-lysine and ofan the-lysine target of protein. the target SUMO protein. precursors SUMO pr areecursors first processed are first byprocessed SUMO by isopeptidases, SUMO leavingisopeptidases, a C-terminal leaving di-glycine a C-terminal (GG) motif di-glycine that is(GG) activated motif that in an is ATP-dependentactivated in an ATP-dependent manner, forming a thioestermanner, with forming catalytic a cysteinethioester ofwith the catalytic heterodimeric cysteine E1-activating of the heterodimeric enzyme Uba2E1-activating/Aos1. Next,enzyme SUMO is transferredUba2/Aos1. onto Next, the SUMO catalytic is transferred cysteine ofonto the the E2-conjugating catalytic cysteine enzyme of the (Ubc9)E2-conjugating and finally enzyme onto the target(Ubc9) protein, and eitherfinally directlyonto the ortarget through protein, a SUMOeither directly E3 ligase. or through SUMO a itselfSUMO can E3 alsoligase. serve SUMO as itself target for SUMOylation,can also serve leading as target to for formation SUMOylation, of polySUMO leading to formation chains. SUMOylation of polySUMO chains. is reversed SUMOylation by one is of the reversed by one of the SUMO isopeptidases that processed its precursor in the first step (SENP1-3 SUMO isopeptidases that processed its precursor in the first step (SENP1-3 and SENP5-7 in human and and SENP5-7 in human and Ulp1 and 2 in budding yeast). SENP1, 2, 3, and 5 belong to the Ulp1 Ulp1 and 2 in budding yeast). SENP1, 2, 3, and 5 belong to the Ulp1 branch, whereas SENP6 and 7 are branch, whereas SENP6 and 7 are more closely related to the Smt4/Ulp2 branch [20]. more closely related to the Smt4/Ulp2 branch [20]. Contrary to ubiquitylation, SUMOylation does not always require a E3 ligase, at least in vitro Contrary[21]. Nevertheless, to ubiquitylation, three classes SUMOylation of E3 ligases doesare the not best always characterized require (for a E3 aligase, review, at see least [22];in other vitro [21]. Nevertheless,types of SUMO three classesE3s alsoof exist). E3 ligases The SP-RING are the family best characterized was identified (for with a review,Siz1/Siz2 see in [budding22]; other yeast types of SUMOthat E3s share also aexist). conserved The SP-RINGRING-related family motif was with identified PIAS (protein with Siz1 inhibitor/Siz2 inof budding activated yeast STAT) that [23], share a conservedresponsible RING-related for the interaction motif with of the PIAS SUMO (protein E3 with inhibitor Ubc9 [24]. ofactivated STAT) [23], responsible for the interactionThe of second the SUMO class of E3 SUMO with Ubc9E3s is [the24 ].Ran-binding protein 2 (RanBP2), which is a large (358 kDa) Thecomponent second of class the nuclear of SUMO pore E3s complex is the Ran-binding(NPC). This multidomain protein 2 (RanBP2), E3 ligase whichcontains is atwo large internal (358 kDa) componentrepeats of(IR) the displaying nuclear pore the complexE3 ligase (NPC).domain This IR1- multidomainM-IR2 [25–27]. E3 The ligase IR-domain contains is twoalso internalthe site repeatsof assembly of the RRSU complex that contains the SUMO1-modified form of RanGAP1 (IR) displaying the E3 ligase domain IR1-M-IR2 [25–27]. The IR-domain is also the site of assembly of (RanGAP1•SUMO1) and Ubc9 [28]. This complex is recruited to the outermost part of the the RRSU complex that contains the SUMO1-modified form of RanGAP1 (RanGAP1
Load more

Recommended publications
  • Identification of Hub Genes Involved in the Occurrence and Development of Hepatocellular Carcinoma Via Bioinformatics Analysis
    ONCOLOGY LETTERS 20: 1695-1708, 2020 Identification of hub genes involved in the occurrence and development of hepatocellular carcinoma via bioinformatics analysis NINGNING MI1,2*, JIE CAO1-6*, JINDUO ZHANG2-5, WENKANG FU1-5, CHONGFEI HUANG1-5, LONG GAO1-5, PING YUE2-5, BING BAI2-5, YANYAN LIN1-5, WENBO MENG1-5 and XUN LI4,5,7 1The First Clinical Medical School, Lanzhou University; 2Department of Special Minimally Invasive Surgery, The First Hospital of Lanzhou University; 3Institute of Genetics, School of Basic Medical Sciences, Lanzhou University; 4Gansu Province Institute of Hepatopancreatobiliary; 5Gansu Province Key