Bacterial Microbiome of Coptotermes Curvignathus (Isoptera: Rhinotermitidae) Reﬂects the Coevolution of Species and Dietary Pattern

Insect Science (2014) 21, 584–596, DOI 10.1111/1744-7917.12061

ORIGINAL ARTICLE Bacterial microbiome of Coptotermes curvignathus (Isoptera: Rhinotermitidae) reﬂects the coevolution of species and dietary pattern

Jie Hung Patricia King1 , Nor Muhammad Mahadi2, Choon Fah Joseph Bong1, Kian Huat Ong1 and Osman Hassan3 1Faculty of Agriculture and Food Sciences, Universiti Putra Malaysia Bintulu Sarawak Campus, Sarawak, 2Malaysia Genome Institute, Jalan Bangi Lama, 43000 Kajang, and 3Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor, Malaysia

Abstract Coptotermes curvignathus Holmgren is capable of feeding on living trees. This ability is attributed to their effective digestive system that is furnished by the termite’s own cellulolytic enzymes and cooperative enzymes produced by their gut microbes. In this study, the identity of an array of diverse microbes residing in the gut of C. curvignathus was revealed by sequencing the near-full-length 16S rRNA genes. A total of 154 bacterial phylotypes were found. The Bacteroidetes was the most abundant phylum and accounted for about 65% of the gut microbial profile. This is followed by Firmicutes, Actinobacteria, Spirochetes, Proteobacteria,TM7,Deferribacteres, Planctomycetes, Verrucomicrobia,and Termite Group 1. Based on the phylogenetic study, this symbiosis can be a result of long coevolution of gut enterotypes with the phylogenic distribution, strong selection pressure in the gut, and other speculative pressures that determine bacterial biome to follow. The phylogenetic distribution of cloned rRNA genes in the bacterial domain that was considerably different from other termite reflects the strong selection pressures in the gut where a proportional composition of gut microbiome of C. curvignathus has established. The selection pressures could be linked to the unique diet preference of C. curvignathus that profoundly feeds on living trees. The delicate gut microbiome composition may provide available nutrients to the host as well as potential protection against opportunistic pathogen. Key words Coptotermes curvignathus, diet preference, gut microbiome, selection

Introduction biota in the gut of Coptotermes curvignathus Holmgren is largely unknown. The role of the gut microbiota of C. In contrast to the most studied termite Reticulitermes sper- curvignathus in the survival of its host is still obscure. atus Kolbe, diversity and community structure of micro- This termite species is found in the Indo-Malaysia region, and display several unique features that have attracted the attention of science communities to explore its potential Correspondence: Jie Hung Patricia King, Faculty of Agri- as gold mine for robust industrial enzymes. culture and Food Sciences, Universiti Putra Malaysia Bintulu Unlike most of the termite species that feed on semi Sarawak Campus, P. O. Box 396, 97008 Bintulu, Sarawak, or partially degraded wood residues, C. curvignathus has Malaysia. Tel: +60 86 855411; fax: +60 86 855415; email: the ability to attack and consume tissues of healthy liv- [email protected] ing trees. This indicates the unique digestive feature of

584 C 2013 Institute of Zoology, Chinese Academy of Sciences Bacterial microbiome of Coptotermes curvignathus 585

C. curvignathus that can overcome plant defense mecha- out using sterilized fine tip forceps. The isolated guts of nism and achieve effective lignocellulosic biomass con- 60 individuals were torn to release their gut fluid in ATL version. Discerning understanding on the gut microbial solution (Qiagen DNeasy Tissue Kit, Qiagen Inc., Va- community is very important in order to comprehend the lencia, CA, USA). Proteinase was added and incubated digestion mechanism of C. curvignathus. overnight at 55 ◦C. DNA was extracted using the Qiagen Studies have shown that the alteration of the gut mi- DNeasyTissueKit. crobiota could affect the metabolic versatility of termites (Nazarczuk et al., 1981). The dense and diverse intestinal microbiota assemblages in the gut of termites help capac- PCR amplification and preparation of clone libraries itate various metabolic reactions to be performed. As a result of this, an intriguing yet delicate physiochemical The 16S rRNA genes were amplified from the gut sample by PCR, using Bacteria-universal primers, balance environment is created in this tiny termite gut, μ 63F (5 CAGGCCTAACACATGCAAGTC3 )–1389R approximately 1–10 L of volume. The multifarious metabolic activities also provide and (5 ACGGGCGGTGTGTACAAG3 ) (Marchesi et al., 1998) and 27F (5AGAGTTTGATCMTGGCTCAG sustain the necessary aerobic and anaerobic condition unto this tiny environment. Many of these microbes are 3 )–1429R (5 GGTTACCTTGTTACGACTT 3 ) (Suzuki believed to be unique to termites and perhaps are the di- & Giovannoni, 1996). PCR was performed using a PTC- rect descendants of those inhabited termites millions of 225, Peltier Thermal Cycler (MJ Research Inc., Waltham, years ago (Nalepa et al., 2001). Molecular analysis of MA, USA), Go-Taq (Promega Corporation, Madison, WI, USA), and the following program: 2 min of initial de- bacterial microbiota in the gut of R. speratus revealed ◦ that more than 90% of the phylotypes were found for naturation at 95 C, followed by 24 cycles of denaturation (30 s at 95 ◦C), annealing (60 s at 55 ◦C), and extension the first time. Some phylotypes also constituted mono- ◦ ◦ phyletic clusters with sequences recovered from the gut (2 min at 72 C), with a final extension at 72 C for 10 min. of other termite species. This implies the existence of The concentrations of the template and primers were μ termite-specific bacterial lineages (Hongoh et al., 2003). 35 ng/ L and 20 pmol, respectively. The PCR product μ The research of termites’ gut is often complicated by was purified from 200 L of reaction mixture, using the their tiny gut structures and diversiform physicochemical QIAquick PCR Purification kit (Qiagen Inc., Valencia, niches in the gut. These made in vitro duplication of gut CA, USA). The products were cloned into pJET1/blunt fluid and condition challenging and hardly possible. Thus cloning vectors (GeneJET PCR cloning Kit, Fermentas a serious obstacle in studying the gut microbes is in iso- International Inc., Burlington, ON, Canada) and a clone lating and cultivating microbes in vitro. Therefore, most library was established on LB agar plates. studies of termite gut microbiota diversity are culture- independent. In this study, the microbial diversity in the Plasmid extraction and purification gut of C. curvignathus was probed based on both culture- independent and cultivation approaches in order to better A total of 576 clones from each library were cultured comprehend the interaction between the host digestive as in 2× Luria-Bertani (Miller)-ampicilin broth at 37 ◦Cat well as innate immune systems and microbes residing in 320 r/m for 20 h. Cultures were centrifuged and pel- the termites’ guts. lets were resuspended in Solution 1 (Millipore, Billerica, MA, USA). Plasmids were extracted and purified using MultiScreen Plasmid 96-well plates according to Plasmid Materials and methods Miniprep Millipore protocol.

