DOCSLIB.ORG

Supplemental Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Data Supplemental Table 1: List of the 570 genes with conserved Stat3 binding sites (CBS) in at least four species differentially expressed between C56BL/6 and FVB/N remnant kidneys 60 days after nephron reduction. Gene Symbol Ratio CBS in Name Abhd1 27.86 5 species abhydrolase domain containing 1 Pi4k2b 19.99 4 species phosphatidylinositol 4-kinase type 2 beta Pik3c2g 11.64 4 species phosphoinositide-3-kinase, class 2, gamma polypeptide Snap91 11.31 4 species synaptosomal-associated protein, 91kDa homolog (mouse) Ocel1 10.58 ≥ 6 species occludin/ELL domain containing 1 Slc34a2 8.86 4 species solute carrier family 34 (sodium phosphate), member 2 Psmc3ip 8.68 ≥ 6 species PSMC3 interacting protein Hddc3 7.17 ≥ 6 species HD domain containing 3 Lcn2 6.52 4 species lipocalin 2 Pea15a 5.09 5 species phosphoprotein enriched in astrocytes 15 Gfra1 5.09 4 species GDNF family receptor alpha 1 H2-DMb2 4.94 4 species major histocompatibility complex, class II, DM beta Atf3 4.88 4 species activating transcription factor 3 Wdfy1 4.85 4 species WD repeat and FYVE domain containing 1 Serpina10 4.73 4 species serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 Pm20d1 4.71 4 species peptidase M20 domain containing 1 Aldh4a1 4.35 4 species aldehyde dehydrogenase 4 family, member A1 Wasf2 4.10 4 species WAS protein family, member 2 Edn1 4.07 4 species endothelin 1 Zkscan1 3.98 4 species zinc finger with KRAB and SCAN domains 1 Cyr61 3.94 4 species cysteine-rich, angiogenic inducer, 61 Adamts1 3.76 5 species ADAM metallopeptidase with thrombospondin type 1 motif, 1 Fst 3.70 ≥ 6 species follistatin Egr2 3.63 4 species early growth response 2 (Krox-20 homolog, Drosophila) Cep55 3.56 4 species centrosomal protein 55kDa Aspm 3.43 4 species asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 671322 3.43 4 species chromosome 4 open reading frame 33 Itga1 3.34 4 species integrin, alpha 1 Sik1 3.28 ≥ 6 species SNF1-like kinase Timp1 3.27 4 species TIMP metallopeptidase inhibitor 1 Ctps 3.24 4 species CTP synthase Lrg1 3.18 4 species leucine-rich alpha-2-glycoprotein 1 Il17rb 3.15 4 species interleukin 17 receptor B Ubtd2 3.12 4 species ubiquitin domain containing 2 Rcan1 3.05 4 species regulator of calcineurin 1 Socs3 3.03 4 species suppressor of cytokine signaling 3 Egr1 3.00 4 species early growth response 1 Anxa4 2.99 4 species annexin A4 Col12a1 2.98 4 species collagen, type XII, alpha 1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal Ammecr1 2.96 4 species region, gene 1 Tlr2 2.91 4 species toll-like receptor 2 Rrm2 2.91 5 species ribonucleotide reductase M2 polypeptide Ccl2 2.88 4 species chemokine (C-C motif) ligand 13 Bcl3 2.88 4 species B-cell CLL/lymphoma 3 Rragd 2.87 4 species Ras-related GTP binding D Cygb 2.84 4 species cytoglobin transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma- Tgm1 2.80 4 species glutamyltransferase) LOC100045442 2.79 4 species stromal antigen 1 Prc1 2.78 5 species protein regulator of cytokinesis 1 Fgg 2.73 4 species fibrinogen gamma chain Cdca8 2.73 4 species cell division cycle associated 8 Fos 2.70 4 species v-fos FBJ murine osteosarcoma viral oncogene homolog Zwilch 2.69 4 species Zwilch, kinetochore associated, homolog (Drosophila) LOC636537 2.63 4 species signal sequence receptor, alpha (translocon-associated protein alpha) Aldh1a2 2.61 4 species aldehyde dehydrogenase 1 family, member A2 Myc 2.58 4 species v-myc myelocytomatosis viral oncogene homolog (avian) Tmem82 2.57 4 species transmembrane protein 82 Egr3 2.53 4 species