sign in sign up
<<
Home , Awamori

Philippine Journal of Science 147 (2): 261-273, June 2018 ISSN 0031 - 7683 Date Received: 28 June 2017

Determination of the cDNA Sequence and In Silico Functional Analysis of a Glucoamylase Gene From Saccharomycopsis fibuligera 2074

Dan Exerlin E. Bonete, Joel Hassan G. Tolentino, and Annabelle U. Novero*

College of Science and Mathematics, University of the Philippines Mindanao, Mintal, Tugbok District, Davao City 8022 Philippines

Saccharomycopsis fibuligera 2074 is a yeast strain used in producing , a traditional Philippine mix. A glucoamylase gene from this yeast was isolated and characterized in this study. Using primers designed via the primer walking method, the synthesized Sf 2074 cDNA (GenBank: KP068008.1) was found to contain 1531 bp and was homologous to glucoamylases deposited in the databases. Using bioinformatic tools, the predicted protein was found to possess 512 amino acids and a molecular weight of 56715.92. The conserved amino acid sequence Ala- Tyr-Thr-Gly similar to other amylases was located. The glucoamylase belongs to a superfamily of Glycoside Hydrolase 15 (GH 15), which are six-hairpin glycosidases with alpha/alpha toroid fold. This is the first report of a glucoamylase gene from S. fibuligera in the Philippines. Bioethanol cost of production could be markedly reduced if this amylolytic gene can be cloned in the brewer’s yeast Saccharomyces cerevisieae.

Keywords: glucoamylase, in silico characterization, primer walking, protein structure, Saccharomycopsis fibuligera, yeast

INTRODUCTION polymers of glucose (Wong & Robertson 2002; Galdino et al. 2010). These enzymes are of great biotechnological Ethanol is the most widely used liquid biofuel. The demand interest with applications in the food industry and for ethanol is expected to rise to over 125 billion liters in production of biofuels. 2017 (FAO 2008). It is fermented from sugars, starches, or from cellulosic biomass. Production of ethanol from There are three types of amylases: alpha-amylases, starch is one way to reduce consumption of crude oil as glucoamylases, and beta-amylases. These amylolytic well as environmental pollution. In view of continuously enzymes have similar function i.e., catalysis of hydrolysis rising petroleum costs and dependence upon fossil fuel of alpha-glucosidic bonds in starch and related saccharides, resources, considerable attention has been focused on although they are quite different in terms of some alternative energy resources. Production of ethanol from structural and functional points of view (Horváthová et al. biomass is one way to reduce both the consumption of crude 2001). α-Amylase (E.C.3.2.1.1) catalyzes the hydrolysis oil and environmental pollution (DiPardo 2000; Bothast & of internal α-1,4-glycosidic linkages in starch create Schlicher 2005; Dufey 2006; Schafer et al. 2007). products like glucose and maltose (Sundarram & Murthy 2014). Because it is a calcium metalloenzyme, it is only Amylases are enzymes that hydrolyze starch polymers active in the presence of the cofactor. Endo-hydrolase and yielding diverse products, including dextrins and smaller exo-hydrolase are two types of hydrolases (Gupta et al. *Corresponding author: [email protected] 2003). As the term implies, the endohyrolase acts inside the substrate whereas the exohydrolase targets the terminal

261 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

end of a molecule. The substrate of α-amylase is starch, based on their substrate specificity and sometimes, on which is composed of amylose and amylopectin polymers. their molecular mechanism. α-Amylases, β-amylases, Starch is about 20-25% amylose and 75-80% amylopectin. and glucoamylases were found in the families 13, 14, and Amylose is a chain of repetitive glucose units in linear 15, respectively. Both β-amylases and glucoamylases are form linked by α-1,4-glycosidic linkage. Amylopectin – found in the only one sequence-based family – family 14 the linear successive glucose units – are also joined by and family 15, respectively (Henrissat & Bairoch 1993). α-1,4-glycosidic linkage, but there is branching every α-Amylases, aside from acting as hydrolases, also act 15-45 glucose units bound by α-1,6 glycosidic bonds. as transferases and isomerases from classes 2 and 5, The amount of hydrolysate produced after hydrolysis will respectively (Horváthová et al. 2000). depend on the efficiency of α-amylase, which is dependent on critical factors such as temperature and pH (de Souza Generally, α-amylases hydrolyze α-1,4-glycosidic & Magalhaes 2010). linkages, randomly yielding dextrins, oligosaccharides, and monosaccharides. α-Amylases are endoamylases. β-Amylase (EC 3.2.1.2), an exoamylase, hydrolyzes α-1,4- Exoamylases hydrolyze the α-1,4-glycosidic linkage only glycosidic linkages of polyglucan chains at the non- from the non-reducing outer polysaccharide chain ends. reducing end. This reaction ensues to produce maltose Exoamylases include β-amylases and glucoamylases (4-O-α-d-Glucopyranosyl-β-d-Glc; Kossman & Lloyd (γ-amylases, amyloglucosidases) (Wind 1997). 2000). It has been reported that β-amylase has a significant role in transitory starch breakdown (Scheidig et al. 2002; While α-amylase is an α-retaining enzyme, both β-amylase Kaplan & Guy 2004; Wu et al. 2014). The accumulation and glucoamylase use the α-inverting reaction mechanism. of maltose may aid in the stabilization of the chloroplast Structurally, alpha and beta amylases (β/α) eight-barrel stroma during acute temperature stress (Kaplan & Guy enzymes (TIM-barrels) consist of eight parallel β- strands 2004). forming the inner β-barrel, which is surrounded by the outer cylinder composed of eight α-helices so that the Glucoamylase (α-1,4-glucan glucohydrolase, individual β-strands and α-helices alternate and are amyloglucosidase, EC 3.2.1.3) is invaluable in the connected by loops. Glucoamylases, on the other hand, food industry. It is used in saccharification of starch adopts a helical (α/α) six-barrel fold, which consists of six an in fermentation processes (Pavezzi et al. 2008). In mutually parallel α-helices forming an inner core (helical the glucoamylolytic process, glucose is produced from barrel mimicking the inner β-barrel of α-amylase and the hydrolysis of α-1,4 glycosidic bonds from the non- β-amylase), which is covered by a peripheral set of six reducing ends of the starch molecules (Mertens & Skory further α-helices (Aleshin et al. 1992; Sevcík et al. 1998). 2006). In the retaining mechanism – exhibited by α-amylases involving the formation and hydrolysis of a covalent Carbohydrate-binding molecules (CBM) are molecules glycosyl-enzyme intermediate – the roles of the two that bring polysaccharides closer to a biocatalyst. Though active-site carboxylic acid residues are somewhat different CBM is non-catalytic, its role in carbohydrate recognition in comparison with the inverting mechanism. One (playing is vital to carbohydrate-catalyst interactions (Guillen et al. the role of the nucleophile) attacks at the sugar anomeric 2010). CBMs may be located either at the N- or C- terminal, centre to form the glycosyl-enzyme species, while or middle portion of a polypeptide chain (Shoseyov et al. the other acts as an acid/base catalyst, protonating the 2006). Enzymes with CBM are structurally similar and glycosidic oxygen in the first step (general-acid catalysis) share a common catalytic domain (Guillen et al. 2010). and deprotonating the water in the second step (general- There are 81 different CBM families listed in the CAZy base catalysis) (Ly & Withers 1999). (Carbohydrate Active Enzyme) database (http://www. cazy.org/Carbohydrate-Binding-Modules.html). These are The glucoamylase catalytic reaction utilizes the inversion based on their amino acid sequences, substrate binding mechanism. It uses a direct displacement mechanism, specificities, location in protein, and structures. According while the catalysis by retaining glycosidases proceeds to Barchiesi and co-authors (2015), starch-binding domain via a two-step double displacement mechanism. In the (SBD) sequences that evolved to have the capability of inverting mechanism, the two active-site carboxylic acid disrupting their substrate’s surface can be highlighted. residues are suitably oriented so that one assists as a general base to the attack of water, while the other serves Glycoside hydrolases (EC 3.2.1.-) are enzymes that as a general acid to cleavage of the glycosidic bond. This hydrolyze glycosidic bond between two or more is also employed by beta-amylases (McCarter & Withers carbohydrates. It can also hydrolyze glycosidic bond 1994; Sinnott 1990; Konstantinidis & Sinnott 1991; between a carbohydrate and a non-carbohydrate moiety Tanaka et al. 1994). (CAZy 2017). There are 145 GH family members in CAZy (http://www.cazy.org/Glycoside-Hydrolases.html) Amylases capable of digesting raw starch are collectively