Sample collection and extraction of DNA Sequencing and phylogenetic affiliation of clones Wood-feeding lower termites, C. curvignathus (Fam- ily Rhinotermitidae) that were actively feeding on the Purified plasmids were sequenced with pJET1 forward oil palm, were collected from an oil palm plantation in sequencing primer (5GCCTGAACACCATATCCAT- Bintulu, Sarawak, Malaysia. A total of 13 different species CC3)/reverse sequencing primer (5GCAGCTGAGAA- of termites were found within the plantation vicinity TATTGTAGGAGATC3) (GeneJET PCR Cloning Kit, (Bong et al., 2012), and C. curvignathus was the domi- Fermentas International Inc., Burlington, ON, Canada), nance species (Bong, personal communication). Termites using ABI 3710XL analyzer. All sequences were sub- were washed in sterilized water, and their guts were drawn jected to Pregap4 base calling, vector masking before

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 586 J. H. P.King et al. aligning using Gap4 program. These near-full-length 16S 98%–99% sequence similarity with clones representing rRNA gene sequences (approximately 1 400 bases) were endosymbionts of gut cellulolytic protist Pseudotricho- analyzed by BLAST 2.0 (National Center for Biotechnol- nymphae. Another abundant group (100 clones) repre- ogy Information [NCBI]) to find the closest phylogenetic sented by 32 phylotypes were closely related to bacte- neighbors. A maximum parsimony tree of all sequences riainthefamilyPorphyromonadaceae, and majority of was constructed using MEGA V2.1. The tree was tested them affiliated with the genera Dysgonomonas and Tan- statistically using bootstrap resampling of 500 times. nerella. The clone libraries also contained 2 phylotypes each from family Rikenellaceae and Bacteroidaceae. Phy- lotypes 1c001b04 (6 clones) and 3d005d09 (2 clones) Rarefraction analysis formed a minor cluster affiliated with the order cytophagales which forms the CFB group with Bacteroidetes and The coverage of the biodiversity assessment in this Flavobacterium (Woese, 1987). study was evaluated with the Analytic Rarefraction soft- A total of 166 clones that belonged to Firmicutes fell ware (version 1.2; M Holland, University of Georgia, almost equally within the class Clostridia (44%) and Athens, GA; http://www.uga.edu/strata/Software.html). Lactobacillales (49%), whereas another 7% in class Mollicutes (Fig. 3). The most abundant group was repre- Results sented by phylotype MgKI1c001D09 (61 clones), which had 99% sequence similarity with Lactococcus garvieae. Bacterial community in the termite gut Phylotypes 3d011f09 and 3d002g11 were distantly related to L. garvieae (90%–94% sequence similarity). A total of 1 152 clones were sequenced and 154 phylo- Within the class Lactobacillales, 4 phylotypes were clus- types were identified. Phylogenetic analysis revealed that tered with Enterococcus (93%–98% sequence similarity), the clones represented 10 bacterial phyla. Almost 65% of 1 phylotype each clustered with Leuconostoc citreum the clones belonged to Bacteroidetes (41 phylotype), and (99% sequence similarity), Streptococcus (94% sequence followed by Firmicutes that were about 15% of total ana- similarity), Oscillospira guilliermondii, and Pilibacter lyzed clones (57 phylotypes). About 82 clones of the Fir- termitis (90% sequence similarity). Another abundant micutes were Lactobacillales, 73 clones were Clostridia, group, represented by 3d005h02, was affiliated with and the rest fell within the class Mollicutes. Actinobac- uncultured members of Clostridiaceae (92% sequence teria were the third most abundant bacteria in the gut of similarity) from termites, mammalian, and ruminant guts. C. curvignathus, approximately 6% of the total analyzed Others members of class Clostridia were closely related to clones (21 phylotypes). A total of 10 phylotypes were Clostridium saccharolyticum, Clostridium amygdalinum, found to belong to Proteobacteria, 7 phylotypes clus- and Acetanaerobacterium. Clones assigned to Class Mol- tered among Spirochetes, 5 phylotypes were members licutes were minority (11 clones) and mostly fell within to candidate phylum Termite Group 1 (TG1), 4 phylo- family Spiroplasmas and Mycoplasmas (2 phylotypes). types were clustered among the candidate division TM7, Actinobacteria constituted the third largest phylum in 2 each among Planctomycetes and Verrucomicrobia, and the intestinal tract of C. curvignathus (66 clones) (Fig. 4). a single phylotype among Deferribacteres. There were The majority of clones (32 clones) were represented 4 phylotypes assigned as uncultured bacteria with un- by phylotype MgKI 3d003h07 that had 92% sequence known phylum, and 1 phylotype (MgKI3d002D04) had no similarity with Actinobacterium (NCBI Sequence ID: significant hit against NCBI database. Rarefaction anal- GQ502466.1). There were several phylotypes represent- ysis indicated that the number of analyzed clones was ing clusters affiliated with the family Cellulomonadaceae sufficient to give reasonable coverage at a sequence sim- (9 clones), Microbacteriaceae (43 clones), Micrococ- ilarity threshold of 95% (Fig. 1). caceae (3 clones), Coriobacteriaceae (10 clones), and Mycobactericeae (1 clone) (Fig. 4). Almost all the clones had the highest sequence similarity hit with clones that Phylogenetic affiliation of 16S rDNA phylotypes were extracted from the gut of Coptotermes formosanus Shiraki as deposited in NCBI. Bacteroidetes were the most abundant microbes in the The majority of the remaining clones (1.3% of the li- gut of C. curvignathus. A total of 744 clones were assigned brary) belonged to the phylum Proteobacteria.Mostof to Bacteroidetes and the most abundant clones were rep- the clones were Gammaproteobacteria of the family En- resented by phylotypes MgKI3d011C08 (649 clones) and terobacteriaceae. Phylotypes MgKI3d002c04 (6 clones) 3d011e08 (8 clones) (Fig. 2). These phylotypes shared shared 99% sequence similarity with Serratia marcescens

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 Bacterial microbiome of Coptotermes curvignathus 587