Laboratory Biotherapy and Regenerative Medicine; 6Laboratory Department; 7The Fifth Department of General Surgery, The First Hospital of Lanzhou University, Lanzhou, Gansu 730000, P.R. China Received September 28, 2019; Accepted May 7, 2020 DOI: 10.3892/ol.2020.11752 Abstract. Hepatocellular carcinoma (HCC) is a heterogeneous cyclin B1 (CCNB1), cell-division cycle protein 20 (CDC20), malignancy, which is a major cause of cancer morbidity and cyclin-dependent kinase 1, BUB1 mitotic checkpoint serine/ mortality worldwide. Thus, the aim of the present study was threonine kinase β (BUB1B), cyclin A2, nucleolar and spindle to identify the hub genes and underlying pathways of HCC associated protein 1, ubiquitin‑conjugating enzyme E2 C via bioinformatics analyses. The present study screened three (UBE2C) and ZW10 interactor. Furthermore, upregulated datasets, including GSE112790, GSE84402 and GSE74656 CCNB1, CDC20, BUB1B and UBE2C expression levels from the Gene Expression Omnibus (GEO) database, and indicated worse disease-free and overall survival. Moreover, downloaded the RNA-sequencing of HCC from The Cancer a meta-analysis of tumor and healthy tissues in the Oncomine Genome Atlas (TCGA) database.
    [Show full text]
  • CENPT (NM 025082) Human 3' UTR Clone – SC200995 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC200995 CENPT (NM_025082) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: CENPT (NM_025082) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: CENPT Synonyms: C16orf56; CENP-T; SSMGA ACCN: NM_025082 Insert Size: 140 bp Insert Sequence: >SC200995 3’UTR clone of NM_025082 The sequence shown below is from the reference sequence of NM_025082. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC AGTGGCAACTCTGTCTTCCCTGCCCAGTAGTGGCCAGGCTTCAACACTTTCCCTGTCCCCACCTGGGGA CTCTTGCCCCCACATATTTCTCCAGGTCTCCTCCCCACCCCCCCAGCATCAATAAAGTGTCATAAACAG AA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_025082.4 Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008] Locus ID: 80152 This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • Phosphorylation and Activation of Cell Division Cycle Associated 8 by Aurora Kinase B Plays a Significant Role in Human Lung Carcinogenesis
    Research Article Phosphorylation and Activation of Cell Division Cycle Associated 8 by Aurora Kinase B Plays a Significant Role in Human Lung Carcinogenesis Satoshi Hayama,1,2 Yataro Daigo,1 Takumi Yamabuki,1 Daizaburo Hirata,1 Tatsuya Kato,1 Masaki Miyamoto,2 Tomoo Ito,3 Eiju Tsuchiya,4 Satoshi Kondo,2 andYusuke Nakamura 1 1Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, Tokyo, Japan; Departments of 2Surgical Oncology and 3Surgical Pathology, Hokkaido University Graduate School of Medicine, Sapporo, Japan; and 4Kanagawa Cancer Center Research Institute, Kanagawa, Japan Abstract inhibitors for EGFR tyrosine kinase (i.e., gefitinib and erlotinib), Through genome-wide gene expression analysis of lung were developed and are applied in clinical practice (5). However, carcinomas, we detected in the great majority of lung cancer each of the new regimens can provide survival benefits to a small samples cotransactivation of cell division cycle associated subset of the patients (6, 7). Hence, new therapeutic strategies, such 8(CDCA8) and aurora kinase B (AURKB), which were as development of more effective molecular targeted agents considered to be components of the vertebrate chromosomal applicable to the great majority of patients with less toxicity, are passenger complex.Immunohistochemical analysis of lung eagerly awaited. cancer tissue microarrays showed that overexpression of Systematic analysis of expression levels of thousands of genes CDCA8 and AURKB was significantly associated with poor using cDNA microarrays is an effective approach for identification prognosis of lung cancer patients.AURKB directly phosphor- of unknown molecules involved in carcinogenic pathways and can ylated CDCA8 at Ser154, Ser219, Ser275, and Thr278 and seemed effectively screen candidate target molecules for development of to stabilize CDCA8 protein in cancer cells.Suppression of novel therapeutics and diagnostics.
