FASTK Antibody

Total Page：16

File Type：pdf, Size：1020Kb

Product Datasheet FASTK Antibody Catalog No: #35737 Orders: [email protected] Description Support: [email protected] Product Name FASTK Antibody Host Species Rabbit Clonality Polyclonal Purification Antigen affinity purification. Applications IHC Species Reactivity Hu Specificity The antibody detects endogenous levels of total FASTK protein. Immunogen Type Recombinant Protein Immunogen Description Fusion protein corresponding to residues near the C terminal of human fas-activated serine/threonine kinase Target Name FASTK Other Names FAST Accession No. Swiss-Prot#: Q14296NCBI Gene ID: 10922Gene Accssion: BC000377 Concentration 1.3mg/ml Formulation Rabbit IgG in pH7.4 PBS, 0.05% NaN3, 40% Glycerol. Storage Store at -20°C Application Details Immunohistochemistry: 1:50-1:200 Images Immunohistochemical analysis of paraffin-embedded Human gastric cancer tissue using #35737 at dilution 1/30. Address: 8400 Baltimore Ave., Suite 302, College Park, MD 20740, USA http://www.sabbiotech.com 1 Immunohistochemical analysis of paraffin-embedded Human brain tissue using #35737 at dilution 1/30. Background The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. Note: This product is for in vitro research use only and is not intended for use in humans or animals. Address: 8400 Baltimore Ave., Suite 302, College Park, MD 20740, USA http://www.sabbiotech.com 2.

Copy Link

Recommended publications

Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
[Show full text]
Effects of Changes in TIA1 on Stress Granule Formation
Effects of changes in TIA1 on stress granule formation Master’s thesis Lydia Sagath University of Helsinki Faculty of Biological and Environmental Sciences Genetics August 2015 Tiedekunta – Fakultet – Faculty Laitos – Institution– Department Bio- och miljövetenskapliga fakulteten Biovetenskapliga institutionen Tekijä – Författare – Author Lydia Johanna Sagath Työn nimi – Arbetets titel – Title Effects of changes in TIA1 on stress granule formation Oppiaine – Läroämne – Subject Humangenetik Työn laji – Arbetets art – Level Aika – Datum – Month and year Sivumäärä – Sidoantal – Number of pages Pro gradu Augusti 2015 63 Tiivistelmä – Referat – Abstract Welanders distala myopati (WDM) orsakas av mutationen p.E384K i genen TIA1. Mutationen antas vara sjukdomsalstrande på grund av en ökad produktion av protein, som relaterats till formationen av stressgranuler (Hackman et al. 2013). Även omgivningsfaktorer har föreslagits verka i sjukdomens utveckling: en ökad mängd stressgranuler har observerats i celler som behandlats med köldshock jämfört med celler som förvarats i 37°C (Hofmann et al. 2012). I patienter med WDM-liknande symptom som undersökts för förändringar i TIA1 har en p.N357S-förändring noterats förrikad. Denna förändring har tidigare anmälts som en polymorfism. Förändringen i fråga ligger i samma prionliknande domän i exon 5 som WDM-orsakande förändringen p.E384K. Därmed kunde p.N357S-förändringen öka predispositionen till aggregering. Pro gradu –arbetet är uppdelat i två delar: • p.N357S-polymorfismens effekt på stressgranulsbildningen i arsenitbehandle celler • Köldshockens effekt på stressgranulsbildningen Resultaten påvisar, att förändringen p.N357S i TIA1 orsakar en förändring i det translaterade proteinets beteende. I likhet med p.E384K-förändringen orsakar även p.N357S en ökad mängd stressgranuler i arsenitbehandlade celler. Däremot tyder resultaten på att stressgranulerna återbildas snabbare i fluorescence recovery after photobleaching-studier (FRAP) I p.N357S-transfekterade celler än i celler som transfekterats med TIA1 p.E384K och vildtyp.
