Genome-Scale Detection of Positive Selection in 9 Primates Predicts Human-Virus Evolutionary Conflicts
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
CENPT (NM 025082) Human 3' UTR Clone – SC200995 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC200995 CENPT (NM_025082) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: CENPT (NM_025082) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: CENPT Synonyms: C16orf56; CENP-T; SSMGA ACCN: NM_025082 Insert Size: 140 bp Insert Sequence: >SC200995 3’UTR clone of NM_025082 The sequence shown below is from the reference sequence of NM_025082. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC AGTGGCAACTCTGTCTTCCCTGCCCAGTAGTGGCCAGGCTTCAACACTTTCCCTGTCCCCACCTGGGGA CTCTTGCCCCCACATATTTCTCCAGGTCTCCTCCCCACCCCCCCAGCATCAATAAAGTGTCATAAACAG AA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_025082.4 Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008] Locus ID: 80152 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. -
Abolhalaj M Et Al, 2018.Pdf
www.nature.com/scientificreports OPEN Profling dendritic cell subsets in head and neck squamous cell tonsillar cancer and benign tonsils Received: 24 November 2017 Milad Abolhalaj1, David Askmyr2,3, Christina Alexandra Sakellariou1, Kristina Lundberg1, Accepted: 19 April 2018 Lennart Greif2,3 & Malin Lindstedt1 Published: xx xx xxxx Dendritic cells (DCs) have a key role in orchestrating immune responses and are considered important targets for immunotherapy against cancer. In order to develop efective cancer vaccines, detailed knowledge of the micromilieu in cancer lesions is warranted. In this study, fow cytometry and human transcriptome arrays were used to characterize subsets of DCs in head and neck squamous cell tonsillar cancer and compare them to their counterparts in benign tonsils to evaluate subset- selective biomarkers associated with tonsillar cancer. We describe, for the frst time, four subsets of DCs in tonsillar cancer: CD123+ plasmacytoid DCs (pDC), CD1c+, CD141+, and CD1c−CD141− myeloid DCs (mDC). An increased frequency of DCs and an elevated mDC/pDC ratio were shown in malignant compared to benign tonsillar tissue. The microarray data demonstrates characteristics specifc for tonsil cancer DC subsets, including expression of immunosuppressive molecules and lower expression levels of genes involved in development of efector immune responses in DCs in malignant tonsillar tissue, compared to their counterparts in benign tonsillar tissue. Finally, we present target candidates selectively expressed by diferent DC subsets in malignant tonsils and confrm expression of CD206/ MRC1 and CD207/Langerin on CD1c+ DCs at protein level. This study descibes DC characteristics in the context of head and neck cancer and add valuable steps towards future DC-based therapies against tonsillar cancer. -
Gene Knockdown of CENPA Reduces Sphere Forming Ability and Stemness of Glioblastoma Initiating Cells
Neuroepigenetics 7 (2016) 6–18 Contents lists available at ScienceDirect Neuroepigenetics journal homepage: www.elsevier.com/locate/nepig Gene knockdown of CENPA reduces sphere forming ability and stemness of glioblastoma initiating cells Jinan Behnan a,1, Zanina Grieg b,c,1, Mrinal Joel b,c, Ingunn Ramsness c, Biljana Stangeland a,b,⁎ a Department of Molecular Medicine, Institute of Basic Medical Sciences, The Medical Faculty, University of Oslo, Oslo, Norway b Norwegian Center for Stem Cell Research, Department of Immunology and Transfusion Medicine, Oslo University Hospital, Oslo, Norway c Vilhelm Magnus Laboratory for Neurosurgical Research, Institute for Surgical Research and Department of Neurosurgery, Oslo University Hospital, Oslo, Norway article info abstract Article history: CENPA is a centromere-associated variant of histone H3 implicated in numerous malignancies. However, the Received 20 May 2016 role of this protein in glioblastoma (GBM) has not been demonstrated. GBM is one of the most aggressive Received in revised form 23 July 2016 human cancers. GBM initiating cells (GICs), contained within these tumors are deemed to convey Accepted 2 August 2016 characteristics such as invasiveness and resistance to therapy. Therefore, there is a strong rationale for targeting these cells. We investigated the expression of CENPA and other centromeric proteins (CENPs) in Keywords: fi CENPA GICs, GBM and variety of other cell types and tissues. Bioinformatics analysis identi ed the gene signature: fi Centromeric proteins high_CENP(AEFNM)/low_CENP(BCTQ) whose expression correlated with signi cantly worse GBM patient Glioblastoma survival. GBM Knockdown of CENPA reduced sphere forming ability, proliferation and cell viability of GICs. We also Brain tumor detected significant reduction in the expression of stemness marker SOX2 and the proliferation marker Glioblastoma initiating cells and therapeutic Ki67. -
Location Analysis of Estrogen Receptor Target Promoters Reveals That
Location analysis of estrogen receptor ␣ target promoters reveals that FOXA1 defines a domain of the estrogen response Jose´ e Laganie` re*†, Genevie` ve Deblois*, Ce´ line Lefebvre*, Alain R. Bataille‡, Franc¸ois Robert‡, and Vincent Gigue` re*†§ *Molecular Oncology Group, Departments of Medicine and Oncology, McGill University Health Centre, Montreal, QC, Canada H3A 1A1; †Department of Biochemistry, McGill University, Montreal, QC, Canada H3G 1Y6; and ‡Laboratory of Chromatin and Genomic Expression, Institut de Recherches Cliniques de Montre´al, Montreal, QC, Canada H2W 1R7 Communicated by Ronald M. Evans, The Salk Institute for Biological Studies, La Jolla, CA, July 1, 2005 (received for review June 3, 2005) Nuclear receptors can activate diverse biological pathways within general absence of large scale functional data linking these putative a target cell in response to their cognate ligands, but how this binding sites with gene expression in specific cell types. compartmentalization is achieved at the level of gene regulation is Recently, chromatin immunoprecipitation (ChIP) has been used poorly understood. We used a genome-wide analysis of promoter in combination with promoter or genomic DNA microarrays to occupancy by the estrogen receptor ␣ (ER␣) in MCF-7 cells to identify loci recognized by transcription factors in a genome-wide investigate the molecular mechanisms underlying the action of manner in mammalian cells (20–24). This technology, termed 17-estradiol (E2) in controlling the growth of breast cancer cells. ChIP-on-chip or location analysis, can therefore be used to deter- We identified 153 promoters bound by ER␣ in the presence of E2. mine the global gene expression program that characterize the Motif-finding algorithms demonstrated that the estrogen re- action of a nuclear receptor in response to its natural ligand. -
Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia
ARTICLE DOI: 10.1038/s41467-018-05379-y OPEN Evaluation of chromatin accessibility in prefrontal cortex of individuals with schizophrenia Julien Bryois 1, Melanie E. Garrett2, Lingyun Song3, Alexias Safi3, Paola Giusti-Rodriguez 4, Graham D. Johnson 3, Annie W. Shieh13, Alfonso Buil5, John F. Fullard6, Panos Roussos 6,7,8, Pamela Sklar6, Schahram Akbarian 6, Vahram Haroutunian 6,9, Craig A. Stockmeier 10, Gregory A. Wray3,11, Kevin P. White12, Chunyu Liu13, Timothy E. Reddy 3,14, Allison Ashley-Koch2,15, Patrick F. Sullivan 1,4,16 & Gregory E. Crawford 3,17 1234567890():,; Schizophrenia genome-wide association studies have identified >150 regions of the genome associated with disease risk, yet there is little evidence that coding mutations contribute to this disorder. To explore the mechanism of non-coding regulatory elements in schizophrenia, we performed ATAC-seq on adult prefrontal cortex brain samples from 135 individuals with schizophrenia and 137 controls, and identified 118,152 ATAC-seq peaks. These accessible chromatin regions in the brain are highly enriched for schizophrenia SNP heritability. Accessible chromatin regions that overlap evolutionarily conserved regions exhibit an even higher heritability enrichment, indicating that sequence conservation can further refine functional risk variants. We identify few differences in chromatin accessibility between cases and controls, in contrast to thousands of age-related differential accessible chromatin regions. Altogether, we characterize chromatin accessibility in the human prefrontal cortex, the effect of schizophrenia and age on chromatin accessibility, and provide evidence that our dataset will allow for fine mapping of risk variants. 1 Department of Medical Epidemiology and Biostatistics, Karolinska Institutet, SE-17177 Stockholm, Sweden. -
PDF Output of CLIC (Clustering by Inferred Co-Expression)
PDF Output of CLIC (clustering by inferred co-expression) Dataset: Num of genes in input gene set: 13 Total number of genes: 16493 CLIC PDF output has three sections: 1) Overview of Co-Expression Modules (CEMs) Heatmap shows pairwise correlations between all genes in the input query gene set. Red lines shows the partition of input genes into CEMs, ordered by CEM strength. Each row shows one gene, and the brightness of squares indicates its correlations with other genes. Gene symbols are shown at left side and on the top of the heatmap. 2) Details of each CEM and its expansion CEM+ Top panel shows the posterior selection probability (dataset weights) for top GEO series datasets. Bottom panel shows the CEM genes (blue rows) as well as expanded CEM+ genes (green rows). Each column is one GEO series dataset, sorted by their posterior probability of being selected. The brightness of squares indicates the gene's correlations with CEM genes in the corresponding dataset. CEM+ includes genes that co-express with CEM genes in high-weight datasets, measured by LLR score. 3) Details of each GEO series dataset and its expression profile: Top panel shows the detailed information (e.g. title, summary) for the GEO series dataset. Bottom panel shows the background distribution and the expression profile for CEM genes in this dataset. Overview of Co-Expression Modules (CEMs) with Dataset Weighting Scale of average Pearson correlations Num of Genes in Query Geneset: 13. Num of CEMs: 1. 0.0 0.2 0.4 0.6 0.8 1.0 Cenpk Cenph Cenpp Cenpu Cenpn Cenpq Cenpl Apitd1 -
Epithelial Barrier and Dendritic Cell Function in the Intestinal Mucosa
UvA-DARE (Digital Academic Repository) Epithelial barrier and dendritic cell function in the intestinal mucosa Verstege, M.I. Publication date 2010 Link to publication Citation for published version (APA): Verstege, M. I. (2010). Epithelial barrier and dendritic cell function in the intestinal mucosa. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:27 Sep 2021 Chapter 5. Single nucleotide polymorphisms in C- type lectin genes, clustered in the IBD2 and IBD6 susceptibility loci, may play a role in the pathogenesis of inflammatory bowel diseases Simone C. Wolfkamp1,2, Marleen I. Verstege1,2, Sander Meisner2, Pieter C. Stokkers1, Anje A. te Velde2 1. Department of Gastroenterology and Hepatology, Academic Medical Centre, Amsterdam 2. Tytgat Institute for Liver and Intestinal Diseases, Academic Medical Centre, Amsterdam Chapter 5 Abstract The balance between microbes and host defence mechanisms at the mucosal frontier plays an important, yet unclarified role in the pathogenesis of inflammatory bowel disease (IBD). -
Supplementary Table S5. Differentially Expressed Gene Lists of PD-1High CD39+ CD8 Tils According to 4-1BB Expression Compared to PD-1+ CD39- CD8 Tils
BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Supplementary Table S5. Differentially expressed gene lists of PD-1high CD39+ CD8 TILs according to 4-1BB expression compared to PD-1+ CD39- CD8 TILs Up- or down- regulated genes in Up- or down- regulated genes Up- or down- regulated genes only PD-1high CD39+ CD8 TILs only in 4-1BBneg PD-1high CD39+ in 4-1BBpos PD-1high CD39+ CD8 compared to PD-1+ CD39- CD8 CD8 TILs compared to PD-1+ TILs compared to PD-1+ CD39- TILs CD39- CD8 TILs CD8 TILs IL7R KLRG1 TNFSF4 ENTPD1 DHRS3 LEF1 ITGA5 MKI67 PZP KLF3 RYR2 SIK1B ANK3 LYST PPP1R3B ETV1 ADAM28 H2AC13 CCR7 GFOD1 RASGRP2 ITGAX MAST4 RAD51AP1 MYO1E CLCF1 NEBL S1PR5 VCL MPP7 MS4A6A PHLDB1 GFPT2 TNF RPL3 SPRY4 VCAM1 B4GALT5 TIPARP TNS3 PDCD1 POLQ AKAP5 IL6ST LY9 PLXND1 PLEKHA1 NEU1 DGKH SPRY2 PLEKHG3 IKZF4 MTX3 PARK7 ATP8B4 SYT11 PTGER4 SORL1 RAB11FIP5 BRCA1 MAP4K3 NCR1 CCR4 S1PR1 PDE8A IFIT2 EPHA4 ARHGEF12 PAICS PELI2 LAT2 GPRASP1 TTN RPLP0 IL4I1 AUTS2 RPS3 CDCA3 NHS LONRF2 CDC42EP3 SLCO3A1 RRM2 ADAMTSL4 INPP5F ARHGAP31 ESCO2 ADRB2 CSF1 WDHD1 GOLIM4 CDK5RAP1 CD69 GLUL HJURP SHC4 GNLY TTC9 HELLS DPP4 IL23A PITPNC1 TOX ARHGEF9 EXO1 SLC4A4 CKAP4 CARMIL3 NHSL2 DZIP3 GINS1 FUT8 UBASH3B CDCA5 PDE7B SOGA1 CDC45 NR3C2 TRIB1 KIF14 TRAF5 LIMS1 PPP1R2C TNFRSF9 KLRC2 POLA1 CD80 ATP10D CDCA8 SETD7 IER2 PATL2 CCDC141 CD84 HSPA6 CYB561 MPHOSPH9 CLSPN KLRC1 PTMS SCML4 ZBTB10 CCL3 CA5B PIP5K1B WNT9A CCNH GEM IL18RAP GGH SARDH B3GNT7 C13orf46 SBF2 IKZF3 ZMAT1 TCF7 NECTIN1 H3C7 FOS PAG1 HECA SLC4A10 SLC35G2 PER1 P2RY1 NFKBIA WDR76 PLAUR KDM1A H1-5 TSHZ2 FAM102B HMMR GPR132 CCRL2 PARP8 A2M ST8SIA1 NUF2 IL5RA RBPMS UBE2T USP53 EEF1A1 PLAC8 LGR6 TMEM123 NEK2 SNAP47 PTGIS SH2B3 P2RY8 S100PBP PLEKHA7 CLNK CRIM1 MGAT5 YBX3 TP53INP1 DTL CFH FEZ1 MYB FRMD4B TSPAN5 STIL ITGA2 GOLGA6L10 MYBL2 AHI1 CAND2 GZMB RBPJ PELI1 HSPA1B KCNK5 GOLGA6L9 TICRR TPRG1 UBE2C AURKA Leem G, et al. -
Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
CSE642 Final Version
Eindhoven University of Technology MASTER Dimensionality reduction of gene expression data Arts, S. Award date: 2018 Link to publication Disclaimer This document contains a student thesis (bachelor's or master's), as authored by a student at Eindhoven University of Technology. Student theses are made available in the TU/e repository upon obtaining the required degree. The grade received is not published on the document as presented in the repository. The required complexity or quality of research of student theses may vary by program, and the required minimum study period may vary in duration. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain Eindhoven University of Technology MASTER THESIS Dimensionality Reduction of Gene Expression Data Author: S. (Sako) Arts Daily Supervisor: dr. V. (Vlado) Menkovski Graduation Committee: dr. V. (Vlado) Menkovski dr. D.C. (Decebal) Mocanu dr. N. (Nikolay) Yakovets May 16, 2018 v1.0 Abstract The focus of this thesis is dimensionality reduction of gene expression data. I propose and test a framework that deploys linear prediction algorithms resulting in a reduced set of selected genes relevant to a specified case. Abstract In cancer research there is a large need to automate parts of the process of diagnosis, this is mainly to reduce cost, make it faster and more accurate. -
Greg's Awesome Thesis
Analysis of alignment error and sitewise constraint in mammalian comparative genomics Gregory Jordan European Bioinformatics Institute University of Cambridge A dissertation submitted for the degree of Doctor of Philosophy November 30, 2011 To my parents, who kept us thinking and playing This dissertation is the result of my own work and includes nothing which is the out- come of work done in collaboration except where specifically indicated in the text and acknowledgements. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. November 30, 2011 Gregory Jordan ii Analysis of alignment error and sitewise constraint in mammalian comparative genomics Summary Gregory Jordan November 30, 2011 Darwin College Insight into the evolution of protein-coding genes can be gained from the use of phylogenetic codon models. Recently sequenced mammalian genomes and powerful analysis methods developed over the past decade provide the potential to globally measure the impact of natural selection on pro- tein sequences at a fine scale. The detection of positive selection in particular is of great interest, with relevance to the study of host-parasite conflicts, immune system evolution and adaptive dif- ferences between species. This thesis examines the performance of methods for detecting positive selection first with a series of simulation experiments, and then with two empirical studies in mammals and primates. -
Human Lectins, Their Carbohydrate Affinities and Where to Find Them
biomolecules Review Human Lectins, Their Carbohydrate Affinities and Where to Review HumanFind Them Lectins, Their Carbohydrate Affinities and Where to FindCláudia ThemD. Raposo 1,*, André B. Canelas 2 and M. Teresa Barros 1 1, 2 1 Cláudia D. Raposo * , Andr1 é LAQVB. Canelas‐Requimte,and Department M. Teresa of Chemistry, Barros NOVA School of Science and Technology, Universidade NOVA de Lisboa, 2829‐516 Caparica, Portugal; [email protected] 12 GlanbiaLAQV-Requimte,‐AgriChemWhey, Department Lisheen of Chemistry, Mine, Killoran, NOVA Moyne, School E41 of ScienceR622 Co. and Tipperary, Technology, Ireland; canelas‐ [email protected] NOVA de Lisboa, 2829-516 Caparica, Portugal; [email protected] 2* Correspondence:Glanbia-AgriChemWhey, [email protected]; Lisheen Mine, Tel.: Killoran, +351‐212948550 Moyne, E41 R622 Tipperary, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +351-212948550 Abstract: Lectins are a class of proteins responsible for several biological roles such as cell‐cell in‐ Abstract:teractions,Lectins signaling are pathways, a class of and proteins several responsible innate immune for several responses biological against roles pathogens. such as Since cell-cell lec‐ interactions,tins are able signalingto bind to pathways, carbohydrates, and several they can innate be a immuneviable target responses for targeted against drug pathogens. delivery Since sys‐ lectinstems. In are fact, able several to bind lectins to carbohydrates, were approved they by canFood be and a viable Drug targetAdministration for targeted for drugthat purpose. delivery systems.Information In fact, about several specific lectins carbohydrate were approved recognition by Food by andlectin Drug receptors Administration was gathered for that herein, purpose. plus Informationthe specific organs about specific where those carbohydrate lectins can recognition be found by within lectin the receptors human was body.