DOCSLIB.ORG

High Expression Levels of Centromere Protein a Plus Upregulation of The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High Expression Levels of Centromere Protein a Plus Upregulation of The ONCOLOGY LETTERS 21: 410, 2021 High expression levels of centromere protein A plus upregulation of the phosphatidylinositol 3‑kinase/Akt/mammalian target of rapamycin signaling pathway affect chemotherapy response and prognosis in patients with breast cancer SONGBO ZHANG*, YANYAN XIE*, TING TIAN, QIANRU YANG, YUTING ZHOU, JUANJUAN QIU, LI XU, NAN WEN, QING LV and ZHENGGUI DU Department of Breast Surgery, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China Received March 8, 2020; Accepted February 16, 2021 DOI: 10.3892/ol.2021.12671 Abstract. Centromere proteins (CENPs) are involved in overall survival. However, according to the multivariate mitosis, and CENP gene expression levels are associated analyses, only CENPA was an independent risk factor asso‑ with chemotherapy responses in patients with breast cancer. ciated with DRFS in GEO database. In addition, in the RD The present study aimed to examine the roles and underlying subgroup, patients with higher CENPA expression levels had mechanisms of the effects of CENP genes on chemotherapy a worse prognosis compared with those with lower CENPA responses and breast cancer prognosis. Using data obtained expression levels. Among patients with high expression levels from the Gene Expression Omnibus (GEO) database, correla‑ of CENPA, the PI3K/Akt/mTOR pathway was more likely tion and Cox multivariate regression analyses were used to to be activated in the RD compared with the PCR subgroup. determine the CENP genes associated with chemotherapy The same trend was observed in TCGA data. These results responses and survival in patients with breast cancer. Weighted suggested that high CENPA expression levels plus upregulation gene co‑expression network and correlation analyses were used of the PI3K/Akt/mTOR signaling pathway may affect DRFS to determine the gene modules co‑expressed with the identi‑ in patients with breast cancer. fied genes and the differential expression of gene modules associated with the pathological complete response (PCR) and Introduction residual disease (RD) subgroups. CENPA, CENPE, CENPF, CENPI, CENPJ and CENPN were associated with a high Breast cancer is the most common cancer among women nuclear grade and low estrogen and progesterone receptor worldwide, with 2.1 million newly diagnosed cases in 2018 expression levels. In addition, CENPA, CENPB, CENPC according to the World Health Organization (1). In the United and CENPO were independent factors affecting the distant States of America, 249,260 patients were diagnosed with breast relapse‑free survival (DRFS) rates in patients with breast cancer in 2016 (2). According to data released by the Cancer cancer. Patients with high expression levels of CENPA or Center of China in 2014, the total incidence of breast cancer CENPO exhibited poor prognoses, whereas those with high in China was 42.55 per 100,000 individuals, making breast expression levels of CENPB or CENPC presented with favor‑ cancer the most common malignant tumor in women (3). able prognoses. For validation between databases, the Cancer The aim of chemotherapy is to interfere with the process Genome Atlas (TCGA) database analysis also revealed that of cell proliferation; therefore, most chemotherapeutic drugs CENPA, CENPB and CENPO exerted similar effects on exert major effects on proliferating cells, including cancer cells, which are characterized by abnormal and uncontrolled proliferation (4). Chemotherapy is currently the most effective method for systemic treatment of patients with breast cancer and prevents the division and proliferation of cancer cells by Correspondence to: Dr Zhenggui Du, Department of Breast destroying cancer cell DNA and disrupting the intracellular Surgery, West China Hospital, Sichuan University, 37 Guoxue Alley, components involved in mitosis (5). In addition, certain chemo‑ Wuhou, Chengdu, Sichuan 610041, P.R. China therapeutic drugs kill cancer cells by inducing apoptosis (6). E‑mail: [email protected] Centromere proteins (CENPs) serve important roles *Contributed equally in centromere function and mitosis; for example, CENPA encodes centromere protein A, which contains a variant of Key words: breast cancer, centromere protein A, neoadjuvant histone H3 that is specifically expressed on the centromere chemotherapy, phosphatidylinositol 3‑kinase/Akt/mammalian target and kinetochore of the chromosome and is targeted by of rapamycin pathway, residual disease microfilaments during mitosis, resulting in the separation of centromeres during mitosis (7). CENPB supports kinetochore formation and contributes to the maintenance of chromosome 2 ZHANG et al: CENPA PLUS UPREGULATION OF PI3K/Akt/mTOR PATHWAY IN BREAST CANCER segregation fidelity (8). CENPC serves as a scaffold for the Weighted correlation network analysis (WGCNA). Data of this specific recruitment of essential kinetochore proteins and part were extracted from the GEO database publicly mentioned links centromeres and kinetochores in mitosis (9). Thus, above. The ‘WGCNA’ package in the R software (21) was CENPs are important components of chromosomes during used to perform scale‑free network topology analysis of mitosis and can regulate the proliferation of tumor cells. microarray expression data of breast cancer samples. Standard Therefore, we hypothesized that the expression of CENP genes WGCNA parameters were used for analysis. Using WGCNA, may be associated with the responses of breast tumor cells to a co‑expression module of genes associated with patient chemotherapy and may affect patient survival. clinicopathological characteristics was extracted from the The aim of the present study was to systematically explore breast cancer data for subsequent analysis. the associations between 13 CENP genes and chemotherapy responses in patients with breast cancer and to identify genes Kyoto Encyclopedia of Genes and Genomes (KEGG) that were most relevant to the patient prognosis. enrichment analysis of co‑expression modules. KEGG pathway analyses were performed to determine the biological Materials and methods functions of the genes in the green module identified by WGCNA to be highly correlated with CENPA using the Gene datasets. Five breast cancer mRNA expression profiles, DAVID Bioinformatics Tool (version 6.8; https://david.ncifcrf. namely GSE20194 (10,11), GSE20271 (12), GSE22093 (13), gov/home.jsp). P<0.05 was considered to indicate a statistically GSE23988 (13) and GSE25066 (14,15), were extracted significant result. A total of 12 records were extracted. Graphs from the Gene Expression Omnibus (GEO; http://www. were generated using the ‘ggplot2’ R package (22). ncbi.nlm.nih.gov/geo/) database using the key words ‘breast cancer’, ‘neoadjuvant chemotherapy’ and ‘pre‑operative Statistical analysis. Data are presented as the mean, range, chemotherapy’. Studies in which gene expression levels were standard deviation or proportion. Statistical analyses were analyzed in genome profiling data using pretreatment biopsies performed using R software (version 3.5). Univariate and from patients who underwent neoadjuvant chemotherapy multivariate survival analyses were performed using Cox were included. The first four datasets (GSE20194, GSE20271, regression models. The χ2 test was used to analyze the GSE22093 and GSE23988) were used as the training dataset associations between CENP expression levels and patient (n=620 patients), and the fifth dataset (GSE25066) was used clinicopathological characteristics. Kaplan‑Meier curves as the validation dataset (n=508 patients). The mRNA expres‑ were used for survival analysis, and the Cramér‑von Mises sion profiles of breast cancer from The Cancer Genome Atlas and log‑rank tests were used for the curves with and without (TCGA; https://portal.gdc.cancer.gov/) database were used crossovers, respectively. Comparisons of correlations were for validation. In the GEO database, the result of pathological performed using the ‘correlation coefficients’ module in response was classified into pathological complete response MedCalc software (Version 19.6.4; MedCalc Software, Ltd.). (PCR) and residual disease (RD). In TCGA database used for For comparisons of means, continuous variables