    [Show full text]
  • Evolution, Expression and Meiotic Behavior of Genes Involved in Chromosome Segregation of Monotremes
    G C A T T A C G G C A T genes Article Evolution, Expression and Meiotic Behavior of Genes Involved in Chromosome Segregation of Monotremes Filip Pajpach , Linda Shearwin-Whyatt and Frank Grützner * School of Biological Sciences, The University of Adelaide, Adelaide, SA 5005, Australia; fi[email protected] (F.P.); [email protected] (L.S.-W.) * Correspondence: [email protected] Abstract: Chromosome segregation at mitosis and meiosis is a highly dynamic and tightly regulated process that involves a large number of components. Due to the fundamental nature of chromosome segregation, many genes involved in this process are evolutionarily highly conserved, but duplica- tions and functional diversification has occurred in various lineages. In order to better understand the evolution of genes involved in chromosome segregation in mammals, we analyzed some of the key components in the basal mammalian lineage of egg-laying mammals. The chromosome passenger complex is a multiprotein complex central to chromosome segregation during both mitosis and meio- sis. It consists of survivin, borealin, inner centromere protein, and Aurora kinase B or C. We confirm the absence of Aurora kinase C in marsupials and show its absence in both platypus and echidna, which supports the current model of the evolution of Aurora kinases. High expression of AURKBC, an ancestor of AURKB and AURKC present in monotremes, suggests that this gene is performing all necessary meiotic functions in monotremes. Other genes of the chromosome passenger complex complex are present and conserved in monotremes, suggesting that their function has been preserved Citation: Pajpach, F.; in mammals.
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • Nuclear Organization and the Epigenetic Landscape of the Mus Musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected]
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 8-9-2019 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Liu, Alicia, "Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome" (2019). Doctoral Dissertations. 2273. https://opencommons.uconn.edu/dissertations/2273 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia J. Liu, Ph.D. University of Connecticut, 2019 ABSTRACT X-linked imprinted genes have been hypothesized to contribute parent-of-origin influences on social cognition. A cluster of imprinted genes Xlr3b, Xlr4b, and Xlr4c, implicated in cognitive defects, are maternally expressed and paternally silent in the murine brain. These genes defy classic mechanisms of autosomal imprinting, suggesting a novel method of imprinted gene regulation. Using Xlr3b and Xlr4c as bait, this study uses 4C-Seq on neonatal whole brain of a 39,XO mouse model, to provide the first in-depth analysis of chromatin dynamics surrounding an imprinted locus on the X-chromosome. Significant differences in long-range contacts exist be- tween XM and XP monosomic samples. In addition, XM interaction profiles contact a greater number of genes linked to cognitive impairment, abnormality of the nervous system, and abnormality of higher mental function. This is not a pattern that is unique to the imprinted Xlr3/4 locus. Additional Alicia J. Liu - University of Connecticut - 2019 4C-Seq experiments show that other genes on the X-chromosome, implicated in intellectual disability and/or ASD, also produce more maternal contacts to other X-linked genes linked to cognitive impairment.