[Show full text]
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
[Show full text]
And Rasopathies-Associated SHP2 and BRAF Mutations
Functional Characterization of Cancer- and RASopathies-associated SHP2 and BRAF Mutations Dissertation zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat.) im Fach Biologie/ Molekularbiologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt–Universität zu Berlin von M. Sc. Paula Andrea Medina-Pérez Präsident der Humboldt–Universität zu Berlin Prof. Dr. Jan–Hendrik Olbertz Dekan der Lebenswissenschaftlichen Fakultät Prof. Dr. Richard Lucius Gutachter: 1. Prof. Dr. Reinhold Schäfer 2. Prof. Dr. Hanspeter Herzel 3. Prof. Dr. Holger Sültmann Tag der mündlichen Prüfung: 12.03.2015 Abstract Deregulation of the Ras/MAPK signaling is implicated in a wide variety of human diseases, including developmental disorders and cancer. In the last years, a group of developmental disorders, characterized by an overlapping phenotype in patients, was clustered under the term RASopathies. These disorders result from germline mutations in genes encoding key components of the Ras/MAPK signaling cascade. Although the incidence of solid tumors in patients suffering from these disorders is rather low, reports on different forms of leukemia have considerably increased. In this work, a group of mutations in the genes SHP2/PTPN11 and BRAF, both key regulators of the MAPK signaling pathway and implicated in RASopathies and cancer, were selected for expression in well-established cell systems for a comprehensive molecular and phenotypic characterization using high-throughput approaches and functional assays. Synthetic cDNA sequences carrying the SHP2 mutations T42A, E76D, I282V (Noonan syndrome-associated), E76G, E76K, E139D (Noonan- and leukemia-associated), T468M (LEOPARD syndrome -associated) and the BRAF mutations Q257R, S467A, L485F and K499E (cardio-facio-cutaneous syndrome-associated) were shuttled into the modified lentivi- ral vector pCDH-EF1-IRES-GFP.
[Show full text]
Dysregulated Expression of Lipid Storage and Membrane Dynamics Factors in Tia1 Knockout Mouse Nervous Tissue
Neurogenetics DOI 10.1007/s10048-014-0397-x ORIGINAL ARTICLE Dysregulated expression of lipid storage and membrane dynamics factors in Tia1 knockout mouse nervous tissue Melanie Vanessa Heck & Mekhman Azizov & Ta n j a S t e h n i n g & Michael Walter & Nancy Kedersha & Georg Auburger Received: 28 January 2014 /Accepted: 3 March 2014 # The Author(s) 2014. This article is published with open access at Springerlink.com Abstract During cell stress, the transcription and translation decreased levels for Bid and Inca1 transcripts. Novel and sur- of immediate early genes are prioritized, while most other mes- prisingly strong expression alterations were detected for fat stor- senger RNAs (mRNAs) are stored away in stress granules or age and membrane trafficking factors, with prominent +3-fold degraded in processing bodies (P-bodies). TIA-1 is an mRNA- upregulations of Plin4, Wdfy1, Tbc1d24,andPnpla2 vs. a −2.4- binding protein that needs to translocate from the nucleus to seed fold downregulation of Cntn4 transcript, encoding an axonal the formation of stress granules in the cytoplasm. Because other membrane adhesion factor with established haploinsufficiency. stress granule components such as TDP-43, FUS, ATXN2, In comparison, subtle effects on the RNA processing machinery SMN, MAPT, HNRNPA2B1, and HNRNPA1 are crucial for included up to 1.2-fold upregulations of Dcp1b and Tial1.The the motor neuron diseases amyotrophic lateral sclerosis (ALS)/ effect on lipid dynamics factors is noteworthy, since also the gene spinal muscular atrophy (SMA) and for the frontotemporal de- deletion of Ta rd b p (encoding TDP-43) and Atxn2 ledtofat mentia (FTD), here we studied mouse nervous tissue to identify metabolism phenotypes in mouse.
[Show full text]
Anti-TIA1 Antibody (ARG58772)
Product datasheet [email protected] ARG58772 Package: 100 μl anti-TIA1 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes TIA1 Tested Reactivity Hu, Ms Tested Application IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name TIA1 Antigen Species Human Immunogen Synthetic peptide from Human TIA1. Conjugation Un-conjugated Alternate Names T-cell-restricted intracellular antigen-1; WDM; TIA-1; RNA-binding protein TIA-1; p40-TIA-1; Nucleolysin TIA-1 isoform p40 Application Instructions Application table Application Dilution IHC-P 1:50 - 1:200 WB 1:500 - 1:2000 Application Note IHC-P: Antigen Retrieval: Heat mediated. * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 43 kDa Observed Size ~ 45 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.4), 150mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol TIA1 Gene Full Name TIA1 cytotoxic granule-associated RNA binding protein Background The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells.
