Inhibiting PARP1 Splicing Along with Inducing DNA Damage As Potential Breast Cancer Therapy

Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Inhibiting PARP1 Splicing along with Inducing DNA Damage as Potential Breast Cancer Therapy

Student: Reem Alsayed Spring 2021 Professor: Ihab Younis

1 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Abstract:

Triple negative breast cancer is a deadly cancer and once it has metastasized it is deemed incurable. The need for an effective therapy is rising, and recent therapies include targeting the DNA damage response pathway. PARP1 is one of the first responders to DNA damage, and has been targeted for inhibition along with the stimulation of DNA damage as a treatment for breast cancer. However, such treatments lack in specificity, and only target one or two domains of the PARP1 protein, whereas PARP1 has other functions pertaining to multiple cancer hallmarks such as promoting angiogenesis, metastasis, inflammation, life cycle regulation, and regulation of tumorigenic genes. In this project, we hypothesize that by inhibiting the PARP1 protein production, we will be able to effectively inhibit all cancer hallmarks that are facilitated by PARP1, and we achieve this by inhibiting the splicing of PARP1. Splicing is the removal of intervening sequences (introns) in the pre-mRNA and the joining of the expressed sequences (exons). For PARP1, we blocked intron 22 splicing by introducing an Antisense Morpholino Oligonucleotide (AMO) that blocks the binding of the spliceosome. The results obtained demonstrate that 50uM PARP1 AMO inhibits PARP1 splicing >88%, as well as inhibits protein production. Additionally, the combination of PARP1 AMO and Doxorubicin lead to a loss in cell proliferation.

2 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Introduction: Breast cancer is the deadliest cancer for women in Qatar (Doenelly et al., 2011), and the second worldwide (Harbeck et al., 2019). The rate of breast cancer incidence globally is rising alarmingly, from having 641,000 patients in 1980 to >1.6million in 2010, and a rising trend is expected (Harbeck et al., 2019). Triple negative TN breast cancer is considered to be a challenging cancer to target due to its lack of HER2, Estrogen, and Progesterone receptors that could have been targets for therapy (Godet & Gikes, 2017). Furthermore, metastasized cancers are considered to be incurable according to the therapies available today (Godet & Gikes, 2017), creating a pressing need for an innovative solution and therapy. Splicing is one of the many pre-mRNA processing steps that help the conversion of pre-mRNA into mRNA (El Marabti & Younis, 2018). It occurs in the nucleus and involves removing the interfering sequences of a pre-mRNA, known as introns, and joining the expressed sequences, known as exons (National Cancer Institute, n.d.). This is a crucial step in preparing the mRNA for export out of the nucleus to be translated (El Marabti & Younis, 2018). Alternative splicing occurs when a variable combination of exons and introns are removed/joined, and this forms different isoforms of the mRNA transcript, in turn forming proteins with different function and structure (El Marabti & Younis, 2018). This process has been known to have significance in cancer, because the cancer cells might modify the ratio of the spliced isoforms in a way that would favor cancer progression (El Marabti & Younis, 2018). Splicing is carried out by snRNPs (small nuclear ribonucleo proteins) called U1, U2, U4, U5, and U6 which form the major spliceosome (El Marabti & Younis, 2018). However, a specific set of 770 introns are spliced by a different machinery called the minor spliceosome, and this consists of U11, U12, U4atac, U5, and U6atac snRNPs. These introns are referred to as minor introns due to their splicing by a machinery that is not as widely used as the major spliceosome (Olthof et al., 2019). Additionally, it is important to mention that minor introns are highly conserved and regulated in cancer, and can serve very important roles (Olthof et al., 2019). PARP1 is overexpressed in breast carcinoma that are BRCA1/2-mutated, triple negative as well as receptor-positive (Wang et al., 2017). PARP1 is poly ADP-ribose polymerase 1, and its main functions include using NAD+ as a substrate to catalyze the synthesis of Poly ADP ribose, as well as transferring this molecule onto other proteins (Wang et al., 2017). The domain responsible for the catalytic ability lies at the C-terminus of the protein (Wang et al., 2017). In addition, this function is an essential part of recognizing damaged DNA, and marking it for repair. As such, PARP1 is the very first response to single and double stranded DNA damage (Wang et al., 2017). Specifically, the single stranded DNA breaks that are recognized by PARP1 are either those occurring due to disintegration of oxidize deoxyribose (DNA sugar damage) or as natural intermediates of base excision and repair (Caldecott, 2008). Marking a damaged segment of DNA for repair would trigger a cascade of proteins that will carry out the end processing, gap filling and ligation of the previously damaged area (Caldecott, 2008). Due to its key function in DNA damage repair, PARP1 plays an essential role in cancer. Generally speaking, cancer cells produce more mutations than healthy cells, which is important for mutagenesis and maintaining and creating adaptive genes (Zhivotovsky & Kroemer, 2004). However, excessive unrepaired mutations lead to death and senescence. Cancer cells avoid this by making sure by balancing their mutation level: enough for mutagenesis to occur but not excessive as not to induce senescence. For this balance to occur, DNA damage repair has to take place in order to prevent cancer cells from creating a level of DNA damage that would lead to their apoptosis (Zhivotovsky & Kroemer, 2004). Therefore many cases of cancer, PARP1 protein is over expressed (Wang et al., 2017). Interestingly, excessive DNA lesions lead to apoptosis despite the presence of PARP1 (Wang et al., 2017). PARP1 manages to repair normal amounts of DNA damage, but with excessive DNA lesions and regular amount of PARP1 expression, PARP1 will not be able to bind every lesion, and signal for repair in a timely manner. Based on this, past research has focused on inducing excessive DNA damage and blocking PARP1 activity in order to trigger apoptosis (Vascotto et al., 2016). The most prevalent PARP1 inhibitors work by blocking the NAD+ binding site, otherwise 3 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis known as the active site, and this inhibits the Poly ADP ribose synthesis catalysis (Caldecott, 2008). However, a problem faced with some PARP1 inhibitors is that they display off-target binding, for example, they could bind to certain kinases (Atolín & Mestres, 2014). Another drawback of PARP1 inhibitors is that they only block the Poly- ADP riposylation catalytic activity, when in reality PARP1 is involved in multiple hallmarks of cancer that are not necessarily related to DNA damage repair or Poly-ADP ribosylation (Wang et al., 2017). In addition to its key role in DNA damage repair, PARP1 has been shown to have additional functions that can aid in tumorigenesis, including regulation of gene transcription, upregulating inflammatory signals, regulating cell cycle, and promoting angiogenesis and metastasis (Wang et al., 2017). Gene transcription regulation does not require the catalytic domain, and the rest of the functions mentioned have not yet been listed under a specific domain. An example for gene regulation is that PARP1 was shown to activate vascular endothelial growth factor receptor 1 (VEGFR1) gene, hypoxia-inducible factor 1α and 2A (HIP1α and HIF2A), melanocyte-lineage survival oncogene (MITF), and it suppresses tumor suppressor genes such as p53 and APC. For inflammation, PARP1 was shown to activate NF-κB, which is an inflammatory signal (Wang et al., 2017). Cell cycle modulation and promoting angiogenesis and metastasis is regulated by PARP1 via over activating ERK, which blocks apoptosis and stimulates VEGF and other pro-angiogenic factors (Wang et al., 2017). Among these functions, chromatin remodeling requires the PAR-binding domain, and can function without the catalytic domain (Pines et al. 2012). Moreover, some genes that are activated by PARP1 are activated by the center (automodification) domain (Simbulan-Rosenthal et al., 2003). Ultimately, this tells us that blocking the catalytic domain alone may not be a sufficient form of treatment if PARP1 continues to facilitate other cancer hallmarks. Hence, PARP1 could be inhibited through the blocking of its protein production, and this might be able to block all PARP1 functions. The splicing of PARP1 could be inhibited in several ways. Firstly, it is important to note that PARP1 pre-mRNA consists of 23 exons, and the last one being the one that codes for the catalytic domain of the protein (UniProt, n.d.). Moreover, intron 22 is a minor intron (MIDB, n.d,), and as mentioned previously, minor introns are highly regulated in cancer. Hence, if the splicing of exon 23 is inhibited, this might lead to the inhibition of its protein production. The first method is to inhibit PARP1 intron 22 splicing by adding an AMO (antisense morpholino oligonucleotide) at the junction of exon 22 and intron 23, and this will block the spliceosome from binding there and splicing the intron. Another method is to introduce the AMO at the site of an RNA binding protein that is in charge of aiding the splicing, so this will also be a way to inhibit the splicing of the intron. Inhibiting PARP1 in the past either through chemical means or by siRNA treatment has resulted in apoptosis, G2 cell cycle arrest, and chromatid breaks (Do & Chen, 2013). In this project, we hypothesize that by inhibiting PARP1 splicing we will inhibit PARP1 protein synthesis and all functions related to PARP1, which is expected to be more efficient and specific than the known chemical inhibitors of PARP1 catalytic domain. Additionally, coupling overall PARP1 inhibition to a DNA damaging agent such as doxorubicin would lead to a higher rates of cancer cell death. Previous data gathered Albandari AlKhater (2017-2018) revealed that PARP1 AMO works in inhibiting the splicing of PARP1. Additionally, the data collected at the start of the project also revealed the optimum concentration of PARP1 AMO to be used in future experiments, which was 50uM. Additionally, computational RNA binding protein (RBP) analysis helped narrow down the potential RBP to be targeted for inhibition by an AMO, and that was revealed to be FUS, as it had a strong role in minor intron splicing, and it fit in several other criteria that was set for the analysis (Supplementary Table 1). In this project, we utilized the past information into investigating whether PARP1 AMO blocks protein production, whether or not the combination of PARP1 AMO and doxorubicin leads to higher apoptosis rates, and whether PARP1 AMO inhibits other functions of PARP such as metastasis (wound healing assay).