    [Show full text]
  • Gene Knockdown of CENPA Reduces Sphere Forming Ability and Stemness of Glioblastoma Initiating Cells
    Neuroepigenetics 7 (2016) 6–18 Contents lists available at ScienceDirect Neuroepigenetics journal homepage: www.elsevier.com/locate/nepig Gene knockdown of CENPA reduces sphere forming ability and stemness of glioblastoma initiating cells Jinan Behnan a,1, Zanina Grieg b,c,1, Mrinal Joel b,c, Ingunn Ramsness c, Biljana Stangeland a,b,⁎ a Department of Molecular Medicine, Institute of Basic Medical Sciences, The Medical Faculty, University of Oslo, Oslo, Norway b Norwegian Center for Stem Cell Research, Department of Immunology and Transfusion Medicine, Oslo University Hospital, Oslo, Norway c Vilhelm Magnus Laboratory for Neurosurgical Research, Institute for Surgical Research and Department of Neurosurgery, Oslo University Hospital, Oslo, Norway article info abstract Article history: CENPA is a centromere-associated variant of histone H3 implicated in numerous malignancies. However, the Received 20 May 2016 role of this protein in glioblastoma (GBM) has not been demonstrated. GBM is one of the most aggressive Received in revised form 23 July 2016 human cancers. GBM initiating cells (GICs), contained within these tumors are deemed to convey Accepted 2 August 2016 characteristics such as invasiveness and resistance to therapy. Therefore, there is a strong rationale for targeting these cells. We investigated the expression of CENPA and other centromeric proteins (CENPs) in Keywords: fi CENPA GICs, GBM and variety of other cell types and tissues. Bioinformatics analysis identi ed the gene signature: fi Centromeric proteins high_CENP(AEFNM)/low_CENP(BCTQ) whose expression correlated with signi cantly worse GBM patient Glioblastoma survival. GBM Knockdown of CENPA reduced sphere forming ability, proliferation and cell viability of GICs. We also Brain tumor detected significant reduction in the expression of stemness marker SOX2 and the proliferation marker Glioblastoma initiating cells and therapeutic Ki67.
    [Show full text]
  • Biallelic TRIP13 Mutations Predispose to Wilms Tumor and Chromosome Missegregation
    Europe PMC Funders Group Author Manuscript Nat Genet. Author manuscript; available in PMC 2017 July 01. Published in final edited form as: Nat Genet. 2017 July ; 49(7): 1148–1151. doi:10.1038/ng.3883. Europe PMC Funders Author Manuscripts Biallelic TRIP13 mutations predispose to Wilms tumor and chromosome missegregation Shawn Yost#1, Bas de Wolf#2, Sandra Hanks#1, Anna Zachariou1, Chiara Marcozzi3,4, Matthew Clarke1, Richarda de Voer2, Banafsheh Etemad2, Esther Uijttewaal2, Emma Ramsay1, Harriet Wylie1, Anna Elliott1, Susan Picton5, Audrey Smith6, Sarah Smithson7, Sheila Seal1, Elise Ruark1, Gunnar Houge8, Jonathan Pines3,4, Geert J.P.L. Kops2,9,10,+, and Nazneen Rahman1,11,+ 1Division of Genetics and Epidemiology, Institute of Cancer Research, 15 Cotswold Road, London, SM2 5NG, UK 2Hubrecht Institute – KNAW (Royal Netherlands Academy of Arts and Sciences), Uppsalalaan 8, 3584 CT Utrecht, The Netherlands 3The Gurdon Institute and Department of Zoology, University of Cambridge, Cambridge CB2 1QN, UK 4Division of Cancer Biology, The Institute of Cancer Research, 237 Fulham Road, London SW3 6JB, UK 5Children's and Adolescent Oncology and Haematology Unit, Leeds General Infirmary, Leeds, LS1 3EX, UK 6Yorkshire Regional Clinical Genetics Service, Chapel Allerton Hospital, Chapeltown Road, Leeds, LS7 4SA, UK 7Clinical Genetics Service, St Michael's Hospital, Southwell Street, Bristol, BS2 8EG, UK 8Center for Medical Genetics, Haukeland University Hospital, N-5021 Bergen, Norway 9Cancer Genomics Netherlands, Utrecht, The Netherlands 10Center for Molecular 11 Europe PMC Funders Author Manuscripts Medicine, University Medical Center Utrecht, 3584 CG, Utrecht, The Netherlands Cancer Genetics Unit, Royal Marsden NHS Foundation Trust, London, UK SM2 5PT, UK # These authors contributed equally to this work.