early growth response 3 Adal 2.52 4 species adenosine deaminase-like Hpcal4 2.52 ≥ 6 species hippocalcin like 4 Ccna2 2.51 4 species cyclin A2 Lgi2 2.49 4 species leucine-rich repeat LGI family, member 2 Cks1b 2.48 4 species CDC28 protein kinase regulatory subunit 1B 1 F3 2.47 4 species coagulation factor III (thromboplastin, tissue factor) Abcc9 2.45 4 species ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Tgfb2 2.43 4 species transforming growth factor, beta 2 Tgif1 2.41 4 species TGFB-induced factor homeobox 1 Gm71 2.40 4 species gene model 71. (NCBI) Slc40a1 2.39 ≥ 6 species solute carrier family 40 (iron-regulated transporter), member 1 Steap1 2.39 4 species six transmembrane epithelial antigen of the prostate 1 LOC100046232 2.37 4 species nuclear factor, interleukin 3 regulated Socs2 2.36 5 species suppressor of cytokine signaling 2 Rpl12 2.35 4 species small nucleolar RNA, H/ACA box 65 Nr4a1 2.35 5 species nuclear receptor subfamily 4, group A, member 1 Uchl1 2.32 4 species ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) Csf1 2.31 4 species colony stimulating factor 1 (macrophage) Cnot7 2.30 5 species CCR4-NOT transcription complex, subunit 7 Ccnl2 2.30 ≥ 6 species cyclin L2 Cxcr4 2.29 4 species chemokine (C-X-C motif) receptor 4 Med1 2.29 4 species mediator complex subunit 1 LOC100045677 2.27 4 species minichromosome maintenance complex component 3 Pck1 2.25 ≥ 6 species phosphoenolpyruvate carboxykinase 1 (soluble) Ptrh1 2.24 4 species peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Id1 2.24 4 species inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Josd1 2.23 ≥ 6 species Josephin domain containing 1 Aff2 2.23 4 species --- Clcf1 2.23 4 species cardiotrophin-like cytokine factor 1 Tpm3 2.21 4 species tropomyosin 3 Ctgf 2.21 4 species connective tissue growth factor Il6st 2.19 5 species interleukin 6 signal transducer (gp130. oncostatin M receptor) Olfm4 2.16 4 species olfactomedin 4 Dpysl3 2.16 4 species dihydropyrimidinase-like 3 Icam1 2.16 5 species intercellular adhesion molecule 1 (CD54), human rhinovirus receptor methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2. Mthfd2 2.16 4 species methenyltetrahydrofolate cyclohydrolase 1300014I06Rik 2.15 4 species chromosome 6 open reading frame 145 phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, Gart 2.15 4 species phosphoribosylaminoimidazole synthetase Zfp185 2.14 4 species zinc finger protein 185 (LIM domain) Myo1c 2.14 5 species myosin IC OTTMUSG00000007332 2.14 4 species sushi domain containing 1 Frg1 2.14 4 species FSHD region gene 1 Plek 2.13 4 species pleckstrin Adm 2.11 4 species adrenomedullin Tsr1 2.11 4 species TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) Net1 2.09 4 species neuroepithelial cell transforming gene 1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta Ywhah 2.09 4 species polypeptide Rhobtb3 2.07 4 species Rho-related BTB domain containing 3 Rrad 2.07 4 species Ras-related associated with diabetes Dennd2a 2.07 4 species DENN/MADD domain containing 2A Btg2 2.06 4 species BTG family, member 2 solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), Slc25a17 2.06 4 species member 17 Kras 2.06 4 species v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Parvb 2.06 4 species parvin, beta Per2 2.05 4 species period homolog 2 (Drosophila) Plau 2.04 4 species plasminogen activator, urokinase Gng10 2.03 4 species guanine nucleotide binding protein (G protein), gamma 10 Jun 2.03 4 species jun oncogene Crnkl1 2.02 4 species crooked neck pre-mRNA splicing factor-like 1 (Drosophila) Ier2 2.01 4 species immediate