4 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Materials and methods Cell culture MDAMB231 cells were grown in a 5% CO2 humidified incubator at 37ºC. The media used was DMEM (Dulbecco’s Modified Eagle’s Medium) with 10% FBS (Fetal Bovine Serum), 1% Penicillin/Streptomycin, and 1% nonessential amino acids. Passaging took place when cells were at 50-80% confluent, or as needed. To detach the cells, cells were incubated with 0.05% trypsin for 5 minutes at 37ºC. Doxorubicin and PARP1 inhibitor treatment Cells were treated with a Doxorubicin (purchased from Sigma-Aldrich) to make a final concentration in a range of these concentrations: 0.05-1uM. Doxorubicin was dissolved in DMSO (dimethyl sulfoxide) but the final DMSO concentration added to cells did not exceed 0.5%. Cells were incubated in a 37ºC 5% CO2 humidified incubator for 24 hours, after which protein and RNA extraction took place, as well as a comet assay. As control, cells were treated with the solvent DMSO. PARP1i (AZD246) was purchased from Sigma-Aldrich, and treatments were carried out in the same manner, and also diluted in DMSO. The concentration of the PARP1 inhibitor that was used in this project is 10uM. Neon transfection with AMO Cells were counted by addition of trypan blue at a 1:1 ratio and counted on a Countess machine (Invirtogen), to ensure there was 500,000 cells/mL in each well of a 6-well plate (for protein and RNA extraction), or 250,000 cells/mL in a 12-well plate (for a comet assay), or 100,000 cells/mL for a wound healing assay in a 96-well plate, or 2,500 cells/mL for a Cell titre-Glo assay in a 96-well plate. To get the volume of cells required after the resuspension of the cells, this equation was used: 푇표푡푎푙 푐푒푙푙 푐표푢푛푡 푛푒푒푑푒푑 푉표푙푢푚푒 표푓 푐푒푙푙푠 푛푒푒푑푒푑 = 퐶표푛푐푒푛푡푟푎푡푖표푛 푎푣푎푖푙푎푏푙푒 After determining the volume of cells, the cells are centrifuged at 1000 rpm for 5 minutes, 6ml PBS is used to wash the pellet, and divided into 2 x 15mL centrifuge tubes and centrifuged. Resuspension buffer was used to resuspend the pellet, and the AMO is added to create the desired concentration. The concentration of the AMOs include: 25uM and 50uM PARP1 AMO, 5uM U6atac AMO, and 50uM control AMO. A 100ul tip of a Neon Transfection pipette was used to insert the cells into the transfection chamber that was filled with 3 ml of E2 buffer as recommended by the manufacturer. The cells were charged with 1,400V, and plated in DMEM with 10% FBS and 1% nonessential amino acids but no Penicillin/Streptomycin, and returned to the incubator before being harvested 24h later. Protein extraction and Western Blot Proteins were extracted from a 6-well plate. The media was decanted and 1X Laemmli buffer with mercaptoethanol was added to each well. Wells were scraped and samples were moved to microcentrifuge tubes and stored at -20 C. To start the western blot, proteins were denatured at 95 C for 5 minutes then loaded on a premade 10% acrylamide gel, and ran for 1 hour at 120V. Samples were transferred to a nitrocellulose membrane using a 10-minute semi-wet transfer, and the membrane was stained with 1% Ponseau staining for 5 minutes to check for sample loading and equal transfer across samples. The membrane was destained with water, and incubated in blocking buffer (Licor) overnight. Then, primary antibodies (diluted in blocking buffer) were added (rabbit GammaH2AX 1:1000; mouse GAPDH 1:2000; rabbit PARP1 1:1000) and incubated overnight. After this, three washes with TBST were done then the respective infra-red secondary antibodies were diluted 1:5000 and incubated with the membrane on a shaker for 1 hour in the dark. Additional three washes with TBST were done followed by membrane imaging. The protein ladder that was used was NEB# P7719.