    [Show full text]
  • PDF Output of CLIC (Clustering by Inferred Co-Expression)
    PDF Output of CLIC (clustering by inferred co-expression) Dataset: Num of genes in input gene set: 13 Total number of genes: 16493 CLIC PDF output has three sections: 1) Overview of Co-Expression Modules (CEMs) Heatmap shows pairwise correlations between all genes in the input query gene set. Red lines shows the partition of input genes into CEMs, ordered by CEM strength. Each row shows one gene, and the brightness of squares indicates its correlations with other genes. Gene symbols are shown at left side and on the top of the heatmap. 2) Details of each CEM and its expansion CEM+ Top panel shows the posterior selection probability (dataset weights) for top GEO series datasets. Bottom panel shows the CEM genes (blue rows) as well as expanded CEM+ genes (green rows). Each column is one GEO series dataset, sorted by their posterior probability of being selected. The brightness of squares indicates the gene's correlations with CEM genes in the corresponding dataset. CEM+ includes genes that co-express with CEM genes in high-weight datasets, measured by LLR score. 3) Details of each GEO series dataset and its expression profile: Top panel shows the detailed information (e.g. title, summary) for the GEO series dataset. Bottom panel shows the background distribution and the expression profile for CEM genes in this dataset. Overview of Co-Expression Modules (CEMs) with Dataset Weighting Scale of average Pearson correlations Num of Genes in Query Geneset: 13. Num of CEMs: 1. 0.0 0.2 0.4 0.6 0.8 1.0 Cenpk Cenph Cenpp Cenpu Cenpn Cenpq Cenpl Apitd1
    [Show full text]
  • Download Paper
    M BoC | ARTICLE Chromosomal passenger complex hydrodynamics suggests chaperoning of the inactive state by nucleoplasmin/nucleophosmin Mariah L. Hanleya,b, Tae Yeon Yooc, Matthew Sonnetta, Daniel J. Needlemanc,d, and Timothy J. Mitchisona,* aDepartment of Systems Biology, Harvard Medical School, Boston, MA 02114–5701; bDepartment of Chemistry, cJohn A. Paulson School of Engineering and Applied Sciences, and dDepartment of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138-2902 ABSTRACT The chromosomal passenger complex (CPC) is a conserved, essential regulator of Monitoring Editor cell division. As such, significant anti–cancer drug development efforts have been focused on Yixian Zheng targeting it, most notably by inhibiting its AURKB kinase subunit. The CPC is activated by Carnegie Institution AURKB-catalyzed autophosphorylation on multiple subunits, but how this regulates CPC in- Received: Dec 20, 2016 teractions with other mitotic proteins remains unclear. We investigated the hydrodynamic Revised: Mar 27, 2017 behavior of the CPC in Xenopus laevis egg cytosol using sucrose gradient sedimentation and Accepted: Apr 4, 2017 in HeLa cells using fluorescence correlation spectroscopy. We found that autophosphoryla- tion of the CPC decreases its sedimentation coefficient in egg cytosol and increases its diffu- sion coefficient in live cells, indicating a decrease in mass. Using immunoprecipitation coupled with mass spectrometry and immunoblots, we discovered that inactive, unphosphorylated CPC interacts with nucleophosmin/nucleoplasmin proteins, which are known to oligomerize into pentamers and decamers. Autophosphorylation of the CPC causes it to dissociate from nucleophosmin/nucleoplasmin. We propose that nucleophosmin/nucleoplasmin complexes serve as chaperones that negatively regulate the CPC and/or stabilize its inactive form, pre- venting CPC autophosphorylation and recruitment to chromatin and microtubules in mitosis.