early response 2 Commd2 2.01 4 species COMM domain containing 2 Sec61a1 2.00 4 species Sec61 alpha 1 subunit (S. cerevisiae) Dynll1 2.00 4 species dynein, light chain, LC8-type 1 Rnase4 2.00 4 species ribonuclease, RNase A family, 4 Klf6 1.99 5 species Kruppel-like factor 6 Abca1 1.99 4 species ATP-binding cassette, sub-family A (ABC1), member 1 P2ry6 1.99 4 species pyrimidinergic receptor P2Y, G-protein coupled, 6 Pprc1 1.97 4 species peroxisome proliferator-activated receptor gamma, coactivator-related 1 Shoc2 1.97 ≥ 6 species soc-2 suppressor of clear homolog (C. elegans) Anxa2 1.97 4 species annexin A2 Hs6st2 1.97 4 species heparan sulfate 6-O-sulfotransferase 2 Nfkbie 1.97 4 species nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Tuft1 1.96 4 species tuftelin 1 Trib1 1.95 4 species tribbles homolog 1 (Drosophila) Mobkl2a 1.95 4 species MOB1, Mps One Binder kinase activator-like 2A (yeast) Mettl6 1.95 4 species methyltransferase like 6 2 Pdlim7 1.95 4 species PDZ and LIM domain 7 (enigma) Trim47 1.95 5 species tripartite motif-containing 47 Akt1 1.94 4 species v-akt murine thymoma viral oncogene homolog 1 asparagine-linked glycosylation 12 homolog (S. cerevisiae, alpha-1,6- Alg12 1.94 4 species mannosyltransferase) Marcksl1 1.93 4 species MARCKS-like 1 1810013L24Rik 1.93 5 species chromosome 16 open reading frame 72 Kpna2 1.92 5 species karyopherin alpha 2 (RAG cohort 1, importin alpha 1) Acy1 1.92 4 species aminoacylase 1 Fermt3 1.92 4 species fermitin family homolog 3 (Drosophila) Ier5 1.91 4 species immediate early response 5 Coro1c 1.91 4 species coronin, actin binding protein, 1C Rgs5 1.90 4 species regulator of G-protein signaling 5 S100a6 1.90 4 species S100 calcium binding protein A6 Sphk1 1.89 5 species sphingosine kinase 1 Plp2 1.89 4 species proteolipid protein 2 (colonic epithelium-enriched) Nasp 1.89 ≥ 6 species nuclear autoantigenic sperm protein (histone-binding) Mcm4 1.88 4 species minichromosome maintenance complex component 4 Plekho1 1.88 4 species pleckstrin homology domain containing, family O member 1 Mad2l2 1.88 4 species MAD2 mitotic arrest deficient-like 2 (yeast) Smc2 1.87 4 species structural maintenance of chromosomes 2 Creld2 1.87 4 species cysteine-rich with EGF-like domains
Load more

Recommended publications
  • CENPT (NM 025082) Human 3' UTR Clone – SC200995 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC200995 CENPT (NM_025082) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: CENPT (NM_025082) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: CENPT Synonyms: C16orf56; CENP-T; SSMGA ACCN: NM_025082 Insert Size: 140 bp Insert Sequence: >SC200995 3’UTR clone of NM_025082 The sequence shown below is from the reference sequence of NM_025082. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC AGTGGCAACTCTGTCTTCCCTGCCCAGTAGTGGCCAGGCTTCAACACTTTCCCTGTCCCCACCTGGGGA CTCTTGCCCCCACATATTTCTCCAGGTCTCCTCCCCACCCCCCCAGCATCAATAAAGTGTCATAAACAG AA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_025082.4 Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008] Locus ID: 80152 This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • Functional Roles of Bromodomain Proteins in Cancer