5 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

RNA extraction and RT-PCR RNA was extracted using the Qiagen RNeasy Plus mini kit from a 6-well plate according to manufacturer’s recommendation. Briefly 350ul RLT buffer with beta mercaptoethanol were added to each well (after decanting media), scraped and moved to a Qiashredder column for homogenization and centrifuged. Unless specified, all centrifugation steps are 30-60 seconds at 11,000 rpm. One volume 70% ethanol was added to the flow through, and the sample was transferred to an RNeasy spin column to capture the RNA, and centrifuged. The column was washed once with RW1 buffer and twice with RPE buffer (containing ethanol). The column was then added to a new tube and centrifuged at full speed for 1 minute to get rid of all residual ethanol. The RNA was eluted into a clean centrifuge tube with 50ul RNase-free water. The RNA was stored at -80 C. To convert the RNA to cDNA, reverse transcription took place by fist mixing RNA (6ul) with Oligo DTs, and random hexamer primer mix. The sample was denatured a 65 C for 5 minutes then put on ice. Protoscript II reaction mix (2X) and Protoscript II enzyme mix (10X) were added, and the sample was incubated at 25 C for 5 minutes, 42 C for 1 h, 80 C for 5 minutes. The cDNA was diluted with 180ul Nuclease-free water, and moved to -20 C. The PCR was carried out using the primers IHY074: aattttaagacctccctgtgg (forward), and IHY075: gtcgattgtaattcagacctaccac (reverse). cDNA (5ul) was mixed with OneTaq master mix (Invitrogen) and the primers, and the mixtures were run at 94 C for 30s, 32 cycles (94 C for 30s, 50 C for 30s, and 68 C for 30s), and 68 C for 5 minutes. Samples were loaded on a 1.5% agarose EtBr gel, and ran for 30 minutes at 100V. The running buffer used was 1X Tris/Acetic Acid/ EDTA (TAE). The ladder used was a 100 bp ladder (Invitrogen). The gel was imaged in a UV box, and band intensities were quantified using ImageJ. Cell Titre-Glo Cells were plated on a 96-well plate and allowed to attach (>3 hours). The day 0 measurement was done by adding equal volume of the Cell Titre-Glo Luminescent Cell Viability Assay Reagent (Promega, #G7572), and incubated for 10 minutes before the luminescence was read using a pre-warmed (25C) Promega GloMax machine. This was repeated for day 1, day 2 and day 3. Comet assay A Comet Assay Kit (ab238544) was used to carry out this assay. First, the agarose was melted at 95 C for 20 minutes, then cooled at 37 C for 20 minutes before being plated on a slide. The agarose was allowed to cool for 15 minutes at 4 C. Media was decanted off cells in a 12-well plate, and 250ul of cold PBS was added. Cells were scraped into a centrifuge tube and spun at 700 x g for 2 minutes. Cells were resuspended in 500ul cold PBS and counted. After a concentration of 1 x 105 Cells/mL was established, cells were added to the agarose at a 1/10 ratio, and plated atop the initial agarose layer. The agarose containing the cells was allowed to solidify at 4 C for 15 minutes in the dark. Later, the slide was incubated in lysis buffer for 30 minutes at 4 C in the dark, followed by alkaline buffer in the same conditions. The slides were immersed in TBE for 5 minutes before being transferred to the electrophoresis chamber and run for 20 minutes at 25V. After this, the slides were washed in 70% ethanol for 5 minutes, then allowed to air dry before the addition of 1X Vista Green dye and incubated for 15 minutes. The cells were imaged using an EVOS Cell Imaging Machine (Invitrogen) and 10 cells were captured per treatment. Computational analysis UCSC Xena browser was used for the computational analysis regarding PARP1 expression and breast cancer. First, a box plot with PARP1 expression across carcinogenic and healthy breast tissue was found, then the correlation of the PARP1 mRNA and RNA binding proteins was investigated. Using RBPDB and ATtRACT, RBPs that are relevant to PARP1 minor intron splicing were found. These RBPs along with experimentally found RBPs were 6 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis formatted as BED files and visualized against the PARP1 gene in UCSC genome browser. The ranking for the RBPs was determined by the following criteria: correlation with the PARP1 gene expression (/5) functional relevance in breast cancer (/5), functional relevance to PARP1 (/5), and functional relevance with regard to minor intron splicing (/10).

7 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Results and analysis The online database Xena Browser was used in order to confirm that PARP1 is indeed overexpressed in breast cancer. Figure 1 shows a box plot with different breast samples (normal solid tissue, primary tumor, and metastatic). Box plot are a visual way to display data about a sample, where the whiskers represent the upper and lower quartile (25%), the box represents the 2 middle quartiles (50%), and the solid horizontal line is the median. The y axis represents PARP1 mRNA expression in TPM (transcripts per million), which is an RNA-seq normalization meaning for every 1 million transcript in a sample, there will be 1 transcript of the chosen RNA. As can be seen on the plot, normal solid tissue has much lower mRNA expression than both metastatic or primary tissue samples. Therefore we could say with confidence (P-value<0.05) that PARP1 mRNA is over expressed in breast cancer tissues, and this allowed commencing the wet lab experiments that work on inhibit PARP1 mRNA.