262 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

called as raw starch-digesting amylases (RSDA). A molecular genetics approach has been chosen to find There is a wide array of RSDA sources. Many fungal structural differences between two related glucoamylases, species are capable of producing this kind of enzyme, raw-starch-degrading Glm, and non-degrading Glu from specifically glucoamylase under different fermentation the yeasts Saccharomycopsis fibuligera IFO 0111 and conditions and techniques (Norouzian et al. 2005). HUT 7212, respectively (Hostinová 2002). Results The various fungal genera synthesizing RSDAs that suggest that Glm, although possessing a good ability for are active at higher temperatures include Aspergillus, raw starch degradation, did not show consensus amino Mucor, Neurospora, Rhizopus (Pandey et al. 2000), acid residues to any SBD found in glucoamylases or other and Arthrobotrys (Jaffar et al. 1993; Norouzian & amylolytic enzymes. Raw starch binding and digestion by Jaffar 1993). However, the industrial focus has been Glm must thus depend on the existence of a site(s) lying on RSDA from Aspergillus niger and Rhizopus oryzae. within the intact protein, which lacks a separate SBD The employment of glucoamylase from these sources (Hostinová 2002). Horváthová and co-authors (2004) in the starch processing industries is due to their good tested the raw starch-digesting ability of Glm on corn thermostability and high activity at near neutral pH values starch and found out that the optimum concentration of (Frandsen et al. 1999; Reilly 1999). Fungi belonging to the glucoamylase was 33-75 U∙g-1 of starch. genus Aspergillus have been most commonly employed Fungal strains belonging to Rhizopus (Fogarty & Kelly for the production of α-amylase (Vihinen & Mantasala 1980) and Volvariella volvacea (Olaniyi et al. 2010) 1989). Among bacterial sources, Bacillus sp. is widely have been reported to synthesize β-amylase. Pullulanase used for thermostable α-amylase production to meet appeared to positively stimulate hydrolytic activity of industrial needs. Bacillus subtilis, B. stearothermophilus, β-amylase from Bacillus polymyxa on raw corn starch B. licheniformis, and B. amyloliquefaciens are known to (Sohn et al. 1996). Also, B. polymyxa No 26-1 has the be good producers of α-amylase, and these have been ability to digest raw starch from its β-amylase (Ueda & widely used for commercial production of the enzyme Marshall 1980; Sohn et al. 1996). Bacillus cereus has for various applications (Vihinen & Mantasala 1989; also been found to have a β-amylase capable of raw Pandey et al. 2000). starch digestion. It has been determined that this ability Matsubara and co-workers (2004) cloned cDNA fragment is associated with the C-terminal starch binding domain that encodes an α-amylase (Amyl III) with raw starch- and additional maltose binding sites (Mikami et al. 1999). digesting activity from Aspergillus awamori KT-11. Jabbour and co-authors (2012) was able to isolate an In addition, the cDNA fragments encoding for typical alpha-amylase from a pilot-plant biogas reactor operating α-amylase (Amyl I) – which is unable to digest raw starch at 55°C. The library was screened for starch-degrading – and glucoamylase (GA I) were also cloned from the enzymes, and one active clone was found. An open same strain. A heat-stable raw-starch-digesting amylase reading frame of 1,461 bp encoding an α-amylase from (RSDA) from Cytophaga sp. was generated through PCR- an uncultured organism was identified. The Amy13A gene based site-directed mutagenesis. At 65°C, the half-life of was cloned in Escherichia coli, resulting in high-level this mutant RSDA which, compared with the wild-type expression of the recombinant amylase. Amy13A is one of RSDA, lacks amino acids R178 and G179, was increased the few enzymes that tolerate high concentrations of salt 20-fold. While the wild type was inactivated completely and elevated temperatures, making it a potential candidate at pH 3.0, the mutant RSDA still retained 41% of its for starch processing under extreme conditions. enzymatic activity (Shiau et al. 2003). From our institution, Fronteras and Bullo (2017) The α-amylase AMY-CS2 capable of raw starch digestion reported amylolytic activity from Saccharomycopsis from Cryptococcus sp. S-2 was found to have 611 amino fibuligera 2074 (Sf 2074) of a fungal isolate from bubod, acids, including a putative signal peptide of 20 amino a Philippine starter mix. The isolate preferred acids, of its ORF of the cDNA (Iefuji et al. 1996). The raw sago starch as substrate over the gelatinized one amylase has similar N-terminal and C-terminal domains based on their enzymatic activity. Sf 2074 registered as that of the Taka-amylase of and its maximum amylase production from a 36-h culture glucoamylase G1 of A. niger. The C-terminal domain when 1% sago starch was used as carbon source. This of this enzyme has been reported to show the ability to isolate was the source of glucoamylase gene reported in digest raw starch and cause thermostability. A mutation this study. Glucoamylases from this species belong to lacking this domain loses its raw starch digestion and Glycoside Hydrolase 15 family. Most of the currently thermostability. Also, Goyal and co-authors (2005) characterized family members have a two-domain obtained RSDA from Bacillus sp. I-3. The obtained structure, the small domain playing the role of binding enzyme had an optimum temperature of 70°C using potato the enzyme to starch, allowing the larger catalytic starch as substrate. doamin to hydrolyze the starch substance (Sevcík et al.

263 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

2006). GH 15 family comprises enzymes with several Table 1. Primers designed for the amplification of glucoamylase known activities: glucoamylase (EC 3.2.1.3); alpha- gene from S. fibuligera. glucosidase (EC 3.2.1.20); and glucodextranase Primer Length (EC 3.2.1.70) (CAZY database; Henrissat 1991). Sequence (5’ – 3’) T (°C) designation (bases) m This study elucidated the putative function of Sf 2074 P1-F ATTGCTTATCGTGAAGGCCA 20 44.6 cDNA. This is an initial step towards its functional P1-R AGCCAAAGCCTTGACCTTAT 20 44.6 characterization and eventual cloning and expression in PA-F TTCCGTCTTTGCTCGTATTGT 21 45.3 Saccharomyces cerevisiae for the conversion of raw starch into bioethanol using a single microorganism. PB-R TGTAGTACTCAACTGCCTTGT 21 47.3 PC-R TGCCTTGGTTTTCCTCCCAA 20 46.7 PD-F TTTTGACGACGGCGACTTTG 20 46.7 PE-F TGGTCACATTCGGTGATTCC 20 46.7 MATERIALS AND METHODS

Sample Preparation A pure strain of Saccharomycopsis (Endomycopsis) ac.uk/Tools/msa/clustalo/; Sievers et al. 2011; McWilliam fibuligera [Accession Number: 2074] was obtained from et al. 2013). the Philippine National Collection of Microorganisms, University of the Philippines, Los Banos, Laguna. The First Strand cDNA Synthesis cells were grown in Yeast Extract-Malt-Peptone-Starch For synthesis and amplification of cDNA, the following (YMPS) medium. A loopful of yeast was inoculated into were prepared: 1 µL of 10 mM of dNTP mix, 1 µL of the 100 mL YMPS Broth in 250-mL flask. The cultures were RNA sample and sterile distilled water up to 13 µL. One incubated in 30°C in a shaking incubator. Cells harvested (1) µL of 2 pmol reverse primer was used for FS-cDNA after 72 h of incubation (optimum and experimentally synthesis (5’ – AGCCAAAGCCTTGACCTTAT – 3’; determined) were used for RNA extraction. designated as P1-R). The mixture was heated at 65°C for 5 min then placed on ice for at least 1 min. It was Isolation of Total mRNA then centrifuged at 10,000 x g at 4°C for 1 min before Total mRNA of Sf 2074 was isolated using the PureLink® adding the following: 4 µL 5X first strand buffer, 1 µL 0.1 RNA Mini Kit (Invitrogen, USA) with some modifications, dithiothreitol, and 1 µL of 200 units • µL-1 Superscript™ that mainly include lysis of the yeast cells (amount reverse transcriptase (Invitrogen, USA). After mixing of enzyme and incubation time for lysis to occur). gently, the mixture was incubated in 55°C for 1 h. The Appropriate amount of zymolyase digestion buffer reaction was then deactivated at 70°C for 15 min. depended on the weight of the pellets collected (2 U: 3 -1 mg pellets; 0.1 U • µL ). The solution was incubated at Second Strand Synthesis 30°C for 90 min. Twenty five (25) µL of RNAse-free water Optimized PCR conditions for second strand synthesis was added during the final elution step. The elution step was prepared using a concentration of MgCl2: 4.0 mM, 5 was repeated once and the RNA sample dissolved in the μL colorless buffer; 1.0 μL dNTP; 2 μL of the first strand centrifuge tube was stored at -80°C. cDNA; 1.0 μL each of the forward and reverse primers; 0.2 All obtained samples were visualized using agarose μL Taq polymerase; and sterile nanopure water. Volume gel electrophoresis to check for the presence and purity was made up to 25 µL. of nucleic acids in the sample. The UN-SCAN-IT gel The PCR reaction ran under the following conditions automated digitizing system v6.1 (Silk Scientific Corp, (Looke et al. 2011): predenaturation at 94°C for 2 min USA) was used to quantify the sample. for 1 cycle; 30 cycles of denaturation (at 94°C for 10 s), annealing and extension (at 72°C for 90 s), and Primer Design final extension at 72°C for 90 s. The generated optimal The primers (Table 1) were designed based on gene annealing temperature was at 55°C was used for all PCR sequences deposited in Genbank/NCBI (http://blast.ncbi. trials. The PCR products were characterized using agarose nlm.nih.gov/Blast.cgi; Ye et al. 2012; Table 2) using the gel electrophoresis. software Primer-BLAST available at the same site. To Using optimized conditions for amplification, one PCR check the compatibility and annealing position of the primer pair (P1-F and P1-R) and four primer walking pairs designed primers, they were aligned with the design (PA-F and PB-R, PA-F and PC-R, PD-F and P1-R, PE-F) template by using ClustalΩ software (http://www.ebi. were utilized to yield the desired gene from the isolated

264 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

Table 2. S. fibuligera glucoamylase genes used in the primer design. Name of NCBI Accession Size Organism (Scientific Name) Type Reference Amylase Number (bp) Saccharomycopsis fibuligera Glu 0111 AJ311587 1548 complete cds Hostinová et al. (2003) Saccharomycopsis fibuligeraPD70 - JF751023 1476 partial sequence Li et al. (2011) Saccharomycopsis fibuligeraR64 GII1 HQ415729 1476 partial sequence Natalia et al. (2011) Saccharomycopsis fibuligera GLU1 L25641 1848 complete cds Itoh et al. (1987) Saccharomycopsis fibuligera - X58117 1881 complete cds Hostinová et al. (1991) Saccharomycopsis fibuligera GLZ AJ628041 2892 complete cds Hostinová et al. (2005)

mRNA. Mass amplification was done in order to produce Phyre2 (Kelley et al. 2015), identity and protein folding enough amount of sample for sequencing (45 µL). and secondary characteristics were deduced. Using the Protein Model Portal (Haas et al. 2013), protein parameters Nucleotide Sequence Analysis such as molecular weight, pI, N-terminal sequence, and Samples were sent to the Philippine Genome Center – estimated half-life were determined. Predicted binding DNA Core Sequencing Facility for direct sequencing. sites were determined using the 3DLigandSite (Wass et DNA chromatograms were generated containing the al. 2010). complete sequence of the genes tested. The obtained DNA sequences have undergone data clean up using FinchTV software (Geospiza, Inc.). In this process, the unnecessary sequences within the chromatogram were RESULTS eliminated depending on the peaks shown within the chromatogram and the Quality Value (QV). QV is an Analyses of Amplicons and cDNA Sequences established metric for determining quality sequencing The actual contig sizes were smaller than those of the data. QV>20, which typically is considered acceptable, estimated ones except for PA-F/PB-R and PE-F/P1-R means the probability that the base was miscalled is no (Table 3). These differences were attribted to sequence greater than 1% (Jankowski 2007). Peaks with low heights clean up applied to the data. The sequences were removed and small values for QV imply non-significance of that of unnecessary bases generally located on both the 5- and certain sequence. Contig assembly was done based on 3- ends. These sequences had low quality value (QV) and forward and reverse primers and trimmed of low quality low peak heights (data not presented). bases using BioEdit software (Ibis BioSciences). Another round of contig assembly was done in order to assemble The gel profile of the amplicons revealed thick and sharp the complete sequence of the desired gene using the initial bands in each lane (Figure 1). This indicates that the contigs generated as starting sequences. Assessment conditions for amplification were successfully optimized. using the nucleotide Basic Local Alignment Search Tool Moreover, there were no secondary products amplified. (BLASTn; Altschul et al. 1997, 2005) from NCBI (http:// The contig sequences were able to assemble a gene www.ncbi.nlm.nih.gov/) was employed. Further analysis containing 1,531 bases. The open reading frame (ORF) was done using Clustal Omega website (http://www.ebi. contains 510 amino acid residues (Figure 2). These ac.uk/Tools/msa/clustalo/), which is used for multiple sequence alignment and phylogenetic tree construction, employing iterative progressive alignment using Hidden Markov Models. This type of alignement refines an initial Table 3. Primer pairs, their expected amplicon sizes and actual progressive multiple alignment by iteratively dividing the contig sizes obtained from Sf 2074. alignment into two profiles and realigning them (Sievers Primer Pair Estimated Generated et al. 2011). The genes used for analysis were grabbed Forward Reverse Amplicon Size (bp) Contig Size (bp) from the GenBank of the NCBI. P1-F P1-R 1,500 1,096 PA-F PB-R 350 356 In Silico Analysis of Protein Structure PA-F PC-R 700 636 Translated protein sequences were used for characterization PD-F P1-R 750 621 using tools in the ExPASy Biointformatics Tool Portal (http://www.expasy.org/structural_bioinformatics). Using PE-F P1-R 150 181

265 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

resulting nucleotide sequences were similar to four glucoamylase genes of different S. fibuligera strains (Table 4). This sequence has been deposited in GenBank/NCBI with the assigned accession number KP068008.1.

Phylogenetic Analysis The phylogenetic tree shows that the determined gene sequence for Sf 2074 glucoamylase gene is most closely related to GLU 1 glucoamylase gene (Accession number: L25641.1; Figure 3). Two glucoamylase genes from Sf PD70 and R64 (HQ415729.1 and JF751023.1, respectively) are in one group, being ~99% homologous to one another (Table 4). Moreover, they are of the same Figure 1. Agarose gel profile of PCR amplicons obtained from primer pairs using total RNA from Sf 2074. Bands shown size, comprising of 1,476 bases. in both (A) and (B) are from the following primer pairs: (1) PA-F and PB-R, (2) PA-F and PC-R, (3) PD-F and P1-R, (4) PE-F and P1-R, and (5) P1-F and P1-R. In Silico Analysis of Protein Structure The translated protein sequence was identified as glucoamylase belonging to the Glycoside Hydrolase 15 (GH 15) family of amylases and possesses a (α/α) six-barrel fold (Figure 5), closely similar to that of the catalytic domain of Aspergillus awamori and T. thermosaccharolyticum (Solovicová et al. 1999), with the active site at the narrower end of barrel. Ninety-six percent (96%) of the sequence comprising 492 residues had been modelled by Phyre2 software with 100% confidence. The protein was also found to possess the following properties: contains 512 amino acids, a molecular weight of 56,715.92 Da, and pI of 4.33. The N-terminal is considered to be serine and the protein’s estimated half-life is >20 h in vivo. Figure 6 shows the glucoamylase molecular model and predicted structural binding sites.

DISCUSSION Cellular disruption is the first step in RNA isolation and one of the most critical steps affecting yield and quality of the isolated RNA. Typically, cell disruption needs to be fast and thorough. Slow disruption may result in RNA degradation by endogenous RNases released internally. Incomplete disruption may also result in decreased yield because some of the RNA in the sample remains trapped in intact cells and therefore, is unavailable for subsequent purification (Farrell 2009). Yeast cells can be extremely difficult to disrupt because their cell walls may form capsules or nearly indestructible spores. In this study, an enzymatic method using zymolyase successfully lysed yeast cells using the proportion 2U zymolyase: 3 mg Figure 2. Nucleotide and deduced amino acid sequence of the -1 cDNA generated from Sf 2074. Pairs of basic amino pellet: 0.1 U uL buffer. Among three enzymes tested on acid residues (Lys-Arg) and potential N-glycosylation S. cerevisiae and Pichia pastoris, Burden (2008) found sites are boxed in red and black, respectively. Sequence that zymolyase had the greatest activity by forming 100% “Ala-Tyr-Thr-Gly” preceding Trp-160 that is identical protoplasts within 10 min, when used at 300 U/ml. The with that preceding alpha-amylase (Taka-amylase) from effectivity of this enzyme is genus-dependent. Each genus Aspergillus oryzae is boxed in green.

266 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

Table 4. Percent identity matrix of Sf 2074 glucoamylase gene compared to other S. fibuligera glucoamylases of different strains. Accession Number (NCBI) A (%) B (%) C (%) D (%) E (%) F (%) G (%) HQ415729.1 (A) - 60.57 99.53 41.81 98.92 98.98 98.92 AJ311587.1 (B) 60.57 - 60.44 41.23 60.61 60.49 60.78 JF751023.1 (C) 99.53 60.44 - 41.88 99.12 99.19 99.12 AJ628041.1 (D) 41.81 41.23 41.88 - 42.27 42.20 42.08 L25641.1 (E) 98.92 60.61 99.12 42.27 - 98.59 100.00 X58117.1 (F) 98.98 60.22 99.19 42.20 98.59 - 98.69 KP068008.1 (G) 98.92 60.78 99.12 42.08 100.00 98.69 -

Figure 3. Phylogenetic tree showing relationships between Sf 2074 glucoamylase gene and the other S. glucomaylases of different strains. Indicated are the source of glucoamylase and their corresponding accessions numbers in NCBI.

Figure 4. Alignment of the determined glucoamylase gene from Sf 2074 to a glucoamylase gene with accession number L25641.1 (NCBI).

267 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

gel, an optimized reaction will give a brighter product band with minimal background. When developing a protocol for PCR amplification of a new target, it may be important to optimize all parameters including reagent concentrations, cycling temperatures, and cycle number (Kainz 2000). In this study, two variables were manipulated for the optimization process: annealing temperature and MgCl2 concentration. For both parameters, primer pair P1-F and P1-R was used. This is so since these primers are believed to amplify the desired glucoamylase gene from Sf 2074. Good PCR products were generated at 50°C, demonstrating that an addition of nearly 5°C to the established annealing temperature could amplify the desired gene. In general, annealing temperature above the predicted melting temperatures of the primers creates a more restrictive and selective amplification of the target. High annealing temperature is used if non-specific products are present (Judelson 2000). Another variable that has undergone optimization is MgCl2 concentration. Magnesium is required as a co- Figure 5. Structural model of the Sf 20174 glucoamylase protein factor for thermostable DNA polymerase. Taq polymerase 2 using Pyre . Image colored by rainbow N to C terminus; is a magnesium-dependent enzyme and determining model dimensions (Å): x:64.667 y:60.387 z:60.380. the optimum concentration to use is critical to the success of the PCR reaction. A concentration of 0.5 mM MgCl2 was not enough to yield acceptable products because presumably, a significant reduction in MgCl2 concentration prevented a sufficient number of enzyme molecules from being in the correct conformation for an efficient amplification to occur (Markoulatos et al. 2002). Conversely, primers that bind to incorrect template sites are stabilized in the presence of excessive magnesium concentrations and so results in decreased specificity of the reaction (Kramer & Coen 2006). In effect, a substantial increase in secondary products is produced by non- specific priming (Kainz 2000). This effect was shown by using MgCl2 concentrations of 2.0 mM, 3.0 mM, and 4.0 mM as smears are visible near the crisp band and at the bottommost part of the wells. The optimum magnesium chloride concentration at 1.0 mM was wherein a single crisp band was evident. The resulting contig sequences amplified from Sf 2074 that were able to assemble a gene sequence containing 1,531 Figure 6. Sf 2074 molecular model and predicted structural view bases and was able to identify with four glucoamylase of the binding sites. genes of different S. fibuligera strains in the Genbank database. The phylogenetic tree generated from alignment data via Clustal-Omega (EMBL-EBI), supports the has a designated enzyme concentration in order for cellular results. Two glucoamylase genes from Sf PD70 and R64 disruption to be effective. (HQ415729.1 and JF751023.1, respectively) are into one group due to the fact that they are ~99% homologous with Taking particular care when optimizing PCR conditions each other. Moreover, they are of the same size having can provide rewards in several ways. An optimized PCR 1,476 bases. These two genes are highly homologous to run will improve both product yield and reproducibility the gene with Accession No. X58117.1, yet it branched out between reactions, while reducing amplification of non- into a separate clade, perhaps due to its shorter size (405 specific products. When electrophoresed on an agarose

268 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

bases). A strain of S. fibuligera amylase (AJ311587.1) has only indicates the possibility, not the certainty that the a separate clade since it belongs to a different family as it modification actually occurred (Medzihradszky 2008). is reported as an alpha-glucosidase (Itoh 1987). As per the findings of Itoh and co-workers (1987), S. Interestingly, an S. fibuligera amylase gene (AJ628041.1) fibuligera glucoamylase gene suggested that sequences having relatively low homologies to all other genes of surrounding the conserved tryptophan residue near the same species and AJ311587.1) have their own group. the short peptide sequence allow the formation of This has been reported as a glucoamylase gene from β-turn conformation in all glucoamylases. In Sf 2074 another strain of S. fibuilgera, but its structure was altered glucoamylase, all six tryptophan residues are located such that it is without a separate starch-binding domain at highly conserved positions in the five segments, (Hostinová 2002). suggesting that some of these tryptophan residues are likely to be essential for enzymatic activities. However, Ultimately, the tree shows that the determined gene the S. fibuligera HUT 7212 glucoamylase gene (Glu sequence for Sf 2074 glucoamylase gene is most closely gene; which is 100% homologous to the reported gene), related, still to GLU 1 glucoamylase gene (Accession No. adsorbs to, but does not digest raw starch as reported by L25641.1). To further support this, an alignment of the Solovicová and co-authors (1999). The glucomaylases amino acid sequence of these two is shown on Figure 4. from A. niger and A. awamori prefer longer malt- Both genes exhibit 100% homology with each other. The oligosaccharides as substrates, which is also the case for high level of homology (~99%) of Sf 2074 with most S. S. fibuligera glucoamylase. fibuligera glucoamylases (5 of 7) indicates that this gene is highly conserved. In a study by Sevcík and co-authors (2006), Glu was compared to Glm, a glucoamylase from S. fibuligera IFO Although homology was high, the ORF – which had 510 0111. Comparison of the key residues in the starch binding amino acid residues – did not contain a start codon (ATG) site between the two (Tyr464 in Glu vs Phe 461 in Glm) at and a stop codon (TAA, TAG, or TGA), an indication relatively and structurally equivalent positions confirmed that the sequence generated does not code for a complete that the Glu structure lacked the independent starch gene. Instead, it started with serine (TCC) and ended with binding domain, while the catalytic domain was similar alanine (GCT). In order to identify the possible missing to other GH 15 family members. They have also found sequence, the determined sequence was aligned to the out that for Glu, two acarbose molecules (on the active glucoamylase gene (GLU1; accession number L25641) site and on a site remote from the active site) are bound in a S. fibuligera strain. Aside from this is its closest in and the latter is curved along Tyr 464 residue. Mutation terms of phylogeny, his gene contains a complete sequence of this specific binding site have greatly reduced starch having a start codon and stop codon. Using this, it can binding properties. This residue is shown to be present in be deduced that an initial 5’ end sequence of 20 bases the reported gene. (5’ - ATGAAATTCGGTGTTTTATT – 3’) is lacking. The same premise is supported with the alignment of The catalytic machinery of the reported gene is shown the amino acid sequence of both genes. As shown on on Figure 2. In the glucoamylase from A. awamori and Figure 4, Sf 2074 glucoamylase gene lacks initial 5‘ end A. niger structures Glu179 was indentified as the general sequence of 7 amino acids (5‘ – MKFGVLF – 3‘). At the acid and base responsible for catalysis. Superposition of 3’ end, it shows the sequence only lacks the stop codon these genes to glucoamylase complexes of S. fibuligera alone 5’ – TAA – 3’. The most probable cause for this shows that the same residues are also found. In the case of was the clean-up done to the sequence data. This process the reported gene, it is found in Glu230, general acid, and probably removed the above mentioned sequence. If the Glu476, general base (Aleshin et al. 1994ab; Harris et al. end bases were able to generate enough peak heights and 1993; Sierks et al. 1990; Svensonn et al. 1990). high quality value in the chromatogram, then a complete cDNA sequence could have been obtained. The claim above supports that S. fibuligera glucomaylases, including the reported one, might have evolved a starch Bioinformatic analysis of protein structure identified the binding site on the catalytic domain that is quite distinct protein as a glucoamylase with potential N-glycosylation from that seen in other members of the GH 15 family. This sites. Asparagine residues were found in the protein is further supported by the constructed phylogenetic tree mainly due to the presence of consensus sequence required (Figure 3). Glu and the reported gene are grouped together for N-glycosylation, which is “Asn – Xxx - Ser/Thr/ in a single clade and has evolved most recently in contrast Cys”, where Xxx can be any amino acidexcept proline to other S. fibuligera glucoamylases (highly homologous). (Mellquist et al. 1998). However, even if a consensus Glm from S. fibuligera IFO 0111 is far distantly related sequence has been identified for a post-translational to Glu on the clade, implying that Glm may be likely the modification, the presence of such a sequence motif ancestor of Glu.

269 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

CONCLUSION resolution. J. Biol. Chem. 267: 19291-98 This study determined the presence of glucoamylase ALTSCHUL SF, WOOTON JC, GERTZ EM, AGARWALA gene sequence coded by Sf 2074, a native strain used R, MORGULIS A, SCHAFFER AA, YU YK. 2005. in fermenting rice wine. The cDNA was successfully Protein database searches using compositionally synthesized by the following approach: cell wall lysis adjusted substitution matrices. FEBS J272: 3389-3402. to produce good quality RNA, primers designed by ALTSCHUL SF, MADDEN TL, SCHAFFER AA, primer walking, and optimization of MgCl2concentration ZHANG J, ZHANG Z, MILLER W, LIPMAN DJ. and annealing temperature of primers. Bioinformatic 1997. Gapped BLAST and PSI-BLAST: A new analyses confirmed the putative gene as a glucoamylase. generation of protein database search programs. Tryptophan residues that are likely involved in enzymatic Nucleic Acid Res 25: 3389-3402. activities, as well as a specific sequence serving as a marker for the formation of β-turn conformation in BARCHIESI J, HEDIN N, GOMEZ-CASATI DF, all glucoamylases, were identified. These may lead to BALLICORA MA, BUSI MV. 2015. Functional a possible characterization of the gene as a raw-strach demonstrations of starch binding domains present digesting amylase. in Ostreococcus tauri starch synthases isoforms. BMC Research Notes 8: 613. Characterization methods can also be done to obtain more information on the nature of Sf 2074 glucoamylase. BOTHAST RJ, SCHLICHER MA. 2005. Biotechnological This may include assays on glucoamylase activity, processes for conversion of corn into ethanol. Appl protein concentration, and colony PCR. Furthermore, MicrobiolBiotechnol 67: 19-25. manipulations in the gene/protein can be conducted to BURDEN D. 2008. Comparison: zymolyase™ vs. lyticase characterize this glucoamylase. Induced mutations like & glusulase. Retrieved from http://www.amsbio.com/ insertion and deletion within the gene can be done to brochures/Zymolyase_Comparison.pdf on 31 Mar both hasten and improve the glucoamylase activity of 2015. the enzyme, if possible. Lastly, transformation into S. cerevisiae can be explored to assess this gene‘s potential [CAZy] Carbohydrate Active Enzymes. 2017. Retrieved application in direct . from http://www.cazy.org. DE SOUZA PM, MAGALHAES PDO. 2010. Application of microbial α-amylase in industry – A review. Braz J Microbiol. 41(4): 850-861. ACKNOWLEDGMENTS DIPARDO J. 2000. Outlook for biomass ethanol production Funds from this study were obtained from the Department and demand. Energy Information Administration, of Science and Technology - Philippine Council for Washington, D.C. Energy and Emerging Technology Resources Research and Development (DOST-PCIEERD) and the University DUFEY A. 2006. Biofuels production, trade and sustainable of the Philippines Mindanao. The technical assistance development: Emerging issues. International Institute of Mr. Kevin Labrador is also gratefully acknowledged. for Environment and Development, London. FARRELL RE, JR. 2009. Resilient Ribonucleases. In: RNA Methodologies: Laboratory Guide for Isolation and Characterization. 4th ed. Retrieved from http:// REFERENCES books.google.com.ph/books?id=ERdmQGrAtTQC& ALESHIN AE, HOFFMAN C, FIRSOV LM & dq=RNases+are+said+to+be+very+stable+and+acti HONZATKO RB. 1994a. Crystal structure of ve&hl=fil&source=gbs_navlinks_s on 22 Aug 2013. glucoamylase from Aspergillus awamori var. X100–2.2 FOGARTY WM, KELLY CT. 1980. Amylases, A ˚ resolution. J Mol Biol 238: 575-591. Amyloglucosidase and related Glucanases. In: ALESHIN AE, FIRSOV LM & HONZATKO RB. 1994b. Microbial enzymes and Bioconversion, 4th ed. Refined structure for the complex of acarbose with Academic press, London: p. 115-170. glucoamylase from Aspergillus awamori var. X100–2.4 [FAO] Food and Agriculture Organization. 2008. FAO, A ˚ resolution. J Biol Chem 269: 15631-39. The State of Food and Agriculture, Biofuels: Prospects, ALESHIN A, GOLUBEV A, FIRSOV LM, HON- Risks and Opportunities, Chap 4. FAO, United Nations. ZATKO RB. 1992. Crystal structure of glucoamylase 47p. from Aspergillus awamori var. X100 to 2.2-A FRANDSEN TP, FIEROBE HP, SVENSSON B. 1999. In:

270 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

Alberghin L, ed. Engineering specificity and stability HORVÁTHOVÁ VS, JANEČEK S, STURDÍK E. 2000. in glucoamylase from Aspergillus niger in protein Amylolytic enzymes: their specificities, origins and engineering in industrial biotechnology. Amsterdam properties. Biologia Bratislava 55/6: 605-615. Harwood Academic. p. 189-206. HOSTINOVÁ E. 2002. Amylolytic enzymes produced FRONTERAS JP, BULLO LLR. 2017. Raw starch- by the yeast Saccharomycopsis fibuligera. Biologia, digesting amylase from Saccharomycopsis fibuligera Bratislava. Suppl. 11: 247-251. 2074 isolated from bubod starter. Phil J Sci 46 (1): HOSTINOVÁ E, BALANOVÁ J, GASPERÍK J. 1991. 27-35. The nucleotide sequence of the glucoamylase gene GALDINO AS, SILVA R, LOTTERMANN MT, GLA1 from Saccharomycopsis fibuligera KZ. FEMS ALVARES ACM, DE MORAES LMP, TORRES FAG, Microbiol Lett 83(1):103-108. DE FREITAS SM, ULHOA CJ. 2010. Biochemical and HOSTINOVÁ E, SOLOVICOVÁ A, DVORSKY R, structural characterization of Amy1: An alpha-amylase GASPERÍK J. 2003. Molecular cloning and 3D from Cryptococcus flavus expressed in Saccharomyces structure prediction of the first raw-starch-degrading cerevisiae. Creative Commons Attribution License. glucoamylase without a separate starch-binding p. 1-7. domain. Arch Biochem Biophys 411: 189-195. GOYAL N, GUPTA JK, SONI SK. 2005. A novel raw HOSTINOVÁ E, SOLOVICOVÁ A, GASPERÍK starch digesting thermostable α-amylase from Bacillus J. 2005. Cloning and expression of a gene for an sp. I-3 and its use in direct hydrolysis of raw potato alpha-glucosidase from Saccharomycopsis fibuligera starch. Enzyme Microb Technol 37: 723-734. homologous to family GH31 of yeast glucoamylases. GUILLEN D, SANCHEZ S, RODRÍGUEZ-SANOIA R. Appl Microbiol Biotechnol 69(1): 51-56. 2010. Carbohydrate-binding domains: multiplicity IEFUJI H, CHINO M, KATO M, IMURA Y. 1996. of biological roles. Applied Microbiology and Raw-starch-digesting and thermostable α-amylase Biotechnology 85(5): 1241-49. from the yeast Cryptococcus sp. S-2: Purification, GUPTA R, GIGRAS P, MOHAPATRA H, characterization, cloning, and sequencing. Biochem J GOSWAMI VK, CHAUHAN B. 2003. 318(3): 989-996. Microbial α-amylases: a biotechnological ITOH T, OHTSUKI I, YAMASHITA I, FUKUI S. 1987. perspective. Process Biochemistry 38(11): 1599-1616. Nucleotide sequence of the glucoamylase gene GLU1 HAAS J, ROTH S, ARNOLD K, KIEFER F, SCHMIDT T, in the yeast Saccharomycopsis fibuligera. J Bacteriol BORDOLI L, SCHWEDE T. 2013. The Protein Model 169(9): 4171-76. Portal - a comprehensive resource for protein structure JABBOUR D, SORGER A, SAHM K, ANTRANIKIANG. and model information. Database bat031 2012. A highly thermoactive and salt-tolerant HARRIS EMS, ALESHIN AE, FIRSOV LM & α-amylase isolated from a pilot-plant biogas reactor. HONZATKO RB. 1993. Refined structure for the Appl Microbiol Biotechnol 97(7): 2971-78. complex of 1-deoxynojirimycin with glucoamylase JAFFAR MB, BHARAT RP, NOROUZIAN D, IRANI from Aspergillus awamori var. X100–2.4 A ˚ resolution. SD, SHETTY P. 1993. Production of glucoamylase Biochemistry 32: 1618-26. by nematophagus fungi Arthrobotrys species. Indian HENRISSAT B. 1991. A classification of glycosyl J Exp Biol 31: 87-89. hydrolases based on amino-acid sequence JANKOWSKI P, VENNEMEYER E, HUNKAPILLER similarities. Biochem. J. 280: 309-316. K, SHAH P, VADAPALLI A. 2007. Direct sequencing HENRISSAT B, BAIROCH A. 1993. New families in the quality control: A novel software approach to reducing classification of glycosyl hydrolases based on amino researcher labor. Retrieved from http://www3. acid sequence similarities. Biochem. J. 293: 781-788. appliedbiosystems.com/cms/groups/mcb_marketing/ documents/generaldocuments/cms_039259.pdf HORVÁTHOVÁ V, SLAJSOVÁ K, STURDÍK E. 2004. Evaluation of the glucoamylase Glm from JUDELSON H. 2000. Guidelines for designing primers. Saccharomycopsis fibuligera IFO 0111 in hydrolysing Retrieved from https://oomyceteworld.net/protocols/ the corn starch. Biologia Bratislava 59: 361-365. primer%20designing2.pdf HORVÁTHOVÁ V, JANEČEK S, STURDÍK E. 2001. KAINZ P. 2000. The PCR plateau phase- towards an Amylolytic enzymes: molecular aspects of their understanding of its limitations. Biochem Biophys properties . Gen Physiol Biophys. 20(1): 7-32. Acta 1494: 23-27.

271 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

KAPLAN F, GUY CL. 2004. β-Amylase Induction and determinant of N-linked core glycosylation efficiency. the Protective Role of Maltose during Temperature Biochem 37(19): 6833-37. Shock. Plant Physiol. 135(3): 1674-84. MERTENS JA, SKORY CD. 2006. Isolation and KELLEY LA, MEZULIS S, YATES CM, WASS MN, characterization of a second glucoamylase gene STERNBERG MJ. 2015. The Pyre2 web portal for without a starch binding domain from Rhizopus protein modeling, prediction and analysis. Nat Protoc oryzae. Enzy. Microbia. Technol. 40: 874-880. 10(6): 845-858. MIKAMI B, ADACHI M, KAGE T, SARIKAYA E, KONSTANTINIDIS A, SINNOT ML. 1991. The NANMORI T, SHINKE R, UTSUMI S. 1999. interaction of 1-fluoro-d-glucopyranosyl fluoride with Structure of raw starch-digesting Bacillus cereus beta- glucosidases. Biochem J 279: 587-593. amylase complexed with maltose. Biochem 38(22): 7050--61. KOSSMANN J, LLOYD J. 2000. Understanding and influencing starch biochemistry. Crit Rev Biochem NATALIA D, VIDILASERIS K, SATRIMAFITRAH Mol Biol 35: 141-196. P, ISMAYA WT, PURKAN H, PERMENTIER H, FIBRIANSAH G, PUSPASARI F, NURACHMAN KRAMER MF, COEN DM. 2006. Enzymatic Z, DIJKSTRA BW, SOEMITRO S. 2011. amplification of DNA by PCR: standard procedures Biochemical characterization of a glucoamylase from and optimization. Curr Protoc Cytom, Appendix 3K. Saccharomycopsis fibuligera R64. Biol66(1): 27-32. LI Z, JIANG N, WEI P, CHENG H, HE P, LU D. 2011. NOROUZIAN D, JAFFAR MB. 1993. Immobilization Cloning and characterization of a glucoamylase of glucoamylase produced by fungus Arthrobotrys gene from the dimorphous yeast Saccharomycopsis amerospore. Indian JExp Biol 31: 680-681. fibuligera. Direct submission. NCBI Accession Number JF751023. https://www.ncbi.nlm.nih.gov/ NOROUZIAN D, AKBARZADEH A, SCHARER JM, nuccore/JF751023. YOUNG MM. 2005. Fungal glucoamylases. Elsevier: p. 80-83. LOOKE M, KRISTJUHAN K, KRISTJUHAN A. 2011. Extraction of Genomic DNA from Yeasts for PCR- OLANIYI OO, AKINYELE BJ, AROTUPIN DJ. 2010. Based Applications. Biotechniques 50(5): 325-328. Purification and characterization of beta amylase from Volvariella volvacea. Nigerian J Microbiol 24(1): LY HD, WITHERS S. 1999. Mutagenesis of glycosidases. 1976-82. Annu. Rev. Biochem. 68: 487-522. PANDEY A, NIGAM P, SOCCOL CR, SOCCOL VT, MATSUBARA T, AMMAR YB, ANINDYAWATI T, SINGH D, MOHAN R. 2000. Advances in microbial YAMAMOTO S, ITO K, IZUKA M, MINAMIURA amylases. Biotechnol Appl Biochem 31: 135-152. N. 2004. Molecular cloning and determination of the nucleotide sequence of raw starch-digesting α-amylase PAVEZZI FC, GOMES E, DA SILVA R. 2008. from Aspergillus awamori KT-11 J Biochem Mol Biol Production and characterization of glucoamylase 37(4): 429-438. from fungus Aspergillus awamori expressed in yeast Saccharomyces cerevisiae using different carbon MCCARTER JD, WITHERS SG. 1994. Mechanisms of sources. Braz J Microbiol 39(1): 108-114. enzymatic glycoside hydrolysis. Curr Opin Struct Biol 4: 885-892. PRIMER-BLAST [Computer software]. n/d. US National Center for Biotechnology Information. Retrieved from MCWILLIAM H, LI W, ULUDAG M, SQUIZZATO http://www.ncbi.nlm.nih.gov/tools/primer-blast S, PARK YM, BUSO, N, COWLEY, AP, LOPEZ R. 2013. Analysis Tool Web Services from the EMBL-EBI. REILLY PJ. 1999. Protein engineering of glucoamylase Nucleic Acids Res 41(Web Server issue): W597-600. to improve industrial properties; a review. Starch 51: 269-274. MARKOULATOS P, SIAFAKAS N, MONCANY M. 2002. Multiplex polymerase chain reaction: a practical SCHAFER T, BORCHERT TW, NIELSEN VS, approach. J Clin LabAnaly 16(1): 47-51. SKAGERLIND P, GIBSON K, WENGER K. 2007. Industrial enzymes. Adv BiochemEng/Biotechnol MEDZIHRADSZKY KF. 2008. Characterization of site- 105: 59-131. specific N-glycosylation. Meth Mol Biol 446: 293-316. SCHEIDIG A, FRÖHLICH A, SCHULZE S, LLOYD MELLQUIST JL, KASTURI L, SPITALNIK SL, JR, KOSSMANN J. 2002. Downregulation of a SHAKIN-ESHLEMAN SH. 1998. The amino acid chloroplast-targeted beta-amylase leads to starch- following an asn-X-Ser/Thr sequence is an important excess phenotype in leaves. Plant J 30: 581-591.