    cancers Review Functional Roles of Bromodomain Proteins in Cancer Samuel P. Boyson 1,2, Cong Gao 3, Kathleen Quinn 2,3, Joseph Boyd 3, Hana Paculova 3 , Seth Frietze 3,4,* and Karen C. Glass 1,2,4,* 1 Department of Pharmaceutical Sciences, Albany College of Pharmacy and Health Sciences, Colchester, VT 05446, USA; [email protected] 2 Department of Pharmacology, Larner College of Medicine, University of Vermont, Burlington, VT 05405, USA; [email protected] 3 Department of Biomedical and Health Sciences, University of Vermont, Burlington, VT 05405, USA; [email protected] (C.G.); [email protected] (J.B.); [email protected] (H.P.) 4 University of Vermont Cancer Center, Burlington, VT 05405, USA * Correspondence: [email protected] (S.F.); [email protected] (K.C.G.) Simple Summary: This review provides an in depth analysis of the role of bromodomain-containing proteins in cancer development. As readers of acetylated lysine on nucleosomal histones, bromod- omain proteins are poised to activate gene expression, and often promote cancer progression. We examined changes in gene expression patterns that are observed in bromodomain-containing proteins and associated with specific cancer types. We also mapped the protein–protein interaction network for the human bromodomain-containing proteins, discuss the cellular roles of these epigenetic regu- lators as part of nine different functional groups, and identify bromodomain-specific mechanisms in cancer development. Lastly, we summarize emerging strategies to target bromodomain proteins in cancer therapy, including those that may be essential for overcoming resistance. Overall, this review provides a timely discussion of the different mechanisms of bromodomain-containing pro- Citation: Boyson, S.P.; Gao, C.; teins in cancer, and an updated assessment of their utility as a therapeutic target for a variety of Quinn, K.; Boyd, J.; Paculova, H.; cancer subtypes.
    [Show full text]
  • A Genome-Wide Association Study of Bisphosphonate-Associated
    Calcifed Tissue International (2019) 105:51–67 https://doi.org/10.1007/s00223-019-00546-9 ORIGINAL RESEARCH A Genome‑Wide Association Study of Bisphosphonate‑Associated Atypical Femoral Fracture Mohammad Kharazmi1 · Karl Michaëlsson1 · Jörg Schilcher2 · Niclas Eriksson3,4 · Håkan Melhus3 · Mia Wadelius3 · Pär Hallberg3 Received: 8 January 2019 / Accepted: 8 April 2019 / Published online: 20 April 2019 © The Author(s) 2019 Abstract Atypical femoral fracture is a well-documented adverse reaction to bisphosphonates. It is strongly related to duration of bisphosphonate use, and the risk declines rapidly after drug withdrawal. The mechanism behind bisphosphonate-associated atypical femoral fracture is unclear, but a genetic predisposition has been suggested. With the aim to identify common genetic variants that could be used for preemptive genetic testing, we performed a genome-wide association study. Cases were recruited mainly through reports of adverse drug reactions sent to the Swedish Medical Products Agency on a nation- wide basis. We compared atypical femoral fracture cases (n = 51) with population-based controls (n = 4891), and to reduce the possibility of confounding by indication, we also compared with bisphosphonate-treated controls without a current diagnosis of cancer (n = 324). The total number of single-nucleotide polymorphisms after imputation was 7,585,874. A genome-wide signifcance threshold of p < 5 × 10−8 was used to correct for multiple testing. In addition, we performed candidate gene analyses for a panel of 29 genes previously implicated in atypical femoral fractures (signifcance threshold of p < 5.7 × 10−6). Compared with population controls, bisphosphonate-associated atypical femoral fracture was associated with four isolated, uncommon single-nucleotide polymorphisms.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • Gene Knockdown of CENPA Reduces Sphere Forming Ability and Stemness of Glioblastoma Initiating Cells