Figure 1. The expression of the PARP1 gene in different types of breast tissue; obtained from UCSC Xena browser. P- value <0.05. In order to find out what concentration of AMO that causes a significant reduction in splicing, MDAMB231 were transfected with different AMO concentrations ranging 6.25-50uM. RNA was extracted from the cells 24 hours post transfection, and after a PCR amplification for both PARP1 and GAPDH, a gel electrophoresis was carried out. The properly spliced PARP1 is present as a band at 162bp and the unspliced PARP1 is a band at 594bp. The gel shows that at 6.25uM there is 41.6% inhibition of PARP1 splicing (Fig. 2A, Fig. 2C). However, 12.5uM PARP1 AMO creates 73.6% inhibition of PARP1 splicing, and it increases for both 25uM (78.8%) and 50uM (77.2%) (Fig. 2C). Generally, higher AMO concentrations lead to lower amounts of spliced PARP1 mRNA. However, due to low quality of RNA, we opted to repeat the experiment.

8 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Figure 2. Higher PARP1 AMO concentrations produce higher amount of unspliced PARP1 mRNA. MDAMB231 cells were transfected with PARP1 AMO range: 6.25uM-50uM. 50uM control AMO was the transfection control A: PCR products the amplified the region of exon 22- exon 23 were run on a 1.5% agarose gel for 1 hour at 90V in 1X TAE running buffer. GAPDH was used as a loading control. B: The ImageJ Quantification of the bands. Bands were normalized against their loading control, and a percentage of the intensity of the two bands (spliced and unspliced PARP1) was plotted. The ladder used is a 100bp ladder from Invitrogen.

In order to optimize the PARP1 AMO concentration, the transfection was repeated. MDAMB231 cells were treated with 25uM and 50uM PARP1 AMO, and RT-PCR and gel electrophoresis were conducted 24 hours post transfection (Fig. 3A-B). The results show that 25uM reduced splicing by 57%, while 50uM reduced it by 79%.(Fig. 3B). This confirms that there is a dose dependent decrease in PARP1 mRNA splicing with increasing PARP1 AMO concentrations. Additionally, sine 50uM PARP1 AMO is showing the highest splicing inhibition, it was chosen to be the optimum concentration. The experiment was the repeated for reproducibility. Since the effect of PARP1 AMO on minor intron splicing was determined, the effect on PARP1 protein expression needed to be determined as well.

9 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Figure 3. PARP1 AMO inhibits PARP1 mRNA splicing in a dose dependent manner. MDAMB231 cells were transfected with PARP1 AMO 25uM and 50uM, and some cells were treated with Doxorubicin concentrations 0.5uM and 1uM. The control AMO was transfected at a concentration of 50uM A-C: PCR samples of the PARP1 exon 22- exon 23 region were run on a 1.5% agarose gel for 1 hour at 90V in 1X TAE running buffer. GAPDH was used as a loading control. Bands were quantified using ImageJ Quantification. D-F: Proteins were extracted and ran on an SDS gel, and stained for PARP1, GAPDH (loading control), and Gamma H2AX. The conditions for running were 120V for 1hour in 1X TGS buffer. Samples were transferred to a nitrocellulose membrane for 10 minutes by semi-wet transfer. The intensity of the bands was quantified using ImageJ quantification.

The effect of PARP1 AMO on PARP1 protein production was not known. Therefore, the transfection with 50uM PARP1 AMO was repeated, proteins were extracted 24 hours post transfection, and a western blot was carried out (Fig. 4C). The protein size of PARP1 that is expected on the membrane is 113kDa (Genecards, n.d.).The results of the RT-PCR are shown in Figures 4A and 4B, and they show that 50uM reduced splicing by 88.3% (Fig. 4B). Additionally, 50uM PARP1 AMO was shown to reduce the protein production by 79% that of the control (Fig. 4D). Establishing that 50uM PARP1 AMO causes a reduction in protein production confirms a part of the hypothesis. Since we hypothesize also that an obliteration of protein production should lead to an obliteration of all functions of PARP1, this needed to be tested. Hence, the effect of PARP1 AMO on cell proliferation was to be determined.

10 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Figure 4. 50uM PARP1 AMO shows high inhibition of PARP1 mRNA splicing and PARP1 protein production. MDAMB231 cells were transfected with 50uM PARP1 AMO, and 50uM Control AMO. A-B: PCR samples of the PARP1 exon 22- exon 23 region were run on a 1.5% agarose gel for 1 hour at 90V in 1X TAE running buffer. GAPDH was used as a loading control. Bands were quantified using ImageJ Quantification. C-D: Proteins were extracted and ran on an SDS gel, and stained for PARP1, GAPDH (loading control). The conditions for running were 120V for 1hour in 1X TGS buffer. Samples were transferred to a nitrocellulose membrane for 10 minutes by semi-wet transfer. The ladder used was NEB# P7719. The intensity of the bands was quantified using ImageJ quantification.

We hypothesized that PARP1 AMO should perform better than PARP1 inhibitor by inhibiting protein production and hence all functions of PARP1, but this needed to be confirmed. Therefore, in order to find out the effect of PARP1 AMO on proliferation and compare it to PARP1 inhibitor, a cell proliferation assay was carried out. A Cell Titre-Glo assay was carried out on MDAMB231 cells transfected with 50uM PARP1 AMO (Fig. 5A), and another group of cells were treated with 10uM PARP1 inhibitor (Fig. 5B). This concentration of PARP1 inhibitor was chosen as it is slightly higher than that of the literature (Nile, et al., 2016), which ensures PARP1 inhibition. A two-tailed t- test was carried out to find the significance of the data. PARP1 AMO displayed a decreasing effect on cell proliferation specifically by the second and third day post transfection compared to the control (p = .327) (Fig. 5A). On the other hand, PARP1 inhibitor did not show any large effect on proliferation compared to the DMSO positive 11 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis control 2 days after the treatment (p =.864) (Fig. 5B). Therefore, this confirms another part of the hypothesis, that PARP1 AMO inhibits the function of PARP1 protein in terms of cell proliferation, while PARP1 inhibitor does not. PARP1 inhibitor is coupled with DNA damaging therapies in breast cancer in order to enhance its anti-tumor effects (Do & Chen, 2013). Since the hypothesis states that PARP1 AMO should be the superior treatment, PARP1 AMO also needed to be coupled with doxorubicin to see if there is a change in the effect on cell proliferation.