between validation, the result of pathological response was classified groups were analyzed using the independent‑samples into clinical complete response (CCR) and RD. Student's t‑test or one‑way ANOVA. Comparisons of rates were performed using the χ2 test. P<0.05 was considered to Immunohistochemistry and molecular classification. indicate a statistically significant difference. Immunohistochemistry and molecular classification results were extracted from the GEO database. The hormone receptor Results status of a tumor was defined as positive when the immuno‑ histochemistry results were positive for either estrogen receptor Basic characteristics of the study population. In the present (ER) or progesterone receptor (PR) in ≥1% of cells and as nega‑ study, five datasets including a total of 1,128 patients were eval‑ tive when both ER and PR were negative. According to global uated. The specific characteristics of each study are presented consensus (16), HER2 expression status was defined as negative in Table I. The cancer grades were primarily II and III, and when the immunohistochemistry results were negative or 1+, the nuclear grades were mainly G2 and G3. All patients and as positive when the results were 3+. HER2 positivity was in the present study received neoadjuvant chemotherapy, and evaluated according to the results of fluorescent
Load more

Recommended publications
  • CENPT (NM 025082) Human 3' UTR Clone – SC200995 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC200995 CENPT (NM_025082) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: CENPT (NM_025082) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: CENPT Synonyms: C16orf56; CENP-T; SSMGA ACCN: NM_025082 Insert Size: 140 bp Insert Sequence: >SC200995 3’UTR clone of NM_025082 The sequence shown below is from the reference sequence of NM_025082. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC AGTGGCAACTCTGTCTTCCCTGCCCAGTAGTGGCCAGGCTTCAACACTTTCCCTGTCCCCACCTGGGGA CTCTTGCCCCCACATATTTCTCCAGGTCTCCTCCCCACCCCCCCAGCATCAATAAAGTGTCATAAACAG AA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_025082.4 Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008] Locus ID: 80152 This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • View the Poster.Pdf
    Identifying Novel Associations for Iron-Related Genes in High-Grade Ovarian Cancer Abigail Descoteaux*1, José W. Velázquez*2, Anna Konstorum3, Reinhard Laubenbacher3,4 1Vassar College, 2University of Puerto Rico at Cayey, 3Center for Quantitative Medicine, UConn Health, 4The Jackson Laboratory for Genomic Medicine *These authors contributed equally to this work Introduction Methods Testable Hypothesis § Iron can gain and lose electrons, making it enzymatically Microarray gene expression Adjacency matrix Community detection in a weighted, KEGG pathways Tumor cells promote an inflammatory microenvironment via [1] data from HGSOC clinical • Top 10,000 most variable genes undirected network • Manually curated biological pathways useful in cell replication, metabolism, and growth • Bicor derived from Pearson but • ORA: ask whether any known pathways • Order Statistics Local Optimization Method (OSLOM) recruitment of tumor-associated macrophages, that in turn samples less sensitive to outliers are significantly over-represented in the • Assembled unsupervised with respect to biology by locally § Cancer cells sequester iron by altering the expression of • The Cancer Genome Atlas (TCGA) • Correlation cut-off at 0.45 genes within the community secrete IL4 and CCL4 to promote an iron-influx phenotype in optimizing the statistical significance of clusters and using [1] • Affymetrix HGU133A (n=488) (FDR corrected, α=0.01) Pathway 2 several regulators of iron metabolism (Figure 1) • Tothill et al. [2] this as a fitness score ovarian cancer tumor cells. • • HGU133plus2 (n=217) Accounts for edge weight, overlapping communities, and Pathway 1 hierarchies a. Normal epithelial cell Fe3+ Fe3+ Pathway 3 Tumor-associated 3+ 3+ Tumor cells Fe Fe macrophages Hepcidin (HAMP) samples genes Biweight midcorrelation Over-representation (bicor) Hypothesis CSF1R Ferroportin OSLOM analysis (ORA) CCR1[8] (SLC40A1) generation and [7] genes genes 1.
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • Nuclear Organization and the Epigenetic Landscape of the Mus Musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected]
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 8-9-2019 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Liu, Alicia, "Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome" (2019). Doctoral Dissertations. 2273. https://opencommons.uconn.edu/dissertations/2273 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia J. Liu, Ph.D. University of Connecticut, 2019 ABSTRACT X-linked imprinted genes have been hypothesized to contribute parent-of-origin influences on social cognition. A cluster of imprinted genes Xlr3b, Xlr4b, and Xlr4c, implicated in cognitive defects, are maternally expressed and paternally silent in the murine brain. These genes defy classic mechanisms of autosomal imprinting, suggesting a novel method of imprinted gene regulation. Using Xlr3b and Xlr4c as bait, this study uses 4C-Seq on neonatal whole brain of a 39,XO mouse model, to provide the first in-depth analysis of chromatin dynamics surrounding an imprinted locus on the X-chromosome. Significant differences in long-range contacts exist be- tween XM and XP monosomic samples. In addition, XM interaction profiles contact a greater number of genes linked to cognitive impairment, abnormality of the nervous system, and abnormality of higher mental function. This is not a pattern that is unique to the imprinted Xlr3/4 locus. Additional Alicia J. Liu - University of Connecticut - 2019 4C-Seq experiments show that other genes on the X-chromosome, implicated in intellectual disability and/or ASD, also produce more maternal contacts to other X-linked genes linked to cognitive impairment.
    [Show full text]
  • Gene Knockdown of CENPA Reduces Sphere Forming Ability and Stemness of Glioblastoma Initiating Cells
    Neuroepigenetics 7 (2016) 6–18 Contents lists available at ScienceDirect Neuroepigenetics journal homepage: www.elsevier.com/locate/nepig Gene knockdown of CENPA reduces sphere forming ability and stemness of glioblastoma initiating cells Jinan Behnan a,1, Zanina Grieg b,c,1, Mrinal Joel b,c, Ingunn Ramsness c, Biljana Stangeland a,b,⁎ a Department of Molecular Medicine, Institute of Basic Medical Sciences, The Medical Faculty, University of Oslo, Oslo, Norway b Norwegian Center for Stem Cell Research, Department of Immunology and Transfusion Medicine, Oslo University Hospital, Oslo, Norway c Vilhelm Magnus Laboratory for Neurosurgical Research, Institute for Surgical Research and Department of Neurosurgery, Oslo University Hospital, Oslo, Norway article info abstract Article history: CENPA is a centromere-associated variant of histone H3 implicated in numerous malignancies. However, the Received 20 May 2016 role of this protein in glioblastoma (GBM) has not been demonstrated. GBM is one of the most aggressive Received in revised form 23 July 2016 human cancers. GBM initiating cells (GICs), contained within these tumors are deemed to convey Accepted 2 August 2016 characteristics such as invasiveness and resistance to therapy. Therefore, there is a strong rationale for targeting these cells. We investigated the expression of CENPA and other centromeric proteins (CENPs) in Keywords: fi CENPA GICs, GBM and variety of other cell types and tissues. Bioinformatics analysis identi ed the gene signature: fi Centromeric proteins high_CENP(AEFNM)/low_CENP(BCTQ) whose expression correlated with signi cantly worse GBM patient Glioblastoma survival. GBM Knockdown of CENPA reduced sphere forming ability, proliferation and cell viability of GICs. We also Brain tumor detected significant reduction in the expression of stemness marker SOX2 and the proliferation marker Glioblastoma initiating cells and therapeutic Ki67.