    Neuroepigenetics 7 (2016) 6–18 Contents lists available at ScienceDirect Neuroepigenetics journal homepage: www.elsevier.com/locate/nepig Gene knockdown of CENPA reduces sphere forming ability and stemness of glioblastoma initiating cells Jinan Behnan a,1, Zanina Grieg b,c,1, Mrinal Joel b,c, Ingunn Ramsness c, Biljana Stangeland a,b,⁎ a Department of Molecular Medicine, Institute of Basic Medical Sciences, The Medical Faculty, University of Oslo, Oslo, Norway b Norwegian Center for Stem Cell Research, Department of Immunology and Transfusion Medicine, Oslo University Hospital, Oslo, Norway c Vilhelm Magnus Laboratory for Neurosurgical Research, Institute for Surgical Research and Department of Neurosurgery, Oslo University Hospital, Oslo, Norway article info abstract Article history: CENPA is a centromere-associated variant of histone H3 implicated in numerous malignancies. However, the Received 20 May 2016 role of this protein in glioblastoma (GBM) has not been demonstrated. GBM is one of the most aggressive Received in revised form 23 July 2016 human cancers. GBM initiating cells (GICs), contained within these tumors are deemed to convey Accepted 2 August 2016 characteristics such as invasiveness and resistance to therapy. Therefore, there is a strong rationale for targeting these cells. We investigated the expression of CENPA and other centromeric proteins (CENPs) in Keywords: fi CENPA GICs, GBM and variety of other cell types and tissues. Bioinformatics analysis identi ed the gene signature: fi Centromeric proteins high_CENP(AEFNM)/low_CENP(BCTQ) whose expression correlated with signi cantly worse GBM patient Glioblastoma survival. GBM Knockdown of CENPA reduced sphere forming ability, proliferation and cell viability of GICs. We also Brain tumor detected significant reduction in the expression of stemness marker SOX2 and the proliferation marker Glioblastoma initiating cells and therapeutic Ki67.
    [Show full text]
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
    [Show full text]
  • Figure S1. Quality Control Validation of MS Data. (A‑C) Mass Error Distribution of All Peptides Identified in the Acetylome
    Figure S1. Quality control validation of MS data. (A‑C) Mass error distribution of all peptides identified in the acetylome, succi- nylome and quantitative proteome, respectively. (D‑F) Length distribution of peptides identified in the acetylome, succinylome and quantitative proteome, respectively. Figure S2. Comparison of modification level between breast cancer tissue and normal tissue. Comparison of acetylation level (A) and succinylation level (B) between breast cancer tissue and normal tissue. Data are medians and were analyzed using Wilcoxon Signed Rank Test. **P<0.01. Table SI. Protein sites whose acetylation and succinylation levels were both significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site P54868 HMCS2 310K Q15063 POSTN 549K Q99715 COCA1 1601K P51572 BAP31 72K P07237 PDLA1 328K Q06830 PRDX1 192K P48735 IDHP 180K P30101 PDIA3 417K P0DMV9 HS71B 526K Q01995 TAGL 21K P06748 NPM1 27K Q00325 MPCP 209K P00488 F13A 69K P02545 LMNA 260K P08133 ANXA6 478K P02452 CO1A1 751K Table SII. Protein sites whose acetylation and succinylation levels were both significantly downregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site RET4 P02753 30K PSG2 P07585 142K HBA P69905 12K IGKC P01834 80K HBA P69905 8K Table SIII. All proteins whose expression level were significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein description
    [Show full text]
  • 32-4621: Recombinant Rat Calbindin-1 Description Product