Figure 5. PARP1 AMO alone causes an effect on proliferation, while PARP1i does not. A: MDAMB231 cells were transfected with 50uM PARP1 AMO, and a Cell Titre-Glo assay was carried out. p = .327 B: MDAMB231 cells were treated with 10uM PARP1i (AZD246), and a Cell Titre-Glo assay was carried out. Cells were measured in triplicates over the course of 3 days. Control AMO (50uM) was a positive control for proliferation. p = .864

The effect of PARP1 AMO with Doxorubicin treatment on cell proliferation was to be determined. However, to confirm that Doxorubicin does not interfere with the splicing of PARP1 or the protein production of PARP1, a dosing of Doxorubicin was done with the concentrations 0.5uM and 1uM. Usually, a dosing of doxorubicin in the literature is between 0.1-0.5uM, however, a higher dosage (1uM) was included in order to make clear any effect of doxorubicin on splicing. For the doxorubicin treatment, the cells were harvested 24 hours post treatment, and an RT-PCR followed by a gel electrophoresis was done for the mRNA and a western blot was carried out for the proteins (Fig. 3C-D). The level of PARP1 mRNA was normalized against the GAPDH loading control, and it showed that compared to the DMSO control, doxorubicin does not interfere with PARP1 splicing (Fig. 3C). As can be seen in Fig.3D the ratio of the PARP1 protein was normalized on the loading control (GAPDH), and it shows that the amount of PARP1 protein does not change with or without Doxorubicin treatments compared to the DMSO control. As was mentioned earlier, there needs to be a comparison with the combination of PARP1 AMO and doxorubicin against PARP1 inhibitor and doxorubicin in terms of cell proliferation. First, the effect of doxorubicin alone on proliferation of transfected cells was to be determined. Therefore as can be seen in Figure 6A, MDAMb231 cells that are transfected with Control AMO and treated with doxorubicin show a decrease in proliferation specifically 2 and 3 days post treatment, compared to the Control AMO alone. This confirms that Doxorubicin has a decreasing effect on cell proliferation (p =.486). Then, in order to see the effect of the addition of PARP1 AMO and Doxorubicin, MDAMB231 were transfected with 50uM PARP1 AMO and treated with 0.05uM Doxorubicin (Fig. 6B). It can be seen that this combination of treatments leads to a general reduction in proliferation compared to the Control AMO transfected sample (p =.503). In order to compare PARP1 AMO and PARP1i, cells were treated with 10uM PARP1 inhibitor and 0.1uM Doxorubicin (Fig. 6C). Based on the obtained results, a suboptimal concentration of 12 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Doxorubicin was chosen so that the cells do not die right away. What can be seen is that in the first 2 days post treatment PARP1i does not reduce the cell proliferation compared to the DMSO control, and some slight decrease in cell proliferation is seen in day 3, however, issues with the quality of this data prevents us from making concrete conclusions (p =.431). Therefore, what can be concluded from this figure is that PARP1 AMO when combined with Doxorubicin has a potent effect on reducing cell proliferation. This confirms our hypothesis, in that PARP1 AMO is effective against cancer proliferation. Since the effect of PARP1 on proliferation has been established and compared with PARP1 inhibitor, this allowed us to move on to investigating the effect of PARP1 AMO on other functions of PARP1 in order to answer our hypothesis.

Relative Proliferation Relative Cell (measured by Cell Glo) (measuredCell Titre by

Time after treatment (in days)

Figure 6. PARP1 AMO treatment with Doxorubicin has a decreasing effect on cell proliferation, more so than PARP1 inhibitor with Doxorubicin. A: MDAMB231 cells were transfected with 50uM Control AMO and treated with 0.05uM Doxorubicin. p = .486 B: MDAMB231 cells were transfected with 50uM PARP1 AMO and treated with 0.05uM Doxorubicin. p = .503 C: MDAMB231 cells were treated with 10uM PARP1 inhibitor and 0.1uM Doxorubicin p = .431. Cells were monitored after for 3 days post treatment/transfection, and data was read in triplicates to generate the standard deviation error bars.

The primary function of PARP1 is DNA damage, hence it is essential to see the effect of PARP1 AMO on DNA damage repair inhibition compared to PARP1i. A Comet assay was carried out to check for DNA damage. DNA damage is displayed by a warped shape of the cell or a trail of fragmented DNA known as a comet. MCF7 cells were treated with 0.05uM Doxorubicin, and 10uM PARP1 inhibitor. Due to technical reasons, this experiment was done with MCF7, but a repeat is planned with MDAMB231. Cells were harvested after 24h of treatment and imaged using an EVOS Cell Imaging Machine, and 10 images were captured per treatment, and 4 are displayed here (Fig. 7). Cells treated with DMSO, and cells treated with 0.05uM Doxorubicin alone showed no DNA damage, shown by the round cells in the images (Fig. 7Ai-iv). Half the number of cells treated with PARP1 inhibitor alone showed DNA damage (6 out of 12 cells), and a representative of that is shown in Figure 7Ciii-iv. However, a high number of cells treated 13 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis with both PARP1 inhibitor and Doxorubicin showed DNA damage (9 out of 12 cells) showed by the comet tail next

to the cells shown in Figure 7Di, ii, iv. Therefore, it can be concluded that PARP1 inhibitor causes DNA damage in more cells only when coupled with doxorubicin in MCF7. Figure 7. The combination of Doxorubicin and PARP1 inhibitor causes DNA damage in MCF7. A Comet Assay was carried for MC7F cells 24 hours after treatment with 0.05uM Doxorubicin and 10uM PARP1 inhibitor (AZD246). Samples were run at 80V for 20 minutes, and 10 images per treatment were taken. A: samples were treated with DMSO as a negative control for DNA damage. B: Cells were treated with 0.05uM Doxorubicin. C: cells were treated with 10uM PARP1 inhibitor. D: cells were treated with 10uM PARP1 inhibitor and 0.05uM PARP1 inhibitor. The cells were incubated with 1X vista dye for 15 minutes and imaged in UV.

The effect of PARP1 AMO on DNA damage needed to established. As the hypothesis states that PARP1 AMO will obliterate all functions of PARP1, and DNA damage is the primary function of PARP1, this needed to be tested. MDAMB231 cells were treated with 50uM PARP1 AMO with or without the presence of Doxorubicin, and the DNA damage was analyzed using a Comet assay as described earlier (Fig. 8). Control AMO transfection showed no DNA damage as seen by the round cell shapes (1 out of 10 cells showed DNA damage) (Fig. 8A). The sample transfected 14 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis with the control AMO and treated with doxorubicin showed a small number of cells with DNA damage (6 out of 10 cells), as seen by the warped cell shapes in panels Bi and Biii of Figure 7. Transfection with PARP1 AMO also seemed to have an effect on DNA damage (6 out of 10 cells showed DNA damage) as seen in Figure 7Ci and 7Ciii- iv. Finally, the PARP1 transfected cells that were treated with Doxorubicin showed a high number of cells showing DNA damage (9 out of 10 cells), as most of the cells in the sample displayed a warped cell shape seen in Figure 8Di-ii and iv. Therefore, it is clear that PARP1 AMO is capable of producing DNA damage, and when this sample is challenged with a DNA damaging reagent, such as Doxorubicin, we observe high number of cells showing DNA damage. This answers another part of our hypothesis in which PARP1 AMO inhibits PARP1 protein function in DNA damage repair.