[Show full text]
MOCHI Enables Discovery of Heterogeneous Interactome Modules in 3D Nucleome
Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press MOCHI enables discovery of heterogeneous interactome modules in 3D nucleome Dechao Tian1,# , Ruochi Zhang1,# , Yang Zhang1, Xiaopeng Zhu1, and Jian Ma1,* 1Computational Biology Department, School of Computer Science, Carnegie Mellon University, Pittsburgh, PA 15213, USA #These two authors contributed equally *Correspondence: [email protected] Contact To whom correspondence should be addressed: Jian Ma School of Computer Science Carnegie Mellon University 7705 Gates-Hillman Complex 5000 Forbes Avenue Pittsburgh, PA 15213 Phone: +1 (412) 268-2776 Email: [email protected] 1 Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The composition of the cell nucleus is highly heterogeneous, with different constituents forming complex interactomes. However, the global patterns of these interwoven heterogeneous interactomes remain poorly understood. Here we focus on two different interactomes, chromatin interaction network and gene regulatory network, as a proof-of-principle, to identify heterogeneous interactome modules (HIMs), each of which represents a cluster of gene loci that are in spatial contact more frequently than expected and that are regulated by the same group of transcription factors. HIM integrates transcription factor binding and 3D genome structure to reflect “transcriptional niche” in the nucleus. We develop a new algorithm MOCHI to facilitate the discovery of HIMs based on network motif clustering in heterogeneous interactomes. By applying MOCHI to five different cell types, we found that HIMs have strong spatial preference within the nucleus and exhibit distinct functional properties. Through integrative analysis, this work demonstrates the utility of MOCHI to identify HIMs, which may provide new perspectives on the interplay between transcriptional regulation and 3D genome organization.
[Show full text]
Unit Name Gene Name Forward Sequence Reverse Sequence
SupplTable2.xls Unit name Gene name Forward sequence Reverse sequence AKAP13_0 AKAP13 CAGTGATGTGTCTCTCTCC GTTCTCTCTGGTCTGACTC APAF1_0 APAF1 GGACCCTCAAGAGGATATG GAAAGTACTGTACCCTGGTG ARID4B_0 ARID4B GAGGAGTACTGTAGATCAGC TGGCATCAGTGAGATCCAG ASC_0 ASC CTTCTACCTGGAGACCTAC GTAGGACTGGGACTCCCTTA AXIN1_0 AXIN1 GAGGCTACTCAGAGAGTGTT CAGAAGTAGTACGCCACAAC AXL_0 AXL CCCCTGAGAACATTAGTGCT AGAGCCAAGATGAGGACACA AXUD1_0 AXUD1 GTCCGGCACCACCATGACT GATGTGAAGCTACAGCCAG BAX_0 BAX GAGCAGATCATGAAGACAGG GTCCCAAAGTAGGAGAGGA BCL2L11_0 BCL2L11 TACCTCCCTACAGACAGAG CCTCCTTGCATAGTAAGCGT BCL2L12_0 BCL2L12 TCCTAGCTGCCTTCCTTAG GTATGGCTTCCTTCTCTGTC BCL2L1_0 BCL2L1 ATGGCAGCAGTAAAGCAAGCG TCATTTCCGACTGAAGAGTGA BCLAF1_0 BCLAF1 GTACCCTGAGGAAGCATAC AGTACCACGACCTCTTCCT BIRC5_0 BIRC5 CCACCGCATCTCTACATTCA CTGGTGCCACTTTCAAGACA BNIP1_0 BNIP1 CCGGATCTGTAACCAAGAG CTTAAGAGATCTCCTCCCTG BNIP1_1 BNIP1 CAACTCTCCAACTACACCTG CTCTCAGTGATGGTACTGG BRAF_0 BRAF GAGAGGTCTAATCCCAGAGT CACGTTAGTTAGTGAGCCAG BRCA1_0 BRCA1 CTAACAGCTACCCTTCCATC ACCACATCTCCTCTGACTTC BRCA1_1 BRCA1 GTCTCAGTGTCCAACTCTCT GTCACTCTGAGAGGATAGC C11orf17_0 C11orf17 CTCTAGAAGTGCTGGAGAG GACCATTCCCTATGTCCAAG C11orf17_1 C11orf17 GTTATCACAGAGGCGAGTC CAACTGCTACCACATGAGTC CARD10_0 CARD10 GAGTTCTACTACCCCGAAC CTCAGAGACAAGGTCCACAT CARD10_1 CARD10 GTGGACCTTGTCTCTGAGC GTACAGGTCACAGTCCTTC CASP10_0 CASP10 AGACTCGCTTCCCAAAACTG ATCTGCTTCGATGGATACGG CASP1_0 CASP1 AGGTCCTGAAGGAGAAGAG CCTCCACATCACAGGAACA CASP4_0 CASP4 GGGTCATGGCAGACTCTAT CTATAGTCCAGACCCTCAAG CASP6_0 CASP6 ATGAGCTCGGCCTCGGGG GGCTGCATCCACCTCAGTTA CASP7_0 CASP7 GACCGAGTGCCTACATATC GCTCCTCCACGAGTAATAG