272 Philippine Journal of Science Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase Vol. 147 No. 2, June 2018

SHIAU RJ, HUNG HC, JEAN CL. 2003. Improving the inverting reactions of glycosylases. J Biol Chem 269: thermostability of raw-starch-digesting amylase from 32306-12. Cytophaga sp. by site-directed mutagenesis. Appl. UEDA S, MARSHALL JJ. 1980. Raw starch digestion Environ. Microbiol. 69(4): 2383-85. of Bacillus polymyxa bet amylase. Starch/Starke 32: SEVCÍK J, SOLOVICOVÁ A, HOSTINOVÁ E, 122-125. GASPERÍK J, WILSON KS, DAUTER Z. 1998. VIHINEN M, MANTASALA P. 1989. Microbial Structure of glucoamylase from Saccharomycopsis amylolytic enzymes. Critic Rev Biochem Mol Biol fibuligera at 1.7 A resolution. Acta Crystallogr. D54: 24: 329-418. 854-866. WASS MN, KELLEY LA, STERNBERG MJ. 2010. SEVCÍK J, HOSTINOVÁ E, SOLOVICOVÁ 3DLigandSite: predicting ligand-binding sites using A, GASPERÍK J, DAUTER Z, WILSON KS. 2006. similar structures. Nar 38:469-73. Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding WIND RD. 1997. Starch-converting Enzymes from site on the catalytic domain. FEBS J. 273(10): 2161-71. Thermophilic Microorganisms, PhD thesis, ISBN 90-9010859-9, Ponsen & Looijen BV, Wageningen, SHOSEYOV O, SHANI Z, LEVY I. 2006. Carbohydrate the Netherlands. binding modules: biochemical properties and novel applications. Microbiol Mol Biol Rev. 70(2): 283-95. WONG DWS, ROBERTSON GH. 2002. Beta-amylases. In: Handbook of Food Enzymology. Whitaker JR, SIERKS MR, FORD C, REILLY PJ, SVENSSON B. Voragen AGJ, Wong DWS eds. Marcel Dekker: New 1990. Catalytic mechanism of fungal glucoamylase as York; Chapter 57. defined bymutagenesis of Asp176, Glu179, and Glu180 in the enzyme from Aspergillus awamori. Protein Eng WU AC, RAL JP, MORELL MK, GILBERT RG. 2014. 3: 193-198. New Perspectives on the Role of α- and β-Amylases in Transient Starch Synthesis. PLoS ONE 9(6): e100498. SIEVERS F, WILM A, DINEEN D, GIBSON TJ, KARPLUS K, LI W, LOPEZ R, MCWILLIAM YE J, COULOURIS G, ZARETSKAYA I, CUTCUTACHE H, REMMERT M, SODING J, THOMPSON JD, I, ROZEN S, MADDEN TL 2012. Primer-BLAST: HIGGINSDG. 2011. Fast, scalable generation of high- a tool to design target-specific primers for polymerase quality protein multiple sequence alignments using chain reaction. BMC Bioinf 13: 134. Clustal Omega. Mol SystBiol 7: 539. SINNOTT ML. 1990. Catalytic mechanism of enzymic glycosyl transfer. Chem Rev 90: 1171-1202. SOHN CB, LEE SM, KIM MH, KO JH, KIM KS. 1996. Purification and characterization of β-amylase from Bacillus polytnyna No 26-1. J Food Sci 61: 230-234. SOLOVICOVÁ A, CHRISTENSEN T, HOSTINOVÁ E, GASPERÍK J, SEVCĬK J, SVENSSON B. 1999. Structure-function relationships in glucoamylases encoded by variant Saccharomycopsis fibuligera genes. Eur J Biochem. 264(3): 756-64. SUNDARRAM A, MURTHY TPK. 2014. α-Amylase Production and Applications: A Review. Journal of Applied & Environmental Microbiology 2(4): 166-175. SVENSSON B, CLARKE AJ, SVENDSEN I, MOLLER H. 1990. Identification of carboxylic acid residues in glucoamylaseG2 from Aspergillus niger that participate in catalysis and substrate binding. Eur J Biochem 188: 29-38. TANAKA Y, TAO W, BLANCHARD JS, HEHRE EJ. 1994. Transition-state structures for the hydrolysis of alpha-dglucopyranosyl fluoride by retaining and

273