    [Show full text]
  • Identification of Conserved Genes Triggering Puberty in European Sea
    Blázquez et al. BMC Genomics (2017) 18:441 DOI 10.1186/s12864-017-3823-2 RESEARCHARTICLE Open Access Identification of conserved genes triggering puberty in European sea bass males (Dicentrarchus labrax) by microarray expression profiling Mercedes Blázquez1,2* , Paula Medina1,2,3, Berta Crespo1,4, Ana Gómez1 and Silvia Zanuy1* Abstract Background: Spermatogenesisisacomplexprocesscharacterized by the activation and/or repression of a number of genes in a spatio-temporal manner. Pubertal development in males starts with the onset of the first spermatogenesis and implies the division of primary spermatogonia and their subsequent entry into meiosis. This study is aimed at the characterization of genes involved in the onset of puberty in European sea bass, and constitutes the first transcriptomic approach focused on meiosis in this species. Results: European sea bass testes collected at the onset of puberty (first successful reproduction) were grouped in stage I (resting stage), and stage II (proliferative stage). Transition from stage I to stage II was marked by an increase of 11ketotestosterone (11KT), the main fish androgen, whereas the transcriptomic study resulted in 315 genes differentially expressed between the two stages. The onset of puberty induced 1) an up-regulation of genes involved in cell proliferation, cell cycle and meiosis progression, 2) changes in genes related with reproduction and growth, and 3) a down-regulation of genes included in the retinoic acid (RA) signalling pathway. The analysis of GO-terms and biological pathways showed that cell cycle, cell division, cellular metabolic processes, and reproduction were affected, consistent with the early events that occur during the onset of puberty.
    [Show full text]
  • IL21R Expressing CD14+CD16+ Monocytes Expand in Multiple
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX IL21R expressing CD14 +CD16 + monocytes expand in multiple myeloma patients leading to increased osteoclasts Marina Bolzoni, 1 Domenica Ronchetti, 2,3 Paola Storti, 1,4 Gaetano Donofrio, 5 Valentina Marchica, 1,4 Federica Costa, 1 Luca Agnelli, 2,3 Denise Toscani, 1 Rosanna Vescovini, 1 Katia Todoerti, 6 Sabrina Bonomini, 7 Gabriella Sammarelli, 1,7 Andrea Vecchi, 8 Daniela Guasco, 1 Fabrizio Accardi, 1,7 Benedetta Dalla Palma, 1,7 Barbara Gamberi, 9 Carlo Ferrari, 8 Antonino Neri, 2,3 Franco Aversa 1,4,7 and Nicola Giuliani 1,4,7 1Myeloma Unit, Dept. of Medicine and Surgery, University of Parma; 2Dept. of Oncology and Hemato-Oncology, University of Milan; 3Hematology Unit, “Fondazione IRCCS Ca’ Granda”, Ospedale Maggiore Policlinico, Milan; 4CoreLab, University Hospital of Parma; 5Dept. of Medical-Veterinary Science, University of Parma; 6Laboratory of Pre-clinical and Translational Research, IRCCS-CROB, Referral Cancer Center of Basilicata, Rionero in Vulture; 7Hematology and BMT Center, University Hospital of Parma; 8Infectious Disease Unit, University Hospital of Parma and 9“Dip. Oncologico e Tecnologie Avanzate”, IRCCS Arcispedale Santa Maria Nuova, Reggio Emilia, Italy ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2016.153841 Received: August 5, 2016. Accepted: December 23, 2016. Pre-published: January 5, 2017. Correspondence: [email protected] SUPPLEMENTAL METHODS Immunophenotype of BM CD14+ in patients with monoclonal gammopathies. Briefly, 100 μl of total BM aspirate was incubated in the dark with anti-human HLA-DR-PE (clone L243; BD), anti-human CD14-PerCP-Cy 5.5, anti-human CD16-PE-Cy7 (clone B73.1; BD) and anti-human CD45-APC-H 7 (clone 2D1; BD) for 20 min.
    [Show full text]