[Show full text]
RNA-Binding Proteins and the Complex Pathophysiology of ALS
International Journal of Molecular Sciences Review RNA-Binding Proteins and the Complex Pathophysiology of ALS Wanil Kim 1,†, Do-Yeon Kim 2,* and Kyung-Ha Lee 1,* 1 Division of Cosmetic Science and Technology, Daegu Haany University, Hanuidae-ro 1, Gyeongsan, Gyeongbuk 38610, Korea; [email protected] 2 Department of Pharmacology, School of Dentistry, Kyungpook National University, Daegu 41940, Korea * Correspondence: [email protected] (D.-Y.K.); [email protected] (K.-H.L.); Tel.: +82-53-660-6880 (D.-Y.K.); +82-53-819-7743 (K.-H.L.) † Current Address: Department of Biochemistry, College of Medicine, Gyeongsang National University, Jinju 52828, Korea. Abstract: Genetic analyses of patients with amyotrophic lateral sclerosis (ALS) have identiﬁed disease- causing mutations and accelerated the unveiling of complex molecular pathogenic mechanisms, which may be important for understanding the disease and developing therapeutic strategies. Many disease-related genes encode RNA-binding proteins, and most of the disease-causing RNA or proteins encoded by these genes form aggregates and disrupt cellular function related to RNA metabolism. Disease-related RNA or proteins interact or sequester other RNA-binding proteins. Eventually, many disease-causing mutations lead to the dysregulation of nucleocytoplasmic shuttling, the dysfunction of stress granules, and the altered dynamic function of the nucleolus as well as other membrane- less organelles. As RNA-binding proteins are usually components of several RNA-binding protein complexes that have other roles, the dysregulation of RNA-binding proteins tends to cause diverse forms of cellular dysfunction. Therefore, understanding the role of RNA-binding proteins will help elucidate the complex pathophysiology of ALS.
[Show full text]
Supporting Information
Supporting Information Faltermeier et al. 10.1073/pnas.1521674112 A. FU-R1-R2-V5-SV40-BlasƟ-CGW UbiquiƟn-C CMV 5’ LTR R1 Kinase R2 V5 SV40 BlastiR 3’ LTR promoter promoter GFP B. Kinase (kDa) 210 CMV GFP WPR 105 promot E er 78 49 38 28 V5 293t cells Fig. S1. Lentivirus-mediated overexpression of V5-tagged kinases. (A) Full-length kinases were cloned into the FU-R1-R2-V5-SV40-Blasti-CGW lentiviral vector shown. R1 and R2 represent recombination sites required for recombination-based Gateway cloning. LTR, Long-terminal repeat. (B) Western blot showing expression of selected kinases in 293t cells detected by a V5 antibody. The molecular mass of each kinase is indicated in parentheses. A. vector SrcY529F 3 Cap8 cells 2 weeks 2 x107 Tail vein Y529F Src injecƟon SCID 1 Luciferase reporter BLI Radiance (p/sec/cm3/sr) B. Lungs from mice injected with Cap8-SrcY529F cells Mouse 1 Mouse 2 Fig. S2. SrcY529F promotes lung colonization when overexpressed in murine prostate cells. (A) Experimental design to demonstrate that expression of mu- tationally activated kinase SrcY529F in Cap8 cells promotes lung colonization. (B) Bright-field images of lungs removed from mice 3 wk after being injected with Cap8-SrcY529F cells. (Scale bars, 5 mm.) Faltermeier et al. www.pnas.org/cgi/content/short/1521674112 1of5 A. Lungs-NTRK2 210 105 NTRK2 78 49 38 V5 293t cells Metastases Ɵssue Lungs-EGFR 210 EGFR 105 78 49 38 V5 293t cells Metastases Ɵssues Lungs-Her2 210 105 HER2 78 49 38 V5 293t cells Metastases Ɵssues B.