Figure 8. The combination of PARP1 AMO and Doxorubicin causes significant DNA damage in MDAMB231 cells. A Comet Assay was carried for MDAMB231 cells 24 hours after transfection + treatment with 0.05uM Doxorubicin. Samples were run at 30V for 20 minutes in an electrophoresis chamber in 1X TBS, and 10 cell images per treatment were taken, 4 are shown here. A: Cells were transfected with 50uM Control AMO. B: Cells were transfected with 50uM Control AMO, and treated with 0.05uM Doxorubicin. C: Cells were transfected with 50uM PARP1 AMO. D: Cells were transfected with 50uM PARP1 AMO and treated with 0.05uM Doxorubicin. The cells were incubated with 1X vista dye for 15 minutes and imaged in UV.

15 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

PARP1 also has a function in migration and invasion, and since our hypothesis states that PARP1 AMO will be able to block this function, this needed to be tested. Additionally, whether or not PARP1 inhibitor has the ability to block migration also needs to be confirmed. MDAMB231 cells were treated with either DMSO (positive control for migration), or PARP1 inhibitor (Fig. 9A). A wound healing assay was carried out in which cells were plated in a 96- well plate well and allowed to settle, then a round stopper was removed from the middle in order to reveal a round area with no cells. Red circles have been placed on the images in order to track the migration of the cells into the circles made by the rubber stopper. As can be seen for the DMSO treated sample, on Day 2 cells moved into the red circle, meaning that they have migrated. For the PARP1 inhibitor treated sample, cells also are apparently migrated into the circle at Day 2 as seen when comparing the sample to Day 0 (Fig. 9A-C). Therefore, we can conclude that PARP1 inhibitor has little to no effect on cell migration. The migration assay had to be carried out for PARP1 AMO as well in order to answer the hypothesis. Cells were treated with 50uM PARP1 AMO and 50uM Control AMO, and the cell migration was tracked as mentioned earlier (Fig. 9B). As can be seen from the cells transfected with Control AMO, there is a slight migration of the cells into the red indicated circle on the Day 2 post the treatment (Fig. 9B). Meanwhile, for the samples that were transfected with PARP1 AMO there is a little mount of migration into the center of the well. Therefore it could be concluded from this figure that PARP1 AMO reduces cell migration.

16 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Figure 9. PARP1 AMO disrupts migration more so than PARP1 inhibitor. A: MDAMB231 cells were treated with DMSO or 10uM PARP1 inhibitor. B: MDAMB231 cells were transfected with 50uM Control AMO or 50uM PARP1 inhibitor. 100,000 cells were plated per well in a 96-well plate, and monitored for 3 days, and imaged using an EVOS Cell Imaging Machine.

To shift gears, another form of inhibiting PARP1 splicing could be inhibited by targeting the binding site of an RBP that is involved in splicing by an AMO. In order to find an RBP that could bind PARP1 in either intron 22 or exon 22, a list of RNA binding proteins was found on RBPDB and the sequence of the binding site were found on the PARP1 mRNA and marked as can be seen by the black vertical lines on top of the PARP1 pre-mRNA (Fig. 10). The yellow lines below the PARP1 pre-mRNA represent the experimentally obtained RNA binding proteins of PARP1. This figure is the condensed version of the RBP analysis, and it displays only 6 RBPs that have been chosen due to their ability to bind PARP1 within the exon 22- intron 22 junction, with few binding elsewhere. Hence, the RBPs that could be involved in PARP1 minor intron splicing were FUS, ALKBH5, EWSR1, HNRNPD, TIA1, and TIAL1. A ranking system needed to be established in order to narrow down the RNA binding protein that will be targeted for blocking by an AMO. The following criteria was determined and given an arbitrary score based on the relevance to this project: functional relevance to minor intron splicing (10), relevance of RBP in breast cancer (5), correlation with breast cancer (5), relevance to PARP1 (5), correlation with PARP1 expression (2) (Supplementary Table. 1). According to this criteria EWSR1 and TIAL1 had no functions with regards to minor intron splicing, let alone any form of mRNA or protein expression and manipulation. Therefore, these two proteins were eliminated from the final ranking. A total score was given based on the criteria, and a percentage score was calculated for each of the RNA binding proteins (Supplementary 17 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Table. 1). It can be found that FUS had the highest amount of relevance to this project, since it got a score of 83.3%. Therefore, FUS was chosen to be the RNA binding protein of which the binding site will be blocked using an AMO.

Exon 23 Exon 22

Figure 10. The top 6 RBP’s that could be involved in PARP1 intron 22 splicing aligned with the PARP1 gene visualized on UCSC genome browser. The black lines on top of the PARP1 gene represent the RBPDP RBP’s that bind in the exon 22- 23 junction, and the yellow lines represent the experimentally obtained RBPs. These set of RBP’s show preferential binding around the exon 22-23 junction, unlike the rest of the RBP’s.