    [Show full text]
  • PDF Output of CLIC (Clustering by Inferred Co-Expression)
    PDF Output of CLIC (clustering by inferred co-expression) Dataset: Num of genes in input gene set: 13 Total number of genes: 16493 CLIC PDF output has three sections: 1) Overview of Co-Expression Modules (CEMs) Heatmap shows pairwise correlations between all genes in the input query gene set. Red lines shows the partition of input genes into CEMs, ordered by CEM strength. Each row shows one gene, and the brightness of squares indicates its correlations with other genes. Gene symbols are shown at left side and on the top of the heatmap. 2) Details of each CEM and its expansion CEM+ Top panel shows the posterior selection probability (dataset weights) for top GEO series datasets. Bottom panel shows the CEM genes (blue rows) as well as expanded CEM+ genes (green rows). Each column is one GEO series dataset, sorted by their posterior probability of being selected. The brightness of squares indicates the gene's correlations with CEM genes in the corresponding dataset. CEM+ includes genes that co-express with CEM genes in high-weight datasets, measured by LLR score. 3) Details of each GEO series dataset and its expression profile: Top panel shows the detailed information (e.g. title, summary) for the GEO series dataset. Bottom panel shows the background distribution and the expression profile for CEM genes in this dataset. Overview of Co-Expression Modules (CEMs) with Dataset Weighting Scale of average Pearson correlations Num of Genes in Query Geneset: 13. Num of CEMs: 1. 0.0 0.2 0.4 0.6 0.8 1.0 Cenpk Cenph Cenpp Cenpu Cenpn Cenpq Cenpl Apitd1
    [Show full text]
  • Identification of Conserved Genes Triggering Puberty in European Sea
    Blázquez et al. BMC Genomics (2017) 18:441 DOI 10.1186/s12864-017-3823-2 RESEARCHARTICLE Open Access Identification of conserved genes triggering puberty in European sea bass males (Dicentrarchus labrax) by microarray expression profiling Mercedes Blázquez1,2* , Paula Medina1,2,3, Berta Crespo1,4, Ana Gómez1 and Silvia Zanuy1* Abstract Background: Spermatogenesisisacomplexprocesscharacterized by the activation and/or repression of a number of genes in a spatio-temporal manner. Pubertal development in males starts with the onset of the first spermatogenesis and implies the division of primary spermatogonia and their subsequent entry into meiosis. This study is aimed at the characterization of genes involved in the onset of puberty in European sea bass, and constitutes the first transcriptomic approach focused on meiosis in this species. Results: European sea bass testes collected at the onset of puberty (first successful reproduction) were grouped in stage I (resting stage), and stage II (proliferative stage). Transition from stage I to stage II was marked by an increase of 11ketotestosterone (11KT), the main fish androgen, whereas the transcriptomic study resulted in 315 genes differentially expressed between the two stages. The onset of puberty induced 1) an up-regulation of genes involved in cell proliferation, cell cycle and meiosis progression, 2) changes in genes related with reproduction and growth, and 3) a down-regulation of genes included in the retinoic acid (RA) signalling pathway. The analysis of GO-terms and biological pathways showed that cell cycle, cell division, cellular metabolic processes, and reproduction were affected, consistent with the early events that occur during the onset of puberty.
    [Show full text]
  • IL21R Expressing CD14+CD16+ Monocytes Expand in Multiple
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX IL21R expressing CD14 +CD16 + monocytes expand in multiple myeloma patients leading to increased osteoclasts Marina Bolzoni, 1 Domenica Ronchetti, 2,3 Paola Storti, 1,4 Gaetano Donofrio, 5 Valentina Marchica, 1,4 Federica Costa, 1 Luca Agnelli, 2,3 Denise Toscani, 1 Rosanna Vescovini, 1 Katia Todoerti, 6 Sabrina Bonomini, 7 Gabriella Sammarelli, 1,7 Andrea Vecchi, 8 Daniela Guasco, 1 Fabrizio Accardi, 1,7 Benedetta Dalla Palma, 1,7 Barbara Gamberi, 9 Carlo Ferrari, 8 Antonino Neri, 2,3 Franco Aversa 1,4,7 and Nicola Giuliani 1,4,7 1Myeloma Unit, Dept. of Medicine and Surgery, University of Parma; 2Dept. of Oncology and Hemato-Oncology, University of Milan; 3Hematology Unit, “Fondazione IRCCS Ca’ Granda”, Ospedale Maggiore Policlinico, Milan; 4CoreLab, University Hospital of Parma; 5Dept. of Medical-Veterinary Science, University of Parma; 6Laboratory of Pre-clinical and Translational Research, IRCCS-CROB, Referral Cancer Center of Basilicata, Rionero in Vulture; 7Hematology and BMT Center, University Hospital of Parma; 8Infectious Disease Unit, University Hospital of Parma and 9“Dip. Oncologico e Tecnologie Avanzate”, IRCCS Arcispedale Santa Maria Nuova, Reggio Emilia, Italy ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2016.153841 Received: August 5, 2016. Accepted: December 23, 2016. Pre-published: January 5, 2017. Correspondence: [email protected] SUPPLEMENTAL METHODS Immunophenotype of BM CD14+ in patients with monoclonal gammopathies. Briefly, 100 μl of total BM aspirate was incubated in the dark with anti-human HLA-DR-PE (clone L243; BD), anti-human CD14-PerCP-Cy 5.5, anti-human CD16-PE-Cy7 (clone B73.1; BD) and anti-human CD45-APC-H 7 (clone 2D1; BD) for 20 min.
    [Show full text]
  • Supplementary Table S5. Differentially Expressed Gene Lists of PD-1High CD39+ CD8 Tils According to 4-1BB Expression Compared to PD-1+ CD39- CD8 Tils
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Supplementary Table S5. Differentially expressed gene lists of PD-1high CD39+ CD8 TILs according to 4-1BB expression compared to PD-1+ CD39- CD8 TILs Up- or down- regulated genes in Up- or down- regulated genes Up- or down- regulated genes only PD-1high CD39+ CD8 TILs only in 4-1BBneg PD-1high CD39+ in 4-1BBpos PD-1high CD39+ CD8 compared to PD-1+ CD39- CD8 CD8 TILs compared to PD-1+ TILs compared to PD-1+ CD39- TILs CD39- CD8 TILs CD8 TILs IL7R KLRG1 TNFSF4 ENTPD1 DHRS3 LEF1 ITGA5 MKI67 PZP KLF3 RYR2 SIK1B ANK3 LYST PPP1R3B ETV1 ADAM28 H2AC13 CCR7 GFOD1 RASGRP2 ITGAX MAST4 RAD51AP1 MYO1E CLCF1 NEBL S1PR5 VCL MPP7 MS4A6A PHLDB1 GFPT2 TNF RPL3 SPRY4 VCAM1 B4GALT5 TIPARP TNS3 PDCD1 POLQ AKAP5 IL6ST LY9 PLXND1 PLEKHA1 NEU1 DGKH SPRY2 PLEKHG3 IKZF4 MTX3 PARK7 ATP8B4 SYT11 PTGER4 SORL1 RAB11FIP5 BRCA1 MAP4K3 NCR1 CCR4 S1PR1 PDE8A IFIT2 EPHA4 ARHGEF12 PAICS PELI2 LAT2 GPRASP1 TTN RPLP0 IL4I1 AUTS2 RPS3 CDCA3 NHS LONRF2 CDC42EP3 SLCO3A1 RRM2 ADAMTSL4 INPP5F ARHGAP31 ESCO2 ADRB2 CSF1 WDHD1 GOLIM4 CDK5RAP1 CD69 GLUL HJURP SHC4 GNLY TTC9 HELLS DPP4 IL23A PITPNC1 TOX ARHGEF9 EXO1 SLC4A4 CKAP4 CARMIL3 NHSL2 DZIP3 GINS1 FUT8 UBASH3B CDCA5 PDE7B SOGA1 CDC45 NR3C2 TRIB1 KIF14 TRAF5 LIMS1 PPP1R2C TNFRSF9 KLRC2 POLA1 CD80 ATP10D CDCA8 SETD7 IER2 PATL2 CCDC141 CD84 HSPA6 CYB561 MPHOSPH9 CLSPN KLRC1 PTMS SCML4 ZBTB10 CCL3 CA5B PIP5K1B WNT9A CCNH GEM IL18RAP GGH SARDH B3GNT7 C13orf46 SBF2 IKZF3 ZMAT1 TCF7 NECTIN1 H3C7 FOS PAG1 HECA SLC4A10 SLC35G2 PER1 P2RY1 NFKBIA WDR76 PLAUR KDM1A H1-5 TSHZ2 FAM102B HMMR GPR132 CCRL2 PARP8 A2M ST8SIA1 NUF2 IL5RA RBPMS UBE2T USP53 EEF1A1 PLAC8 LGR6 TMEM123 NEK2 SNAP47 PTGIS SH2B3 P2RY8 S100PBP PLEKHA7 CLNK CRIM1 MGAT5 YBX3 TP53INP1 DTL CFH FEZ1 MYB FRMD4B TSPAN5 STIL ITGA2 GOLGA6L10 MYBL2 AHI1 CAND2 GZMB RBPJ PELI1 HSPA1B KCNK5 GOLGA6L9 TICRR TPRG1 UBE2C AURKA Leem G, et al.
    [Show full text]
  • Research Article the Oncogenic Role of CENPA in Hepatocellular Carcinoma Development: Evidence from Bioinformatic Analysis
    Hindawi BioMed Research International Volume 2020, Article ID 3040839, 8 pages https://doi.org/10.1155/2020/3040839 Research Article The Oncogenic Role of CENPA in Hepatocellular Carcinoma Development: Evidence from Bioinformatic Analysis Yuan Zhang ,1 Lei Yang ,2 Jia Shi ,1 Yunfei Lu ,1 Xiaorong Chen ,1 and Zongguo Yang 1 1Department of Integrative Medicine, Shanghai Public Health Clinical Center, Fudan University, Shanghai 201508, China 2Department of Acupuncture and Moxibustion, Dongzhimen Hospital, Beijing University of Chinese Medicine, Beijing 100007, China Correspondence should be addressed to Xiaorong Chen; [email protected] and Zongguo Yang; [email protected] Received 27 September 2019; Revised 14 March 2020; Accepted 20 March 2020; Published 8 April 2020 Academic Editor: Ali A. Khraibi Copyright © 2020 Yuan Zhang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objective. This study is aimed at investigating the predictive value of CENPA in hepatocellular carcinoma (HCC) development. Methods. Using integrated bioinformatic analysis, we evaluated the CENPA mRNA expression in tumor and adjacent tissues and correlated it with HCC survival and clinicopathological features. A Cox regression hazard model was also performed. Results. CENPA mRNA was significantly upregulated in tumor tissues compared with that in adjacent tissues, which were validated in The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) series (all P <0:01). In the Kaplan-Meier plotter platform, the high level of CENPA mRNA was significantly correlated with overall survival (OS), disease-free survival (DFS), recurrence-free survival (RFS), and progression-free survival (PFS) in HCC patients (all log rank P <0:01).
    [Show full text]
  • 1 AGING Supplementary Table 2
    SUPPLEMENTARY TABLES Supplementary Table 1. Details of the eight domain chains of KIAA0101. Serial IDENTITY MAX IN COMP- INTERFACE ID POSITION RESOLUTION EXPERIMENT TYPE number START STOP SCORE IDENTITY LEX WITH CAVITY A 4D2G_D 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ B 4D2G_E 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ C 6EHT_D 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ D 6EHT_E 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ E 6GWS_D 41-72 41 72 100 100 3.2Å PCNA X-RAY DIFFRACTION √ F 6GWS_E 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ G 6GWS_F 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ H 6IIW_B 2-11 2 11 100 100 1.699Å UHRF1 X-RAY DIFFRACTION √ www.aging-us.com 1 AGING Supplementary Table 2. Significantly enriched gene ontology (GO) annotations (cellular components) of KIAA0101 in lung adenocarcinoma (LinkedOmics). Leading Description FDR Leading Edge Gene EdgeNum RAD51, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, CENPW, HJURP, NDC80, CDCA5, NCAPH, BUB1, ZWILCH, CENPK, KIF2C, AURKA, CENPN, TOP2A, CENPM, PLK1, ERCC6L, CDT1, CHEK1, SPAG5, CENPH, condensed 66 0 SPC24, NUP37, BLM, CENPE, BUB3, CDK2, FANCD2, CENPO, CENPF, BRCA1, DSN1, chromosome MKI67, NCAPG2, H2AFX, HMGB2, SUV39H1, CBX3, TUBG1, KNTC1, PPP1CC, SMC2, BANF1, NCAPD2, SKA2, NUP107, BRCA2, NUP85, ITGB3BP, SYCE2, TOPBP1, DMC1, SMC4, INCENP. RAD51, OIP5, CDK1, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, ESCO2, CENPW, HJURP, TTK, NDC80, CDCA5, BUB1, ZWILCH, CENPK, KIF2C, AURKA, DSCC1, CENPN, CDCA8, CENPM, PLK1, MCM6, ERCC6L, CDT1, HELLS, CHEK1, SPAG5, CENPH, PCNA, SPC24, CENPI, NUP37, FEN1, chromosomal 94 0 CENPL, BLM, KIF18A, CENPE, MCM4, BUB3, SUV39H2, MCM2, CDK2, PIF1, DNA2, region CENPO, CENPF, CHEK2, DSN1, H2AFX, MCM7, SUV39H1, MTBP, CBX3, RECQL4, KNTC1, PPP1CC, CENPP, CENPQ, PTGES3, NCAPD2, DYNLL1, SKA2, HAT1, NUP107, MCM5, MCM3, MSH2, BRCA2, NUP85, SSB, ITGB3BP, DMC1, INCENP, THOC3, XPO1, APEX1, XRCC5, KIF22, DCLRE1A, SEH1L, XRCC3, NSMCE2, RAD21.
    [Show full text]
  • Autosomal Recessive Primary Microcephaly
    Mahmood et al. Orphanet Journal of Rare Diseases 2011, 6:39 http://www.ojrd.com/content/6/1/39 REVIEW Open Access Autosomal recessive primary microcephaly (MCPH): clinical manifestations, genetic heterogeneity and mutation continuum Saqib Mahmood1, Wasim Ahmad2 and Muhammad J Hassan3* Abstract Autosomal Recessive Primary Microcephaly (MCPH) is a rare disorder of neurogenic mitosis characterized by reduced head circumference at birth with variable degree of mental retardation. In MCPH patients, brain size reduced to almost one-third of its original volume due to reduced number of generated cerebral cortical neurons during embryonic neurogensis. So far, seven genetic loci (MCPH1-7) for this condition have been mapped with seven corresponding genes (MCPH1, WDR62, CDK5RAP2, CEP152, ASPM, CENPJ, and STIL) identified from different world populations. Contribution of ASPM and WDR62 gene mutations in MCPH World wide is more than 50%. By and large, primary microcephaly patients are phenotypically indistinguishable, however, recent studies in patients with mutations in MCPH1, WDR62 and ASPM genes showed a broader clinical and/or cellular phenotype. It has been proposed that mutations in MCPH genes can cause the disease phenotype by disturbing: 1) orientation of mitotic spindles, 2) chromosome condensation mechanism during embryonic neurogenesis, 3) DNA damage- response signaling, 4) transcriptional regulations and microtubule dynamics, 5) certain unknown centrosomal mechanisms that control the number of neurons generated by neural precursor cells. Recent discoveries of mammalian models for MCPH have open up horizons for researchers to add more knowledge regarding the etiology and pathophysiology of MCPH. High incidence of MCPH in Pakistani population reflects the most probable involvement of consanguinity.
    [Show full text]