[Show full text]
Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM 014911.2 KIAA1048, Dkfzp686k16132 AP2 Associated Kinase 1
Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM_014911.2 KIAA1048, DKFZp686K16132 AP2 associated kinase 1 (AAK1) AATK NM_001080395.2 AATYK, AATYK1, KIAA0641, LMR1, LMTK1, p35BP apoptosis-associated tyrosine kinase (AATK) ABL1 NM_007313.2 ABL, JTK7, c-ABL, p150 v-abl Abelson murine leukemia viral oncogene homolog 1 (ABL1) ABL2 NM_007314.3 ABLL, ARG v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) (ABL2) ACVR1 NM_001105.2 ACVRLK2, SKR1, ALK2, ACVR1A activin A receptor ACVR1B NM_004302.3 ACVRLK4, ALK4, SKR2, ActRIB activin A receptor, type IB (ACVR1B) ACVR1C NM_145259.2 ACVRLK7, ALK7 activin A receptor, type IC (ACVR1C) ACVR2A NM_001616.3 ACVR2, ACTRII activin A receptor ACVR2B NM_001106.2 ActR-IIB activin A receptor ACVRL1 NM_000020.1 ACVRLK1, ORW2, HHT2, ALK1, HHT activin A receptor type II-like 1 (ACVRL1) ADCK1 NM_020421.2 FLJ39600 aarF domain containing kinase 1 (ADCK1) ADCK2 NM_052853.3 MGC20727 aarF domain containing kinase 2 (ADCK2) ADCK3 NM_020247.3 CABC1, COQ8, SCAR9 chaperone, ABC1 activity of bc1 complex like (S. pombe) (CABC1) ADCK4 NM_024876.3 aarF domain containing kinase 4 (ADCK4) ADCK5 NM_174922.3 FLJ35454 aarF domain containing kinase 5 (ADCK5) ADRBK1 NM_001619.2 GRK2, BARK1 adrenergic, beta, receptor kinase 1 (ADRBK1) ADRBK2 NM_005160.2 GRK3, BARK2 adrenergic, beta, receptor kinase 2 (ADRBK2) AKT1 NM_001014431.1 RAC, PKB, PRKBA, AKT v-akt murine thymoma viral oncogene homolog 1 (AKT1) AKT2 NM_001626.2 v-akt murine thymoma viral oncogene homolog 2 (AKT2) AKT3 NM_181690.1
[Show full text]
Inhibiting PARP1 Splicing Along with Inducing DNA Damage As Potential Breast Cancer Therapy
Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis Inhibiting PARP1 Splicing along with Inducing DNA Damage as Potential Breast Cancer Therapy Student: Reem Alsayed Spring 2021 Professor: Ihab Younis 1 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis Abstract: Triple negative breast cancer is a deadly cancer and once it has metastasized it is deemed incurable. The need for an effective therapy is rising, and recent therapies include targeting the DNA damage response pathway. PARP1 is one of the first responders to DNA damage, and has been targeted for inhibition along with the stimulation of DNA damage as a treatment for breast cancer. However, such treatments lack in specificity, and only target one or two domains of the PARP1 protein, whereas PARP1 has other functions pertaining to multiple cancer hallmarks such as promoting angiogenesis, metastasis, inflammation, life cycle regulation, and regulation of tumorigenic genes. In this project, we hypothesize that by inhibiting the PARP1 protein production, we will be able to effectively inhibit all cancer hallmarks that are facilitated by PARP1, and we achieve this by inhibiting the splicing of PARP1. Splicing is the removal of intervening sequences (introns) in the pre-mRNA and the joining of the expressed sequences (exons). For PARP1, we blocked intron 22 splicing by introducing an Antisense Morpholino Oligonucleotide (AMO) that blocks the binding of the spliceosome. The results obtained demonstrate that 50uM PARP1 AMO inhibits PARP1 splicing >88%, as well as inhibits protein production. Additionally, the combination of PARP1 AMO and Doxorubicin lead to a loss in cell proliferation.
[Show full text]