120

100

40 Observed OTUs 20

Number of sequenced clones

Fig. 1 Rarefaction analysis of all bacterial 16S rRNA gene clones recovered from the digestive trait of Coptotermes curvignathus.The expected number of clones was calculated from the number of clones analyzed at a sequence similarity level of 95%. isolated (Fig. 5). There were 1 phylotype each assigned related than phylotype MgKI3d003g11, which was close to Class Alphaproteobacteria, Betaproteobacteria, and neighbored with the uncultured endomicrobia in termite Deltaproteobacteria. Cryptotermes spp. gut (99% sequence similarity). Phyla Spirochetes, Deferribacteres, Candidate TG1, The Blast-n result showed that higher percentage of Verrucomicrobia, Planctomycetes, and Candidate Divi- similarity in gut microbiome assemblage was observed sion TM7 were only scarcely represented. Only 2% of when compared to C. formosanus. About 25% of the phy- total analyzed clones belonged to spirochetal sequences lotypes in C. curvignathus library had highest similar- (Fig. 6). All the spirochetal clones clustered together ity (95%–99% sequence similarity) to sequences from C. among a group exclusively of termite. The phylotypes formosanus. This is relatively higher than the percentage MgKI1c3g09, MgKI1c2b06, and MgKI3e02 formed a of phylotypes in C. curvignathus library with the high- monophyletic clade that was distantly related to other est sequence similarity to sequences from Reticulitermes spirochetes of other termite species. spp. (16%). Two phylotypes in the libraries belonged to phylum Planctomyctes. Phylotype MgKI1c001a06 was closely affiliated (99% sequence similarity) with an Discussion uncultured Planctomycetes from the gut of C. formosanus (NCBI Sequence ID: GQ502587.1) but The predominance of spirochetes observed in the gut of only shared about 95% sequence similarity with R. speratus (Isoptera: Rhinotermitidae) (Nakajima et al., the uncultured Planctomyctes from Reticulitermes chi- 2005) was an obvious distinguishing factor of gut mi- nensis Snyder (NCBI Sequence ID: JQ617849.1). crobiome between 2 members of family Rhinotermitidae: Phylotype MgKI1c002e07 was neighbored by Planc- Reticulitermes and Coptotermes. In the gut of C. curvi- tomyctes sequences from anaerobic digesters (Fig. 7). gnthaus, Spirochetes only constituted about 2% in the Four clones represented by phylotypes MgKI1c001f09 clone libraries, whereas Spirochetal clones accounted for and 3d011g07 were assigned to uncultured Verrucomi- approximately half of the analyzed clones in R. spera- crobia from termite guts (97% sequence similarity with tus (Hongoh et al., 2003). Interestingly, the differences sequences from C. formosanus). Five clones repre- are not limited to Spirochetes; Bacteriodetes were more sented by Phylotypes MgKI3d005a03, MgKI3d005h11, represented in the gut of C. curvignathus (65% of an- MgKI1c003e08, and MgKI1c001h12 formed a single alyzed clones) than R. speratus (Hongoh et al., 2003). clade with members of the candidate division TM7. However, when compared to R. speratus (Hongoh et al., Phlyotype MgKI3d002e04 belonged to the phylum De- 2003), depletion of bacterial members belonged to TG1 ferribacteres, with the next closest uncultivated Defer- was observed in C. curvignathus microbiome (approxi- ribacteres from the gut of termite Macrotermes gilvus mately 0.3%). In a library of 1 344 clones, microbiome Hagen. Phylotypes MgKI3d002e09, MgKI3d003g11, and of the R. speratus gut contains 42%–63% of Spirochetal MgKI1c001h07 formed a large cluster with TG1 that clones, whereas clones related to Bacteroides and the can- consists exclusively of clones from termite. Phylotypes didate division TG1 each accounted for about 5%–15% MgKI3d002e09 and MgKI1c001h07 were more closely of the sequenced clones (Hongoh et al., 2003).

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 588 J. H. P.King et al.

gi|14388586 uncul endosymb. of P. grassii in C. formosanus Bcf1-03 gi|212548595 Azobacteroides pseudotrichonymphae CFP2 DNA Endosymbiont of MgKI3d011C08.g1 metanew.1.799 Pseudotrichonymphae gi|119359918|Uncul.endosymb pseudotricho. Ma79Cp-S1 gi|27530155 Uncultured Bacteroidaceae Rs-D29 MgKI 3d002D02.g1 metanew.1.219 gi|371500906 Uncultured Porphyromonadaceae SL25 Shelfordella lateralis MgKI3d003C02.b1 metanew.1.349 gi|259377003 Uncul Bacteroidetes bacterium clone Cf2-14 gi|154347326 Uncul Bacteroidales Cc3-005 Crytotermes cavifrons MgKI 3d005B07.b1 metanew.1.623 gi|71609935 Uncultured Bacteroidales RsW01-039 MgKI 3d002G01.b1 metanew.1.270 gi|259377030 Uncultured Bacteroidetes Cf2-07 gi|371496575 Uncultured Porphyromonadaceae Rs1-2 gi|259377029Uncult Bacteroidetes Cf2-06 MgKI 3d002b02bg1 MgKI 3d003g03bg1 MgKI 3d001h07bg1 MgKI 3d003B04.b1metanew.1.337 gi|295026932 Uncultured PS2398 Finland dung compost gi|145284821 Uncultured 23e10 upflow microbial fuel cell anode MgKI3d002G04.b1 metanew.1.276 MgKI 3d001B05.b1 metanew.1.25 Porphyromonadaceae gi|291088359 Uncultured Bacteroidetes RsStar109 MgKI 3d002A03.b1 metanew.1.164 gi|307219169 Dysgonomonas hofstadii JCM 17038 gi|45934830Bacteroidetes Culture dependent gut bacterium in C. formosanus MgKI3d011E03.b1 metanew.1.826 gi|259377021 Uncultured Bacteroidetes Cf2-33 Dysgonomonas gi|329568080 Dysgonomonas sp. activated sludge/degrade/amoxicillin gi|329568080 Dysgonomonas/Porphyromonadaceae/sludge/degrade/amoxicillin MgKI 3d004F09.b1 metanew.1.557 gi|259377002 Uncultured Bacteroidetes Cf2-13 Tannerella gi|373279182 Tannerella forsythia canine oral OB071 Porphyromonadaceae gi|85542697 Tannerella forsythensis MgKI3d004D01.b1 metanew.1.513 gi|78483847Uncultured Bacteroidales RPK-40 gi|373279908 Paludibacter sp. canine oral 2C058 MgKI3d001B10.b1 metanew.1.35 MgKI3d005C10.b1 metanew.1.647 gi|237941305 Uncultured Bacteroidetes QEDN2DG08 mesophi/anaerobe gi|359472430 UncultJXS2-39 anaerob/degrade/tetrabromobisphenol A gi|314912322 Uncultured Cytophagales Clip 86 Sphingobacteriales Cytophagales gi|126131304Uncultured Bacteroidetes 24-9G methanogenic communities MgKI3d005D09.b1 metanew.1.664 gi|27530133|dbj|AB088921.1| Uncultured Bacteroidetes Rs-E47 MgKI3d001A01.b1 metanew.1.1 gi|371500934 Uncultured Rikenellaceae SL48 Shelfordella lateralis Rikenellaceae gi|211908255 Uncul PeHg61 hindgut/humivorous-scarab-beetle-larvae gi|84875239Uncultured Bacteroidales MgMjW-42 Macrotermes gilvus

0.02

Fig. 2 Phylogenetic relationships of the phylotypes in Bacteroidetes. The tree was inferred by the neighbor joining with 1 000 Bootstrap replications with 1 241 unambiguously aligned nucleotide positions (MEGA 5.10). Phylotypes from this study are shown in bold. The scale bar represents a 2% estimated sequence divergence.

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 Bacterial microbiome of Coptotermes curvignathus 589

MgKI3d001b01 gi|56126317 Uncultured PBg1-030 Protaetia brevitarsis gi|259377050 Uncultured Firmicutes Cf4-44 gi|27530179 Uncultured Clostridiaceae Rs-P37 MgKI 3d002e07b1 gi|194139226 Uncultured bact. bovine/glycoside hydrolases gi|259377054 Uncultured Firmicutes Cf4-50 MgKI3d002B08.b1 metanew.1.188 gi|259377049 Uncultured Cf4-42 MgKI3d003H08.b1 metanew.1.451 MgKI3d002A10.b1 metanew.1.176 gi|259150393 Uncultured marine s5 0 IV 25 arctic marine gi|40217927 Acetanaerobacterium elongatum Z7 gi|84875307 Uncul Clostridiales / Macrotermes gilvus gi|38371689 Uncultured Clostridiaceae Rs-B34 MgKI3d003C12.b1 metanew.1.364 rc gi|78483756 Uncultured Clostridiaceae RsTz-59 MgKI3d005H02.b1 metanew.1.734 gi|4335656 Unidentified Eubacterium anaeronic digester gi|75446493 Ruminobacillus xylanolyticum gi|71609987 Uncultured Clostridiales RsW02-041 gi|110451179 Uncultured RL185 aao70a10 human gut MgKI3d004G05.b1 metanew.1.570 gi|259377089 Uncultured Firmicutes Cf4-94 Clostridia MgKI3d005F11.b1 metanew.1.710 MgKI 3d002G05.b1 metanew.1.278 gi|295410017 Uncultured Camel AAR 151 gi|27530189 Uncultured Clostridiales Rs-J39 MgKI 3d001e06bg1 MgKI3d001C10.b1 metanew.1.53 gi|71609938 Uncultured Clostridiales RsW01-043 gi|14328896 Uncultured bacterium BCf10-04 MgKI3d001E09.b1 metanew.1.96 MgKI 3d011e06.b1 metanew.1.678 rcm MgKI3d005E06.b1 metanew.1.678 rc MgKI 3d002f02bg1 rcm gi|259377087 Uncultured Cf4-91 gi|375161406 Uncultured Clostridiales Rc107 R. chinensis gi|27530228 Uncultured Clostridiales Rs-A47 MgKI3d005G03.b1 metanew.1.717 MgKI 3d005d01 rcm MgKI3d002E02.b1 metanew.1. gi|259377103 Uncultured Firmicutes Cf4-20 gi|572627 Clostridium aminobutyricum DSM 2634 MgKI 3d011F09.g1 metanew.1.860 gi|14349223 Uncultured BCf9-13 gi|259377039 Uncultured Cf4-32 gi|169274685 Uncultured HH aai34a08 hedgehog MgKI 3d002C11.b1metanew.1.212 MgKI3d002C11.b1 metanew.1. rc gi|359805291 Enterococcus canis NBRC gi|319516240 Uncultured homo sapiens intestinal specimen gi|359805289 Enterococcus asini NBRC 100681 gi|50513079 Uncultured RsaHf388 gi|343202583 Pilibacter termitis TI-1 Lactobacillales MgKI 3d002G11.b1 metanew.1.286 gi|192985701 Uncultured PB1 aai27c04 polar/bear/feaces MgKI1c001D01.b1 biodiversityassemble.0.69 rc MgKI1c001D09 gi|387286041 Lactococcus garvieae M-T-MRS 45 roach gi|343202334 Leuconostoc holzapfelii LMG 23990 gi|297039802 Leuconostoc citreum culture IMAU:80242 MgKI 3d011F06b1 metanew.1.853 rcm MgKI 1c002B12.b1 biodiversityassemble.0.232 gi|27530269 Uncultured Mycoplasma Rs-E42 MgKI 1c001F07.b1 biodiversityassemble.0.126 gi|194139006 Uncultured 1103200831759 bovine rumen MgKI 3d002H09.b1 metanew.1.303 rcm gi|371500975 Uncultured Erysipelotrichi SL126 Mollicutes gi|265679027 Holdemania filiformis J1-31B-1 human feces gi|219846111 Spiroplasma culicicola AES-1 Aedes sollicitans gi|3212129Spiroplasma sp. gi|50513085Uncultured RsaHf231 MgKI 3d004c05bg1 rcm MgKI 3d003e08bg1 rcm

Fig. 3 Phylogenetic relationships of the phylotypes in Firmicutes. The tree was inferred by the neighbor joining with 1 000 Bootstrap replications with 1 344 unambiguously aligned nucleotide positions (MEGA 5.10). Phylotypes from this study are shown in bold.

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 590 J. H. P.King et al.

MgKI3d004G06.b1 metanew.1.572 rc MgKI3d003H07.b1 metanew.1.449 gi|259376987 Uncultured Cf1-15 MgKI3d011A04.b1 metanew.1.757 rc Cellulomonadaceae gi|375161439 Uncultured Rc577 R. chinensis gi|265678983 Cellulosimicrobium cellulans gi|10185051Cellulomonas sp. Cellulomonadaceae gb|CP001819.1 Sanguibacter keddieii gi|296061807 Micrococcineae from seaweed gi|343201005 Serinibacter salmoneus Beutenbergiaceae gi|390431661 Uncultured Leucobacter gi|343201562|ref|NR 042288.1| Leucobacter aridicollis MgKI3d005D06.b1 metanew.1.660 rc gi|343202407 Agrococcus versicolor gi|74483630 Uncultured J12 Fermentative biohydrogen Microbacteriaceae MgKI3d005A09.g1 metanew.1.610 rc gi|343200927 Pseudoclavibacter soli beta-glucosidase gi|157144266 Pseudoclavibacter sp. soil gi|259376998 Uncultured actinobacterium Cf1-09 MgKI3d004A12.b1 metanew.1.476 gi|168495490 Saccharopolyspora sp. Pseudonocardiaceae gi|372199310 Saccharopolyspora sp. MgKI3d004f08.b1 gi|343201539 Mycobacterium mageritense Mycobacteriaceae gi|381217400 Mycobacterium sphagni / jatropha

MgKI3d003F02.b1 metanew.1.402 gi|259376991 Uncultured Cf1-02 gi|343198543 Eggerthella sinensis gi|259376984 Uncultured Cf1-12 MgKI3d005C11.b1 metanew.1.648 rc Coriobacteriaceae gi|259376994 Uncultured Cf1-05 gi|259376995 Uncultured Cf1-06 MgKI3d003d12bg1 rcm MgKI3d002D09.b1 metanew.1.225 rc

0.02

Fig. 4 Phylogenetic relationships of the phylotypes in actinobacteria. The tree was inferred by the neighbor-joining methods with 1 271 unambiguously aligned nucleotide positions. Phylotypes determined in this study are indicated in bold. The scale bar represents a 2% estimated sequence divergence.

Results from the Blast-n indicated that C. curvignthus diet preference. Although both Coptotermes spp. and shared more enterotypes with C. formosanus than Retic- Reticulitermes spp. feed on wood, Coptotermes spp. are ulitermes spp. These observations suggest codivergence evidently more obvious in feeding on living trees and of intestinal microbes with genusiation their host. The consume more solid wood in the field than Reticuliter- phylogenetic distances among C. curvignathus, C. for- mes spp. (Lenz et al. 1991). Feeding preference between mosanus, and Reticulitermes spp. were to some extent these 2 genera also has been reported by Cornelius et al. reflected among their microbial gut communities. Co- (2003) as well as Morales-Ramos and Rojas (2003) where divergence of gut microorganisms with host termites is the wood consumption of Reticulitermes spp. is generally probably established through strict vertical transmissions negatively correlated with wood hardness, whereas Cop- along the evolutionary lineages via proctodeal trophal- totermes are more related to the nutritional components of laxis. the wood. In general, species of Coptotermes are known to Besides the phylogenetic distance between genera Cop- have greater capacity for destruction than Reticulitermes. totermes and Reticulitermes, the differences in their gut Modulation of gut microbiome composition associated microbial assemblages could also be the result of their with dietary pattern has been established in many studies

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 Bacterial microbiome of Coptotermes curvignathus 591

65 MgKI3d002c04bg1 gi|257072772 Uncultured Serratia F7 Enterobacteriales

gi|330717278 Uncultured Serratia potassium mine soil

86 gi|257073817 Uncultured Serratia F3 degreasing syst

gi|161353268 Pseudomonas sp.

gi|157812603 S. marcescens P1 lactate to pyruvate 100 MgKI3d004b04bg1

MgKI3d001g01bg1 53 gi|322086668 Uncultured ncd1480d01c1 87 gi|359805162 S. marcescens subsp. marcescens 100 Gammaproteobacteria gi|359803185 Cronobacter sakazakii gamma/enterobact

MgKI3d003D09.b1 metanew.1.376 rcmt 91 79 gi|383288246 Mangroveibacter sp. / hydrocarbon-deg

MgKI3d001H09.b1 metanew.1.156

99 gi|15778357 Pseudomonas sp. 5A Pseudomonadaceae 100 gi|387568134 P. xanthomarina HWG-A18

81 83 MgKI3d003D03.b1 metanew.1.368 100 gi|347300771 Uncultured Pseudomonas sp. ELC0606

99 gi|159906307 Pseudomonas putida strain XJUHX-1

93 gi|159906318 Pseudomonas plecoglossicida XJUHX-15 86 gi|220937343 Uncultured beta proteobacterium Z4MB39

gi|259377124 Uncultured Cf6-06 betaproteo Betaproteobacteria 100 100 MgKI3d003B02.b1 metanew.1.335

gi|343201454 Beijerinckia mobilis / methanotrophic Alphaproteobacteria 100 MgKI3d004H09.b1 metanew.1.595 rcmt

gi|169665578 Bacteriovorax sp. w5-4 Bdellovibrionales

gi|209869228 Uncultured delta proteobacterium 63 EDB1 100 Deltaproteobacteria 79 MgKI3d003F12.b1 metanew.1.416

gi|86261828 Uncultured Verrucomicrobia

0.05

Fig. 5 Phylogenetic relationships of the phylotypes in Proteobacteria. The tree was inferred by the neighbor-joining methods with 1 274 unambiguously aligned nucleotide positions. Phylotypes determined in this study are indicated in bold. Bootstrap values are indicated at the nodes. The scale bar represents a 5% estimated sequence divergence. especially in humans (De Filippo et al., 2010; Martin The diversity of Bacteroidetes in the gut of C. curvi- et al., 2010; Wu et al., 2011; Neyrinck et al., 2012), how- gnathus was very diverse, ranging from family Porphy- ever the microbial dimension in insect nutritional ecology romonadaceae, Cytophagales, and Rikenellaceae to the is gaining recognition (Douglas, 2009). The study of gut endosymbiont of flagellate Pseudotrichonymphae. Bac- microbiome modulation linked with dietary pattern could teroidetes were known to exhibit a variety of cellular help explain the variation in microbial diversity and dis- morphologies and were extremely heterogeneous in their tribution among closely related termite species. biochemical and physiological attributes (Skerman et al.,

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 592 J. H. P.King et al.

92 gi|259377164 Uncultured Spirochaetes Cf7-72 86 gi|259377164 Uncultured Spirochaetes Cf7-72 17 MgKI1c2G10.b1 biodiversityassemble.0.344 Ucl bact.767 52 gi|78483105 Uncultured Treponema/Microcerotermes sp. gi|18077621 Spirochaeta sp. / Neotermes castaneus 40 68 gi|551667 Spirocheta sp. / Mastotermes darwiniensis 49 MgKI1c2C11g1 biodiversityassemble.0.255 .688 gi|259377133 Uncultured Spirochaetes Cf7-35 gi|259377175 Uncultured Spirochaetes Cf7-20 MgKI1c3G09.b1 biodiversityassemble.0.515 .751

100 MgKI1c2B06.b1 biodiversityassemble.0.220 .780 36 MgKI1c3E02g1 biodiversityassemble.0.457 .606

0.1

Fig. 6 Phylogenetic relationships of the phylotypes in Spirochetes. The tree was inferred by the neighbor-joining methods with 600 unambiguously aligned nucleotide positions. Phylotypes determined in this study are indicated in bold. Bootstrap values are indicated at the nodes. The scale bar represents a 10% estimated sequence divergence.

96 gi|30838632| Uncultured Endomicrobia Cryptotermes dudleyi 46 gi|154347332 Uncultured Termite group 1 Crytotermes cavifrons 49 gi|157908447 Uncult. TG1 endosymb. Snyderella sp. / Crytotermes secundus 61 MgKI3d003G11.b1 metanew.1.434 100 gi|308386320 Uncultured Endomicrobia Neotermes castaneus Termite Group 1 83 gi|37360639 Uncultured Termite group 1 Reticulitermes speratus 94 gi|50513057 Uncult endosymbiont of Pyrsonympha vertens R. santonensis 80 gi|78483806 Uncultured Termite group 1 R. speratus 100 MgKI1c001H07.b1 biodiversityassemble.0.174 56 MgKI3d002E09.b1 metanew.1.248 rc MgKI3d002E04.b1 metanew.1.239 Deferribacteres 100 gi|84875347 Uncultured Deferribacteres / Macrotermes gilvus 54 99 gi|259377188| Uncultured Verrucomicrobia Cf9-04 C. formosanus 100 MgKI1c001f09 Verrucomicrobia gi|86261828 Uncultured Verrucomicrobia Hodotermopsis sjoestedti gi|253762533 Uncultured bacterium / anaerobic digester 68 100 MgKI1c002E07.b1 biodiversityassemble.0.294 100 100 gi|375161431 Uncultured Planctomycetales Rc81 Planctomycetes 100 gi|259377108 Uncultured planctomycete clone Cf5-01 100 MgKI1c001A06.b1 biodiversityassemble.0.11 100 MgKI3d005A03.g1 metanew.1.603 gi|14537914TM7 phylum sp. oral clone CW040 TM7 100 gi|86261866 Uncultured candidate division TM7 Neotermes koshunensis 100 gi|259377185 Uncultured candidate division TM7 Cf8-02 C. formosanus gi|166164468 Candidatus Nitrosocaldus yellowstonii

0.05

Fig. 7 Phylogenetic relationships of the phylotypes in other phyla. The tree was inferred by neighbor-joining methods with 1 200 unambiguously aligned nucleotide positions. Phylotypes determined in this study are indicated in bold. Bootstrap values are indicated at the nodes. The scale bar represents a 5% estimated sequence divergence.

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 Bacterial microbiome of Coptotermes curvignathus 593

1989). Their versatility helps them establish at different crase, an extracellular enzyme involved in the synthesis niches in the termite gut. The percentage of Bacteroidetes reaction of dextran from sucrose (Barker & Ajongwen, present in the gut of C. curvignathus (65% of clones 1991). Lactic acid bacteria also contribute to effective library) is one of the highest among all other studied ter- oxygen reduction in termite gut that is vital in maintain- mite species. They are the most abundant microbes in the ing microoxic zones for the strictly anaerobic symbiont gut of C. curvignathus and probably play an active role (Tholen et al., 1997; Bauer et al., 2000; Higashiguchi in the degradation of polysaccharides from plant fibers, et al., 2006). Other than that, P.termitis maybeinvolvedin such as cellulose, xylan, arabinogalactan, and pectin at sugar fermentation and pH regulation of the gut (Hutkins an anoxic condition in the termite gut. De Filippo et al. & Nannen, 1993). Several lactic acid bacteria that are in- (2010) reported a positive correlation of Bacteroidetes volved in carbon and nitrogen recycling by metabolizing enrichment in subjects with a high-fiber diet. uric acid have also been reported (Potrikus & Breznak, Bacteroidetes are associated with a wide variety of 1981). This is important as termites consume wood hav- gut protist species as either intracellular endosymbionts ing low-nitrogen content (approximately 0.03%–0.15%) or surface-attached ectosymbionts (Noda et al., 2009). of wood diet (Potrikus & Breznak, 1981). The most abundant clones represented by phylotype Clostridia spp. were major genus of Firmicutes in C. MgKI3d011C08 were endosymbionts of flagellate Pseu- curvignathus (44% of Firmicutes clones). They are dis- dotrichonymphae. Pseudotrichonymphae grasii is an im- tinguished from the Bacilli by lacking aerobic respiration. portant enterophyte in termites’ gut that aids in lignocellu- Members of Clostridiales in the clone library include C. losic digestion. In a controlled feeding study, P.grasii that saccharolyticum, C. amygdalinum, and Acetanaerobac- was found in great abundance in the gut microbiome of C. terium. Acetanaerobacterium generate hydrogen from formosanus (Noda et al., 2005) was completely lost when the glucose during their anaerobic respiration (Miyake fed on a low-molecular weight carbohydrate diet (Tanaka et al., 1984; Taguchi et al., 1992; Chen & Dong, 2004). et al., 2006). This is a marked case of linking lignocellu- Clostridia are believed to be the major contributor to the losic diet with protist P.grasii. hydrogen available for other metabolisms in the termite Phylotype MgKI3d011C08 shared 98%–99% sequence gut (Cao et al., 2010). Without Clostridia, important pro- similarity with phylotype Bcf1–03 that constitutes 70% cess such as H2-dependent acetogenesis and methanogen- of the 261 analyzed clones from C. formosanus (Shinzato esis may be adversely affected (Breznak & Switzer, 1986; et al., 2005). Both phylotypes were found in great abun- Brauman et al., 1992). Based on culture independent stud- dance (more than 60%) in C. curvignathus and C. for- ies, acetogenic clostridial species are one of the major mosanus, respectively. Phylotypes MgKI3d011C08 and groups in termites (Hongoh et al., 2003, 2006; Shinzato Bcf1–03 were similar, but there were more than 29 single et al., 2005, 2007; Yang et al., 2005). Many Clostridia nucleotide polymorphism (SNP) within their 16S rRNA degrade polysaccharides to produce acetone, alcohol, ac- genes. This may be another evidence of cospeciation of etate, lactate, carbon dioxide, and hydrogen (Johnston & bacteria symbiont with host termite. Goldfine, 1985; Chen, 1995), and some Clostridia involve The phylotype MgKI3d011C08 outnumbered others by in nitrogenous or lipid compounds fermentation (Elsden several orders of magnitude. This indicates not only the & Hilton, 1979). Clostridia produce end products such as importance of its metabolic contribution to the nutritional short-chain fatty acids, for example, butyric acid, acetic ecology of C. curvignathus and Pseudotrichonymphae but acid, butanol, and acetone, which are important physi- also the presence of Pseudotrichonymphae in C. curvig- ological energy source for colonic cells and play a vi- nathus. However, this does not imply the abundance of tal role in the maintenance of hindgut health (Roediger Pseudotrichonymphae in C. curvignathus as it has been et al., 1989; Basson & Sgambati, 1998). There are some established that a single flagelate protist P. grasii can ac- members of the Clostridia that produce cellulosomes and commodate 1.08 × 105 ± 0.04 × 105 bacteroidetes en- noncellulosomal (hemi)cellulolytic enzymes to degrade dosymbiont (Noda et al., 2005). plant cell walls (Han et al., 2004) and some exhibit high About 15% of analyzed clones belonged to Firmicutes xylanase or pectate lyase expression such as C. cellulovo- and 49% of these were Lactobacillales, and 44% were rans. This explains the importance of Clostridia to the Clostridia. Phylotype 3d011c05 was the most abundantly versatile metabolism in the gut of C. curvignathus. found Firmicutes with 99% sequence similarity with L. In Reticulitermes spp., spirochetes constituted 42%– garvieae. Other lactic acid bacteria found in C. curvi- 63% of the total gut bacteria (Hongoh et al., 2003), gnathus were the L. citreum, Enterococcus spp., Strep- whereas in this study, they comprise only 2% of total tococcus spp., O. guilliermondii, and P. termitis. Lactic analyzed clones from the gut of C. curvignathus. The de- acid bacteria are known to be the producer of dextransu- pletion of Spirochetes (11.3% of 1 876 analyzed clones)

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 594 J. H. P.King et al. in gut microbiome assemblage was also observed in C. as well as protection against opportunistic pathogen. The formosanus (Husseneder et al., 2010). Spirochetes are mutual symbiosis relation of the gut microbiome with the undoubtedly an important group of the natural termite host termite is established through coevolution that can microbiota, which contribute to termite nutrition via ace- be observed in the phylogenetic studies on termites’ en- tonegenesis from H2 plus CO2 (Leadbetter et al., 1999). terotypes. The capability of C. curvignathus to feed on However, the reduction in Spirochetal composition in the healthy living tree tissues is indeed remarkable digestion gut of Coptotermes spp. reflects a decline in host termite adaptability, linking termite nutritional ecology with its dependency on Spirochetes. On the other hand, a sharp gut microbial enterotypes. increase in the abundance of Bacteroidetes endosymbiont of Pseudotrichonymphae was observed in Coptotermes gut microbiome. The key factor attributed to this modu- Acknowledgments lation of gut microbiome composition is still obscure at this time. However, it may be due to its dietary preference. This work was supported by grants from the Ministry Most of the wood feeder termites feed on dry dead wood of Science, Technology and Innovation, Malaysia under or semi to partially degraded wood residues; however, Genomics and Molecular Biology R&D Initiatives 10– unlike these termites, C. curvignathus preferentially con- 05-MGI-GMB001 and Universiti Putra Malaysia under sumes living plant (Bong et al., 2012). In peat area where Research University Grant Scheme 05–03–10–0964RU. C. curvignathus is vastly found, the decomposition rate was slow. C. curvignathus has evolved and adapt to feed on living plant instead of decomposed wood residue. There- Disclosure fore, C. curvignathus is considered a natural living plant pest, whereas its closest phylogeny, C. formosanus,isan There are no conflicts of interest among authors involved occasional pest that feeds mostly on dead wood, and Reti- in this manuscript. culitermes feed on tree stump or dead wood. Generally, the diet adaptation comes naturally with gut microbiome modulation. Feeding on living trees means the diet of C. References curvignathus has much higher water content than other wood feeder species. Higher water content diet is impor- Barker, P.E. and Ajongwhen, N.J. (1991) The production of the tant for the free living prostist Pseudotrichonymphae to enzyme dextransucrase using nonaerated fermentation tech- flourish in the gut of C. curvignathus. From the phylo- niques. Biotechnology and Bioengineering, 37, 703–707. gentic study (Fig. 6), 60% of the spirochetal phylotypes Basson, M.D. and Sgambati, S.A. (1998) Effects of short-chain in this study form a monophyletic cluster exclusively com- fatty acids on human rectosigmoid mucosal colonocyte brush- posed of C. curvignathus gut-derived clones. This could border enzymes. Metabolism, 47, 133–134. be an indication of cospeciation of Spirochetes with C. Bauer, S., Tholen, A., Overmann, J. and Brune, A. (2000) Char- curvignathus. acterization of abundance and diversity of lactic acid bacteria In summary, the reported phylogenetic distribution of in the hindgut of wood- and soil-feeding termites by molec- cloned rRNA genes in the bacterial domain was consider- ular and culturedependent. Archives of Microbiology, 173, ably different from other termite species. The difference 126–137. in phylogenetic composition of the gut microbes among Brauman, A., Kane, M.D., Labut, M. and Breznak, J.A. (1992) R. speratus, C. formosanus, and C. curvignathus reflects Genesis of acetate and methane by gut bacteria of nutritionally the strong selection pressures inherent in such tiny (1 μL diverse termites. Science, 257, 1384–1387. of volume), yet physiological delicate, environment in Breznak, J.A. and Switzer, J.M. (1986) Acetate synthesis from the intestine where natural gut microbes have to adapt H2 plus CO2 by termite gut microbes. Applied and Environ- themselves to the specific diet of their host. Single and mental Microbiology, 52, 623–630. specific diet such as a living tree or sound wood would Bong, J.C.F., King, P.J.H., Ong, K.H. and Nor, M.M. (2012) Ter- favor some microbial species to flourish and change the mite assemblages in oil palm plantation in Sarawak, Malaysia. composition of the gut bacterial community that reshapes Journal of Entomology, 9, 68–78. the physicochemistry of the gut. The physiocochemistry Chen, J.S. (1995) Alcohol-dehydrogenase–multiplicity and re- of the gut will constraint and conserve the gut microbial latedness in the solvent-producing clostridia. FEMS Microbi- assemblage, and vice versa, and the firmly established ology Letters, 17, 263–273. gut microbiome will maintain the physiocochemical con- Chen, S. and Dong, X. (2004) Acetanaerobacterium elongatum dition of the gut and provide available nutrients to the host gen. nov., sp. nov., from paper mill waste water. International

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 Bacterial microbiome of Coptotermes curvignathus 595

Journal of Systematic and Evolutionary Microbiology, 54, Leadbetter, J.R., Schmidt, T.M., Graber, J.R. and Breznak, J.A.