18 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Discussion: This project has made progress towards answering the hypothesis, but there are many questions that have yet to be answered. To reiterate, this project aimed to inhibit PARP1 splicing, therefore inhibiting the PARP1 protein production. We hypothesized that by inhibiting PARP1 protein production, we should inhibit all functions of PARP1 which include DNA damage repair, regulation of gene transcription, upregulating inflammatory signals, regulating cell cycle, and promoting angiogenesis and metastasis. In this project we have used PARP1 AMO which works by inhibiting the binding of minor intron snRNPs, which in turn inhibits minor intron splicing of PARP1 intron 22. Additionally, cells were treated with PARP1 inhibitor (AZD246) in order to see if PARP1 inhibitor blocks other functions of PARP1 as well. This project confirmed the effect of PARP1 AMO on decreasing PARP1 mRNA levels, and protein levels. The concentration of PARP1 AMO was optimized, as well as the concentration of Doxorubicin for the dual treatment in the DNA damage repair assay. The PARP1 functions that have been studied in the presence of either PARP1 AMO or PARP1 inhibitor are DNA damage repair (Comet Assay), Migration (Wound healing assay), and cell proliferation (Cell Titre-Glo assay). Results from Figure 2 revealed that the concentration of PARP1 AMO to be used in future experiments was to be higher than 12.5uM. Prior to investigating the hypothesis, the concentration of AMO that was to be used in the future experiments needed to be optimized. Therefore, a dosing of PARP1 AMO was carried out, and it was also created to see if there is a dose dependent decrease in spliced PARP1 mRNA. What this experiment revealed was that higher PARP1 AMO concentrations (above 12.5uM) revealed to have more than 73.6% splicing inhibition. This indicated that a higher concentration must be used if we want to produce a greater level of splicing inhibition. However, the quality of the data presented in this figure is not high, due to there being smearing in some of the lanes, which indicates RNA degradation. Therefore, there might have been issues in performing the RT-PCR. Additionally, the loading was not equal in all of the lanes (as seen by the varying GAPDH band intensities), therefore the results were normalized after ImageJ Quantification, and the experiment was repeated. Figure 3 revealed that PARP1 AMO not only inhibits PARP1 mRNA splicing, but it also inhibits PARP1 protein production. After establishing that a concentration higher than 12.5uM of PARP1 AMO must be used, the following experiments tested 25 and 50uM on both mRNA expression and protein expression. What the results revealed was that indeed there was a dose dependent increase in unspliced mRNA for the PARP1 AMO transfected cells, with 50uM showing a 79.0% splicing inhibition. This is much higher than that of 25uM PARP1 AMO. Since 50uM PARP1 AMO yielded higher splicing inhibition, it was the concentration that was chosen to proceed for future experiments. Additionally, the western blot analysis confirmed a segment of our hypothesis, that indeed, by inhibiting PARP1 splicing we inhibit PARP1 protein production. The results of Figure 4C-D reveal this, which show us that upon 50uM PARP1 AMO treatment only 21% protein is produced compared to the control. The results of this figure confirm a segment of our hypothesis that PARP1 AMO inhibits PARP1 protein production. Multiple factors contribute the observation that 11.7% of PARP1 RNA produced 21% of PARP1 protein. These include sensitivity differences in the techniques used for measuring RNA and proteins as well as the difference in half lives of these molecules. While all of pre-existing PARP1 RNA might have been degraded by the time we extracted RNA, some residual PARP1 protein that existed before transfecting the AMO might linger within the time frame of protein extraction. Additionally, the effect of Doxorubicin on PARP1 mRNA and protein needed to be clarified. According to Figure 3C-D, Doxorubicin does not interfere with PARP1 mRNA production, which was expected. However, this needed to be confirmed as to rule out that in the case of combining treatments, that the PARP1 AMO or PARP1 inhibitor were the only reagents that were affecting PARP1 activity. Therefore, these results show that doxorubicin does not interfere with PARP1 expression. 19 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

The effect of PARP1 AMO as well as PARP1 inhibitor on cell proliferation needed to be established. This is in order to answer a part of the hypothesis of whether or not PARP1 AMO inhibits the progression of the cell proliferation. In order to achieve this, a Cell Titre-Glo was carried out on cells treated with PARP1 AMO alone or PARP1 inhibitor alone (Fig. 5). What we can conclude from this figure, is that 50uM PARP1 AMO lead to a decrease in cell proliferation compared to the control AMO alone. This is expected as PARP1 has the ability to block apoptosis, as it is able to reduce the level of DNA damage in the cells that would typically lead to apoptosis. Hence, upon the addition of PARP1 AMO, we are blocking this function of PARP1 and re-activating apoptosis. On the other hand, PARP1 inhibitor does not seem to reduce the proliferation of cells after 2 days post treatment, compared to the DMSO control. This could be because PARP1 inhibitor has unspecific binding, and therefore does not target PARP1 efficiently. Another reason could be that PARP1’s ability to block apoptosis is associated with another domain that is not blocked by the PARP1 inhibitor, and hence the inhibitor is not blocking it, allowing PARP1 to function normally. However, the error bars are large for this figure, and so this figure needs to be repeated. Hence, the treatment of PARP1 AMO alone showed a decrease in cell proliferation, while PARP1 inhibitor alone had no effect on cell proliferation. This confirms our hypothesis in that PARP1 AMO is able to block PARP1’s function in cell proliferation and PARP1 inhibitor could not. Since, PARP1 inhibitor is usually coupled with Doxorubicin for DNA damage enhancement, PARP1 AMO was analyzed in the same lens to see if it performs differently. What we concluded from Figure 6 was that the addition of doxorubicin to transfected cells leads to a loss in proliferation. This was expected, to the fact that transfection increases the stress in the cells, and that DNA damaging reagents, such as doxorubicin, have the ability to increase cell stress due to the DNA damage they cause to the cells. We also observed that 50uM PARP1 AMO with Doxorubicin also have a decreasing effect on proliferation. The expectation was that the combination of PARP1 AMO and doxorubicin was going to have a larger effect on reducing proliferation than each treatment alone. However, this was not observed, and so we speculate that technical issues with cell plating or the stress levels of the cells might have interfered with this experiment. Finally, the effect of PARP1 inhibitor with doxorubicin on proliferation could not be concluded. Issues with the quality of the data make it impossible to draw reliable conclusions. It was expected that PARP1 inhibitor will produce a reduction in proliferation when coupled with doxorubicin, because this is the way we have seen PARP1 inhibitor behave clinically. However, the DMSO treated cells do not act the way that they are expected, due to them not showing an increase in proliferation on the course of 4 days, and this could be also due to technical issues. Figure 6C reveals a very large margin of error on Day 3, therefore, this experiment needs to be repeated. Generally, Figure 6 reveals that the addition of PARP1 AMO to doxorubicin reduces cell proliferation, but does not allow us to draw conclusions about PARP1 inhibitor. In order to answer whether or not PARP1 AMO inhibits DNA damage repair, the level of DNA damage was measured using a Comet assay and compared with PARP1 inhibitor. Instead of MDAMB231, MCF7 cells were used due to there being issues in the lab with not having enough MDAMB231 cells at the time the assay needed to be carried out. For the PARP1 inhibitor, MCF7 cells that were treated with DMSO showed no DNA damage, which is expected, because DMSO should not cause DNA damage. A little amount of Doxorubicin-treated cells also showed DNA damage, and this could be because the DNA damage that was generated was repaired by PARP1. For the PARP1 inhibitor treatment alone, there was also a little amount of cells (50%) showing DNA damage, due to there not being enough damage generated on the course of 24 hours. As was expected, PARP1 inhibitor and Doxorubicin would cause higher number of cells with DNA damage (75%), as Doxorubicin would cause DNA damage, and PARP1 would not be able to repair it. Hence, Figure 7 demonstrated that PARP1 inhibitor with Doxorubicin causes DNA damage in MCF7 cells. MDAMB231 cells are predicted to act the same way MCF7 cells did, but the assay will be repeated with MDAMB231 in order to confirm this. Additionally, the effect of PARP1 AMO and doxorubicin on DNA damage was studied using a comet assay (Fig. 8). What this revealed is that PARP1 AMO alone causes DNA damage in most of the cells in the sample (60%), and 20 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis this could be because PARP1 AMO managed to block the ability of PARP1 to repair the endogenous amounts of DNA damage. However when coupled with doxorubicin, PARP1 AMO showed DNA damage in 90% of the cells. This was expected, because PARP1 AMO reduced PARP1 protein to 21%, hence only 21% of PARP1 would be able to fix the damage that was induced by doxorubicin. Additionally, this DNA damage is seen to be much more prevalenct than in the PARP1 inhibitor treated sample, and this could be due to the unspecificity of PARP1 inhibitor binding. Hence, PARP1 AMO impairs PARP1 protein’s function in DNA damage repair, which is in line with the hypothesis. Finally, the effect of PARP1 AMO on migration was studied. A simple wound healing assay revealed that PARP1 inhibitor did not block the function of PARP1 in migration. This was expected due to PARP1 inhibitor only blocking one domain of PARP1, which is in charge of the DNA damage repair. As this allows the rest of the domains to function normally, migration was expected to be carried out as expected. However, we have observed that PARP1 AMO might block migration, but this is not a conclusion said with full confidence. This is because the cell images contain a lot of debris, and it makes distinguishing between live and dead cells difficult. It was predicted that PARP1 AMO would block the protein production, and hence migration function. Although concrete conclusions could not be made about this experiment, a repeat in the future might reveal more about PARP1 function in cell migration.

21 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Conclusions and future work: PARP1 AMO showed results that encourage future experiments. The questions that our research has answered is that indeed, PARP1 AMO does inhibit PARP1 splicing, and protein production. Additionally, we have answered part of the hypothesis concerning the effect of PARP1 AMO on these functions of PARP1: cell proliferation and DNA damage repair. PARP1 AMO when coupled with Doxorubicin causes a decreasing effect on cell proliferation, and an increasing effect on DNA damage. Therefore, some functions pertaining to PARP1 that are involved in cancer hallmarks have been proven to decrease with PARP1 AMO addition, which PARP1 inhibitor did not manage to achieve. On the other hand, conclusions about PARP1 AMO on migration could not be drawn, and so this assay needs to be repeated in the future. Additionally, the effect of PARP1 AMO on other cancer hallmarks have not yet been studied yet. In future experiments PARP1 functions that could be studied include gene transcription, upregulating inflammatory signals, and angiogenesis. Additionally, analysis on FUS needs to take place as we need to establish its effect on PARP1 splicing. This could be done by the knockdown or the over-expression of FUS, followed by the RT-PCR of PARP1 mRNA or Western blot of PARP1 protein, to see the effect of FUS on PARP1 expression.

22 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

References: 1. Wang, L., Liang, C., Li, F., Guan, D., Wu, X., Fu, X., Lu, A., & Zhang, G. (2017). PARP1 in Carcinomas and PARP1 Inhibitors as Antineoplastic Drugs. International journal of molecular sciences, 18(10), 2111. https://doi.org/10.3390/ijms18102111 2. Donnelly, T., et al, Jong, F., (2011). Study exploring breast cancer screening practices amongst Arabic women living in the State of Qatar, Avicena. retrieved from: doi: 10.5339/avi.2011.1 3. Harbeck, N., et al, Cardoso, F., (2019). Breast cancer, Nature Reviews Disease Primers, 5(66), retrieved from: https://doi.org/10.1038/s41572-019-0111-2 4. Godet, I., Gikes, D., (2017). BRCA1 and BRCA2 mutations and treatment strategies for breast cancer. Integrative Cancer Science and Therapeutics. 4(1), doi: 10.15761/ICST.1000228 5. El Marabti E, Younis I., (2018). The Cancer Spliceome: Reprograming of Alternative Splicing in Cancer, Frontiers in Molecular Biosciences, 5(80), doi: 10.3389/fmolb.2018.00080. PMID: 30246013; PMCID: PMC6137424. 6. National Cancer Institute, n.d., retrieved from: https://www.cancer.gov/publications/dictionaries/genetics- dictionary/def/splicing 7. Olthof, A., Hyatt, K., & Kanadia, R., (2019). Minor intron splicing revisited: identification of new minor intron-containing genes and tissue-dependent retention and alternative splicing of minor introns, BMC Genomics, 20(686) 8. Caldecott, K. (2008) Single-strand break repair and genetic disease. Nat Rev Genet 9, 619–631. https://doi.org/10.1038/nrg2380 9. Zhivotovsky, B., & Kroemer, G. (2004). Apoptosis and genomic instability. Nature reviews. Molecular cell biology, 5(9), 752–762. https://doi.org/10.1038/nrm1443 10. Vascotto, C., Poletto, M., Tell, G., (2016). Chapter 3 - Understanding the basics for translating the base excision repair pathway from benchtop to bedside in cancer treatment, DNA Repair in Cancer Therapy (Second Edition), p. 83-114 11. Pines, A., Vrouwe, M. G., Marteijn, J. A., Typas, D., Luijsterburg, M. S., Cansoy, M., Hensbergen, P., Deelder, A., de Groot, A., Matsumoto, S., Sugasawa, K., Thoma, N., Vermeulen, W., Vrieling, H., & Mullenders, L. (2012). PARP1 promotes nucleotide excision repair through DDB2 stabilization and recruitment of ALC1. The Journal of cell biology, 199(2), 235–249. https://doi.org/10.1083/jcb.201112132 12. Simbulan-Rosenthal, C., Rosenthal, D., Luo, R. et al. (2003). PARP-1 binds E2F-1 independently of its DNA binding and catalytic domains, and acts as a novel coactivator of E2F-1-mediated transcription during re-entry of quiescent cells into S phase. