DOCSLIB.ORG

Mechanism of Ant1-Induced Human Diseases and Stress Signaling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mechanism of Ant1-Induced Human Diseases and Stress Signaling MECHANISM OF ANT1-INDUCED HUMAN DISEASES AND STRESS SIGNALING Item Type Dissertation Authors Liu, Yaxin Rights Attribution-NonCommercial-NoDerivatives 4.0 International Download date 09/10/2021 19:50:21 Item License http://creativecommons.org/licenses/by-nc-nd/4.0/ Link to Item http://hdl.handle.net/20.500.12648/1772 MECHANISM OF ANT1-INDUCED HUMAN DISEASES AND STRESS SIGNALING Yaxin Liu A Dissertation in Department of Biochemistry and Molecular Biology Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Graduate Studies of State University of New York, Upstate Medical University. Approved Date Abstract Mechanism of Ant1-induced Human Diseases and Stress Signaling Yaxin Liu Xin Jie Chen Adenine nucleotide translocase (Ant) is a mitochondrial inner membrane protein, the primary function of which is to mediate the ADP/ATP exchange across the inner membrane. Missense mutations in Ant1, the skeletal muscle- and heart-specific isoform, induce human disorders including autosomal dominant Progressive External Opthalmoplegia (adPEO), cardiomyopathy and myopathy. Several models were proposed to interpret the pathogenesis of mutant Ant1-induced diseases, but no consensus has been reached. Our lab has previously found that mutant Aac2, the homolog of Ant1 in yeast, causes cell death due to the mitochondrial biogenesis defect. In the present study, we provided biochemical evidence supporting the idea that the mutant Aac2 proteins are misfolded, which derails the proteostasis on the inner membrane. We found that the assembly and stability of multiple protein complexes on the inner membrane are affected, including those involved in mitochondrial respiration and protein transport. In human cells, the mutant Ant1 proteins have reduced steady-state levels and increased degradation, consistent with misfolding and increased susceptibility to protein quality control machineries. In the second part of the work, we sought to identify the cellular signaling pathways that respond to Ant1-induced proteostatic stress on the mitochondrial inner membrane. We generated ANT1 alleles that have enhanced toxicity and are able to induce i proteostatic stress on the inner membrane in human. Although these mutant Ant1 proteins only mildly affect mitochondrial respiration, they trigger robust transcriptional responses in the nucleus to remodel cellular signaling. The upregulation of the cytosolic chaperone/ubiquitin-proteasome systems, and the downregulation of mTOR signaling may serve as adaptive responses to mitigate mitochondrial Precursor Over-Accumulation Stress (mPOS), a novel pathway of cell death recently discovered in yeast. We also found that human cells respond to mitochondrial inner membrane stress by increasing Egr1 signaling and the alternative splicing of many genes important for cell survival/death control. In summary, the data suggested that protein misfolding causes Ant1-induced pathogenesis in human diseases. Our study provided support for mitochondria-induced proteostatic stress in the cytosol (or mPOS) in human cells. We also identified several novel mitochondria-to-nucleus signaling pathways, which may help in developing therapeutic interventions for the treatment of mitochondria-induced pathologies. ii Abbreviation ADP adenosine 5'-diphosphate °C degree Celsius µg microgram µL microliter µM micromolar A or Ala alanine AAA ATPase associated with diverse cellular activities Aac ADP/ATP carrier adPEO autosomal dominant progressive external opthalmoplegia ANOVA analysis of variance Ant adenine nucleotide translocase ATP adenosine 5'-triphosphate BN-PAGE blue native polyacrylamide gel electrophoresis bp base pair D or Asp aspartic acid DDM n-dodecyl β-D-maltoside DNA deoxyribonucleic acid EDTA ethylenediaminetetraacetic acid ER endoplasmic reticulum ETC electron transport chain FCCP carbonyl cyanide p-trifluoromethoxyphenylhydrazone FDR false discovery rate iii g gram HA hemagglutinin HCl hydrochloric acid HEPES N-2-hydroxyethylpiperazine-N'-2-ethanesulfonate IMS intermembrane space kb kilobase pair KCl potassium chloride kDa kilo Dalton L or Leu leucine Li-Ac lithium acetate M molar M or Met methionine MDa mega Dalton MgCl2 magnesium chloride MIM mitochondrial inner membrane min minute mL milliliter mM millimolar mol mole MOM mitochondrial outer membrane mPOS mitochondrial precursor over-accumulation stress mRNA messenger RNA mtDNA mitochondrial DNA iv NaCl sodium chloride ng nanogram OCR oxygen consumption rate Oligo oligomycin OXPHOS oxidative phosphorylation P or Pro proline PBS phosphate buffer solution PCR polymerase chain reaction R or Arg arginine RIPA radioimmunoprecipitation assay RNA ribonucleic acid RNA-seq RNA sequencing ROS reactive oxygen species Rot/AA rotenone/antimycin A SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis TIM translocase of the inner membrane TOM translocase of the outer membrane Tris tris(hydroxymethyl)aminomethane UPRmt mitochondrial unfolded protein response V volts V or Val valine w/v weight/volume ratio v WT wild-type YPD yeast extract/peptone/dextrose medium Δψ mitochondrial membrane potential vi Table of Contents Abstract ............................................................................................................................... i Abbreviation ..................................................................................................................... iii Chapter 1 General introduction .......................................................................................1 1.1 Structure of mitochondria ..............................................................................................1 1.1.1 Mitochondrial ultrastructure ....................................................................................2 1.1.2 Mitochondrial networks ..........................................................................................4 1.1.3 Mitochondrial genome ............................................................................................7 1.2 Biogenesis of mitochondrial proteins .........................................................................10 1.2.1 Mitochondrial proteome ........................................................................................10 1.2.2 Mitochondrial protein import ................................................................................12 1.3 Functions of mitochondria ...........................................................................................18 1.3.1 Mitochondria and oxidative phosphorylation .......................................................18 1.3.2 Mitochondria and thermogenesis ..........................................................................21 1.3.3 Mitochondria and Ca2+ homeostasis......................................................................22 1.3.4 Mitochondria and programmed cell death ............................................................24 1.4 Mitochondrial protein quality control and UPRmt........................................................26 1.4.1 Overview of mitochondrial protein quality control ...............................................26 1.4.2 Classification of human mitoproteases .................................................................27 1.4.3 Mitoproteases and protein quantity control ...........................................................29 1.4.4 Mitochondrial unfolded protein response (UPRmt) ...............................................33 1.5 Mitochondrial carrier proteins .....................................................................................38 1.5.1 Overview of SLC25 family proteins .....................................................................38 1.5.2 Adenine nucleotide translocase (Ant) ...................................................................39 Structure and function of Ant ................................................................................39 vii Altered Ant expression and human diseases .........................................................44 Dominant mutations in Ant1 and human diseases ................................................47 1.6 Research objectives ......................................................................................................53 Chapter 2 Misfolding of mutant adenine nucleotide translocase in yeast supports a novel mechanism of Ant1-induced muscle diseases ......................................................55 2.1 Abstract ........................................................................................................................56 2.2 Introduction ..................................................................................................................56 2.3 Results ..........................................................................................................................60 2.3.1 Mutant Aac2 proteins affect protein quality control on the mitochondrial inner membrane .......................................................................................................................60 2.3.2 Aac2 variants with the adPEO-type mutations are prone to aggregation .............62 2.3.3 The mutant Aac2 proteins affect the assembly and stability of multiple protein complexes on the inner membrane .................................................................................66 2.3.4 The i-AAA protease Yme1 plays a critical role in the quality control of misfolded Aac2 ...............................................................................................................................70
Load more

Recommended publications
  • CENPT (NM 025082) Human 3' UTR Clone – SC200995 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC200995 CENPT (NM_025082) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: CENPT (NM_025082) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: CENPT Synonyms: C16orf56; CENP-T; SSMGA ACCN: NM_025082 Insert Size: 140 bp Insert Sequence: >SC200995 3’UTR clone of NM_025082 The sequence shown below is from the reference sequence of NM_025082. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC AGTGGCAACTCTGTCTTCCCTGCCCAGTAGTGGCCAGGCTTCAACACTTTCCCTGTCCCCACCTGGGGA CTCTTGCCCCCACATATTTCTCCAGGTCTCCTCCCCACCCCCCCAGCATCAATAAAGTGTCATAAACAG AA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_025082.4 Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008] Locus ID: 80152 This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
    F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome.
    [Show full text]
  • Gene Knockdown of CENPA Reduces Sphere Forming Ability and Stemness of Glioblastoma Initiating Cells
    Neuroepigenetics 7 (2016) 6–18 Contents lists available at ScienceDirect Neuroepigenetics journal homepage: www.elsevier.com/locate/nepig Gene knockdown of CENPA reduces sphere forming ability and stemness of glioblastoma initiating cells Jinan Behnan a,1, Zanina Grieg b,c,1, Mrinal Joel b,c, Ingunn Ramsness c, Biljana Stangeland a,b,⁎ a Department of Molecular Medicine, Institute of Basic Medical Sciences, The Medical Faculty, University of Oslo, Oslo, Norway b Norwegian Center for Stem Cell Research, Department of Immunology and Transfusion Medicine, Oslo University Hospital, Oslo, Norway c Vilhelm Magnus Laboratory for Neurosurgical Research, Institute for Surgical Research and Department of Neurosurgery, Oslo University Hospital, Oslo, Norway article info abstract Article history: CENPA is a centromere-associated variant of histone H3 implicated in numerous malignancies. However, the Received 20 May 2016 role of this protein in glioblastoma (GBM) has not been demonstrated. GBM is one of the most aggressive Received in revised form 23 July 2016 human cancers. GBM initiating cells (GICs), contained within these tumors are deemed to convey Accepted 2 August 2016 characteristics such as invasiveness and resistance to therapy. Therefore, there is a strong rationale for targeting these cells. We investigated the expression of CENPA and other centromeric proteins (CENPs) in Keywords: fi CENPA GICs, GBM and variety of other cell types and tissues. Bioinformatics analysis identi ed the gene signature: fi Centromeric proteins high_CENP(AEFNM)/low_CENP(BCTQ) whose expression correlated with signi cantly worse GBM patient Glioblastoma survival. GBM Knockdown of CENPA reduced sphere forming ability, proliferation and cell viability of GICs. We also Brain tumor detected significant reduction in the expression of stemness marker SOX2 and the proliferation marker Glioblastoma initiating cells and therapeutic Ki67.
    [Show full text]
  • University of Groningen the Human HSP70/HSP40 Chaperone Family
    University of Groningen The human HSP70/HSP40 chaperone family Hageman, Jurre IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2008 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Hageman, J. (2008). The human HSP70/HSP40 chaperone family: a study on its capacity to combat proteotoxic stress. s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment. Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 30-09-2021 CHAPTER 1 Introduction - Structural and functional diversities between members of the human HSPH, HSPA and DNAJ chaperone families Jurre Hageman and Harm H.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Screening of a Clinically and Biochemically Diagnosed SOD Patient Using Exome Sequencing: a Case Report with a Mutations/Variations Analysis Approach
    The Egyptian Journal of Medical Human Genetics (2016) 17, 131–136 HOSTED BY Ain Shams University The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net www.sciencedirect.com CASE REPORT Screening of a clinically and biochemically diagnosed SOD patient using exome sequencing: A case report with a mutations/variations analysis approach Mohamad-Reza Aghanoori a,b,1, Ghazaleh Mohammadzadeh Shahriary c,2, Mahdi Safarpour d,3, Ahmad Ebrahimi d,* a Department of Medical Genetics, Shiraz University of Medical Sciences, Shiraz, Iran b Research and Development Division, RoyaBioGene Co., Tehran, Iran c Department of Genetics, Shahid Chamran University of Ahvaz, Ahvaz, Iran d Cellular and Molecular Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran Received 12 May 2015; accepted 15 June 2015 Available online 22 July 2015 KEYWORDS Abstract Background: Sulfite oxidase deficiency (SOD) is a rare neurometabolic inherited disor- Sulfite oxidase deficiency; der causing severe delay in developmental stages and premature death. The disease follows an auto- Case report; somal recessive pattern of inheritance and causes deficiency in the activity of sulfite oxidase, an Exome sequencing enzyme that normally catalyzes conversion of sulfite to sulfate. Aim of the study: SOD is an underdiagnosed disorder and its diagnosis can be difficult in young infants as early clinical features and neuroimaging changes may imitate some common diseases. Since the prognosis of the disease is poor, using exome sequencing as a powerful and efficient strat- egy for identifying the genes underlying rare mendelian disorders can provide important knowledge about early diagnosis, disease mechanisms, biological pathways, and potential therapeutic targets.
    [Show full text]
  • ABSTRACT MITCHELL III, ROBERT DRAKE. Global Human Health
    ABSTRACT MITCHELL III, ROBERT DRAKE. Global Human Health Risks for Arthropod Repellents or Insecticides and Alternative Control Strategies. (Under the direction of Dr. R. Michael Roe). Protein-coding genes and environmental chemicals. New paradigms for human health risk assessment of environmental chemicals emphasize the use of molecular methods and human-derived cell lines. In this study, we examined the effects of the insect repellent DEET (N, N-diethyl-m-toluamide) and the phenylpyrazole insecticide fipronil (fluocyanobenpyrazole) on transcript levels in primary human hepatocytes. These chemicals were tested individually and as a mixture. RNA-Seq showed that 100 µM DEET significantly increased transcript levels for 108 genes and lowered transcript levels for 64 genes and fipronil at 10 µM increased the levels of 2,246 transcripts and decreased the levels for 1,428 transcripts. Fipronil was 21-times more effective than DEET in eliciting changes, even though the treatment concentration was 10-fold lower for fipronil versus DEET. The mixture of DEET and fipronil produced a more than additive effect (levels increased for 3,017 transcripts and decreased for 2,087 transcripts). The transcripts affected in our treatments influenced various biological pathways and processes important to normal cellular functions. Long non-protein coding RNAs and environmental chemicals. While the synthesis and use of new chemical compounds is at an all-time high, the study of their potential impact on human health is quickly falling behind. We chose to examine the effects of two common environmental chemicals, the insect repellent DEET and the insecticide fipronil, on transcript levels of long non-protein coding RNAs (lncRNAs) in primary human hepatocytes.
    [Show full text]
  • Browsing Genes and Genomes with Ensembl
    The Bioinformatics Roadshow Tórshavn, The Faroe Islands 28-29 November 2012 BROWSING GENES AND GENOMES WITH ENSEMBL EXERCISES AND ANSWERS 1 BROWSER 3 BIOMART 8 VARIATION 13 COMPARATIVE GENOMICS 18 2 Note: These exercises are based on Ensembl version 69 (October 2012). After in future a new version has gone live, version 69 will still be available at http://e69.ensembl.org/. If your answer doesn’t correspond with the given answer, please consult the instructor. ______________________________________________________________ BROWSER ______________________________________________________________ Exercise 1 – Exploring a gene (a) Find the human F9 (coagulation factor IX) gene. On which chromosome and which strand of the genome is this gene located? How many transcripts (splice variants) have been annotated for it? (b) What is the longest transcript? How long is the protein it encodes? Has this transcript been annotated automatically (by Ensembl) or manually (by Havana)? How many exons does it have? Are any of the exons completely or partially untranslated? (c) Have a look at the external references for ENST00000218099. What is the function of F9? (d) Is it possible to monitor expression of ENST00000218099 with the ILLUMINA HumanWG_6_V2 microarray? If so, can it also be used to monitor expression of the other two transcripts? (e) In which part (i.e. the N-terminal or C-terminal half) of the protein encoded by ENST00000218099 does its peptidase activity reside? (f) Have any missense variants been discovered for the protein encoded by ENST00000218099? (g) Is there a mouse orthologue predicted for the human F9 gene? (h) If you have yourself a gene of interest, explore what information Ensembl displays about it! ______________________________________________________________ Answer (a) 8 Go to the Ensembl homepage (http://www.ensembl.org/).
    [Show full text]
  • Meta-Analyses of Expression Profiling Data in the Postmortem
    META-ANALYSES OF EXPRESSION PROFILING DATA IN THE POSTMORTEM HUMAN BRAIN by Meeta Mistry B.Sc., McMaster University, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Bioinformatics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2012 © Meeta Mistry, 2012 Abstract Schizophrenia is a severe psychiatric illness for which the precise etiology remains unknown. Studies using postmortem human brain have become increasingly important in schizophrenia research, providing an opportunity to directly investigate the diseased brain tissue. Gene expression profiling technologies have been used by a number of groups to explore the postmortem human brain and seek genes which show changes in expression correlated with schizophrenia. While this has been a valuable means of generating hypotheses, there is a general lack of consensus in the findings across studies. Expression profiling of postmortem human brain tissue is difficult due to the effect of various factors that can confound the data. The first aim of this thesis was to use control postmortem human cortex for identification of expression changes associated with several factors, specifically: age, sex, brain pH and postmortem interval. I conducted a meta-analysis across the control arm of eleven microarray datasets (representing over 400 subjects), and identified a signature of genes associated with each factor. These genes provide critical information towards the identification of problematic genes when investigating postmortem human brain in schizophrenia and other neuropsychiatric illnesses. The second aim of this thesis was to evaluate gene expression patterns in the prefrontal cortex associated with schizophrenia by exploring two methods of analysis: differential expression and coexpression.
    [Show full text]
  • The Role of Translocator Protein TSPO in Hallmarks of Glioblastoma
    cancers Review The Role of Translocator Protein TSPO in Hallmarks of Glioblastoma Laura-Marie Ammer 1, Arabel Vollmann-Zwerenz 1, Viktoria Ruf 2, Christian H. Wetzel 3 , Markus J. Riemenschneider 4, Nathalie L. Albert 5, Philipp Beckhove 6 and Peter Hau 1,* 1 Wilhelm Sander-NeuroOncology Unit and Department of Neurology, University Hospital Regensburg, 93053 Regensburg, Germany; [email protected] (L.-M.A.); [email protected] (A.V.-Z.) 2 Center for Neuropathology and Prion Research, Ludwig Maximilians University of Munich, 81377 Munich, Germany; [email protected] 3 Molecular Neurosciences, Department of Psychiatry and Psychotherapy, University of Regensburg, 93053 Regensburg, Germany; [email protected] 4 Department of Neuropathology, Regensburg University Hospital, 93053 Regensburg, Germany; [email protected] 5 Department of Nuclear Medicine, Ludwig-Maximilians-University Munich, 81377 Munich, Germany; [email protected] 6 Regensburg Center for Interventional Immunology (RCI) and Department Internal Medicine III, University Hospital Regensburg, 93053 Regensburg, Germany; [email protected] * Correspondence: [email protected] Received: 14 September 2020; Accepted: 9 October 2020; Published: 14 October 2020 Simple Summary: The translocator protein (TSPO) has been under extensive investigation as a specific marker in positron emission tomography (PET) to visualize brain lesions following injury or disease. In recent years, TSPO is increasingly appreciated as a potential novel therapeutic target in cancer. In Glioblastoma (GBM), the most malignant primary brain tumor, TSPO expression levels are strongly elevated and scientific evidence accumulates, hinting at a pivotal role of TSPO in tumorigenesis and glioma progression. The aim of this review is to summarize the current literature on TSPO with respect to its role both in diagnostics and especially with regard to the critical hallmarks of cancer postulated by Hanahan and Weinberg.
    [Show full text]
  • (TSPO) in Mitochondrial Bioenergetics and Immune Processes
    cells Review The Translocator Protein (TSPO) in Mitochondrial Bioenergetics and Immune Processes Calina Betlazar 1,2,* , Ryan J. Middleton 1 , Richard Banati 1,2 and Guo-Jun Liu 1,2,* 1 Human Health, Australian Nuclear Science and Technology Organisation, New Illawarra Road, Lucas Heights, NSW 2234, Australia; [email protected] (R.J.M.); [email protected] (R.B.) 2 Discipline of Medical Imaging & Radiation Sciences, Faculty of Medicine and Health, Brain and Mind Centre, University of Sydney, 94 Mallett Street, Camperdown, NSW 2050, Australia * Correspondence: [email protected] (C.B.); [email protected] (G-J.L.) Received: 11 January 2020; Accepted: 19 February 2020; Published: 24 February 2020 Abstract: The translocator protein (TSPO) is an outer mitochondrial membrane protein that is widely used as a biomarker of neuroinflammation, being markedly upregulated in activated microglia in a range of brain pathologies. Despite its extensive use as a target in molecular imaging studies, the exact cellular functions of this protein remain in question. The long-held view that TSPO plays a fundamental role in the translocation of cholesterol through the mitochondrial membranes, and thus, steroidogenesis, has been disputed by several groups with the advent of TSPO knockout mouse models. Instead, much evidence is emerging that TSPO plays a fundamental role in cellular bioenergetics and associated mitochondrial functions, also part of a greater role in the innate immune processes of microglia. In this review, we examine the more direct experimental literature surrounding the immunomodulatory effects of TSPO. We also review studies which highlight a more central role for TSPO in mitochondrial processes, from energy metabolism, to the propagation of inflammatory responses through reactive oxygen species (ROS) modulation.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]