2257–2262. (1999) Acetogenesis from H2 plus CO2 by spirochetes from Cao, Y., Sun, J.Z., Rodriguez, J.M. and Lee, K.C. (2010) Hy- termite guts. Science, 283, 686–689. drogen emission by three wood-feeding subterranean termite Lenz, M., Amburgey, T.L., Dai, Z.R., Mauldin, J.K., Preston, species (Isoptera: Rhinotermitidae): Production and charac- A.F., Rudolph, D. and Williams, E.R. (1991) Interlabora- teristics. Insect Science, 17, 237–244. tory studies on termite-wood decay fungi associations: II. Cornelius, M.L., Daigle, D.J., Connick, W.J. Jr., Williams, K.S. Response of termites to Gloeophyllum trabeum grown on dif- and Lovisa, M.P. (2003) Responses of the Formosan subter- ferent species of wood (Isoptera: Mastotermitidae, Termop- ranean termite (Isoptera: Rhinotermitidae) to wood blocks in- sidae, Rhinotermitidae, Termitidae). Sociobiology, 18, 203– oculated with lignin-degrading fungi. Sociobiology, 41, 513– 254. 525. Marchesi, J.R., Sato, T., Weightman, A.J., Martin, T.A., Fry, De Filippo, C., Cavalieri, D., Di Paola, M., Ramazzotti, M., Poul- J.C., Hiom, S.J., Dymock, D. and Wade, W.G. (1998) Design let, J.B., Massart, S., Collini, S., Pieraccini, G. and Lionetti, and evaluation of useful bacterium-specific PCR primers that P. (2010) Impact of diet in shaping gut microbiota revealed amplify genes coding for bacterial 16S rRNA. Applied and by a comparative study in children from Europe and rural Environmental Microbiology, 64, 795–799. African. Proceedings of the National Academy of Sciences of Martin, F.P., Sprenger, N., Montoliu, I., Rezzi, S., Kochhar, S. the United States of America, 107, 14691–14696. and Nicholson, J.K. (2010) Dietary modulation of gut func- Douglas, A.E. (2009) The microbial dimension in insect nutritional ecology studied by fecal metabonomics. Journal of tional ecology. Functional Ecology, 23, 38–47. Proteomic Research, 9, 5284–5295. Elsden, S.R. and Hilton, M.G. (1979) Amino-acid utilization Miyake, J., Mao, X.Y. and Kawashima, S. (1984) Photopro- patterns in clostridial taxonomy. Archives of Microbiology, duction of hydrogen from glucose by a co-culture of photo- 123, 137–141. synthetic bacterium and Clostridium butyricum. Journal of Han, S.O., Cho, H.Y.,Yukawa, H., Inui, M. and Doi, R.H. (2004) Fermentation Technology, 62, 531–535. Regulation of expression of cellulosomes and noncelluloso- Morales-Ramos, J.A. and Rojas, M.G. (2003) Nutritional ecol- mal (hemi)cellulolytic enzymes in Clostridium cellulovorans ogy of the Formosan subterranean termite (Isoptera: Rhinoter- during growth on different carbon sources. Journal of Bacte- mitidae) growth and survival of incipient colonies feeding riology, 186, 4218–4227. onpreferred wood species. Journal of Economic Entomology, Higashiguchi, D.T., Husseneder, C., Grace, J.K. and Berestecky, 96, 106–116. J.M. (2006) Pilibacter termitis gen. nov., sp nov., a lactic acid Nakajima, H., Hongoh, Y., Usamib, R., Kudo, T. and Ohkuma, bacterium from the hindgut of the Formosan subterranean M. (2005) Spatial distribution of bacterial phylotypes in the termite (Coptotermes formosanus). International Journal of gut of the termite Reticulitermes speratus and the bacterial Systematic and Evolutionary Microbiology, 56, 15–20. community colonizing the gut epithelium. FEMS Microbiol- Hongoh, Y., Ekpornprasit, L., Inoue, T., Moriya, S., Trakul- ogy Ecology, 54, 247–255. naleamsai, S., Ohkuma, M., Noparatnaraporn, N. and Kudo, Nalepa, C.A., Bignell, D.E. and Bandi, C. (2001) Detritivory, T. (2006) Intracolony variation of bacterial gut microbiota coprophagy, and the evolution of digestive mutualisms in Dic- among castes and ages in the fungus growing termite tyoptera. Insectes Sociaux, 48, 194–201. Macrotermes gilvus. Molecular Ecology, 15, 505–516. Nazarczuk, R.A, O’Brien, R.W. and Slaytor, M. (1981) Al- Hongoh, Y., Ohkuma, M. and Kudo, T. (2003) Molecular anal- teration of the gut microbiota and its effect on nitrogen ysis of bacterial microbiota in the gut of the termite Retic- metabolism in termites. Insect Biochemistry, 11, 267–275. ulitermes speratus (Isoptera; Rhinotermitidae). FEMS Micro- Neyrinck, A.M., Possemiers, S., Verstraete, W., Backer, F.D., biology Ecology, 44, 231–242. Cani, P.D. and Delzenne, N.M. (2012) Dietary modulation Husseneder, C., Ho, H.Y.and Blackwell, M. (2010) Comparison of clostridial cluster XIVa gut bacteria (Roseburia spp.) by of the bacterial symbiont composition of the Formosan sub- chitin–glucan fiber improves host metabolic alterations in- terranean termite from its native and introduced range. Open duced by high-fat diet in mice. Journal of Nutritional Bio- Microbiology Journal, 4, 53–66. chemistry, 23, 51–59. Hutkins, R.W. and Nannen, N.L. (1993) pH homeostasis in Noda, S., Hongoh, Y.,Sato, T. and Ohkuma, M. (2009) Complex lactic-acid bacteria. Journal of Dairy Science, 76, 2354– coevolutionary history of symbiotic Bacteroidales bacteria 2365. of various protists in the gut of termites. BMC Evolutionary Johnston, N.C. and Goldfine, H. (1985) Phospholipid aliphatic Biology, 9, 158. chain composition modulates lipid class composition, but not Noda, S., Iida, T., Kitade, O., Nakajima, H., Kudo, T. and lipid asymmetry in Clostridium butyricum. Biochimica et Bio- Ohkuma, M. (2005) Endosymbiotic Bacteroidales bacteria physica Acta, 813, 10–18. of the flagellated protist Pseudotrichonympha grasii in the

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596 596 J. H. P.King et al.

gut of the termite Coptotermes formosanus. Applied and En- genes by PCR. Applied and Environmental Microbiology, 62, vironmental Microbiology, 71, 8811–8817. 625–630. Potrikus, C.J. and Breznak, J.A. (1981) Gut bacteria recycle Taguchi, F.,Chang, J.D., Takiguchi, S. and Morimoto, M. (1992) uric-acid nitrogen in termites–a strategy for nutrient conser- Efficient hydrogen production from starch by a bacterium vation. Proceedings of the National Academy of Sciences of isolated from termites. Journal of Fermentation Technology, the United States of America, 78, 4601–4605. 73, 244–245. Roediger, W.E.W., Mooore, J. and Babidge, W. (1989) Colonic Tanaka, H., Aoyagi, H., Shina, S., Dodo, Y., Yoshimura, T., sulfide in pathogenesis and treatment of ulcerative colitis. Nakamura, R. and Uchiyama, H. (2006) Influence of the diet Digestive Diseases and Sciences, 42, 1571–1579. components on the symbiotic microorganisms community in Schmitt-Wagner, D., Friedrich, M.W., Wagner, B. and Brune, hindgut of Coptotermes formosanus Shiraki. Applied Micro- A. (2003) Phylogenetic diversity, abundance, and axial dis- biology and Biotechnology, 71, 907–917. tribution of bacteria in the intestinal tract of two soil-feeding Tholen, A., Schink, B. and Brune, A. (1997) The gut microflora termites (Cubitermes spp). Applied and Environmental Mi- of Reticulitermes flavipes, its relation to oxygen, and evidence crobiology, 69, 6007–6017. for oxygen-dependent acetogenesis by the most abundant En- Shinzato, N., Muramatsu, M., Matsui, T. and Watanabe, Y. terococcus sp. FEMS Microbiology Ecology, 24, 137–149. (2005) Molecular phylogenetic diversity of the bacterial com- Woese, C.R. (1987) Bacterial evolution. FEMS Microbiology munity in the gut of the termite Coptotermes formosanus. Reviews, 51, 221–271. Bioscience, Biotechnology, and Biochemistry, 69, 1145– Wu, G.D., Chen, J., Hoffmann, C., Bittinger, K., Chen, Y.T.,Keil- 1155. baugh, S.A., Bewtra, M., Knights, D., Walters, W.A., Knight, Shinzato, N., Muramatsu, M., Matsui, T. and Watanabe, Y. R., Sinha, R., Gilroy, E., Gupta, K., Baldassano, R., Nessel, (2007) Phylogenetic analysis of the gut bacterial microflora L., Li, H., Bushman, F. and Lewis, J.D. (2011) Linking long of the fungus-growing termite Odontotermes formosanus. term dietary patterns with gut microbial enterotypes. Science, Bioscience, Biotechnology, and Biochemistry, 71, 906– 334(6052), 105–108. 915. Yang, H., Schmitt-Wagner, D., Stingl, U. and Brune, A. (2005) Skerman, V.B.D., McGowan, V. and Sneath, P.H.A. (1989) Ap- Niche heterogeneity determines bacterial community struc- proved Lists of Bacterial Names (amended edn.) American ture in the termite gut (Reticulitermes santonensis). Environ- Society for Microbiology, Washington. mental Microbiology, 7, 916–932. Suzuki, M.T. and Giovannoni, S.J. (1996) Bias caused by template annealing in the amplification of mixtures of 16S rRNA Accepted August 27, 2013

C 2013 Institute of Zoology, Chinese Academy of Sciences, 21, 584–596