    ABGENEX Pvt. Ltd., E-5, Infocity, KIIT Post Office, Tel : +91-674-2720712, +91-9437550560 Email : [email protected] Bhubaneswar, Odisha - 751024, INDIA 32-4621: Recombinant Rat Calbindin-1 Alternative Name : Calbindin,Vitamin D-dependent calcium-binding protein,avian-type,Calbindin D28,D-28K,Spot 35 protein,Calb1,CaBP28K,MGC93326. Description Source : Escherichia Coli. Recombinant Rat Calbindin-1 produced in E.Coli.The Rat CALB1 is purified by proprietary chromatographic techniques. Calbindins are Ca-binding proteins belonging to the troponin C superfamily. CALB28K/Calbindin1/CALB1 (D28K/Spot35 protein or cholecalcin, rat 261 aa; mouse 261 aa; human 261-aa, chromosome 8q21.3-q22.1) was originally described as 27-kDA induced by vitamin D in the duodenum of chicken. In mammals, it is expressed in the kidney, pancreatic islets, and brain. In brain, its synthesis is independent of vitamin D. CABP28K contains 4 active and 2 inactive EF-hand Ca-binding domains. The gene for CABP28K is clustered in the same region as carbonic anhydrase. The neurons in the brains of patients with Huntington disease are CAB28K depleted. There are two types of CaBPs: the 'trigger'- and the 'buffer'-CaBPs. The conformation of 'trigger' type CaBPs changes upon Ca2+ binding and exposes regions on protein that interact with target molecules, thus altering their activity. The buffer-type CABP are thought to control the intracellular calcium concentration. Calbindin D-28K is found predominantly in subpopulations of central and peripheral nervous system neurons, and in certain epithelial cells involved in Ca2+ transport such as distal tubular cells and cortical collecting tubules of the kidney, and in enteric neuroendocrine cells.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Loss of ISWI Atpase SMARCA5 (SNF2H) in Acute Myeloid Leukemia Cells Inhibits Proliferation and Chromatid Cohesion
    International Journal of Molecular Sciences Article Loss of ISWI ATPase SMARCA5 (SNF2H) in Acute Myeloid Leukemia Cells Inhibits Proliferation and Chromatid Cohesion 1, 1, 1 2,3,4 1 Tomas Zikmund y , Helena Paszekova y , Juraj Kokavec , Paul Kerbs , Shefali Thakur , Tereza Turkova 1, Petra Tauchmanova 1, Philipp A. Greif 2,3,4 and Tomas Stopka 1,* 1 Biocev, 1st Medical Faculty, Charles University, 25250 Vestec, Czech Republic; [email protected] (T.Z.); [email protected] (H.P.); [email protected] (J.K.); [email protected] (S.T.); [email protected] (T.T.); [email protected] (P.T.) 2 Department of Medicine III, University Hospital, LMU Munich, D-80539 Munich, Germany; [email protected] (P.K.); [email protected] (P.A.G.) 3 German Cancer Consortium (DKTK), partner site Munich, D-80336 Munich, Germany 4 German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany * Correspondence: [email protected]; Tel.: +420-32587-3001 These authors contributed equally. y Received: 26 February 2020; Accepted: 16 March 2020; Published: 18 March 2020 Abstract: ISWI chromatin remodeling ATPase SMARCA5 (SNF2H) is a well-known factor for its role in regulation of DNA access via nucleosome sliding and assembly. SMARCA5 transcriptionally inhibits the myeloid master regulator PU.1. Upregulation of SMARCA5 was previously observed in CD34+ hematopoietic progenitors of acute myeloid leukemia (AML) patients. Since high levels of SMARCA5 are necessary for intensive cell proliferation and cell cycle progression of developing hematopoietic stem and progenitor cells in mice, we reasoned that removal of SMARCA5 enzymatic activity could affect the cycling or undifferentiated state of leukemic progenitor-like clones.
    [Show full text]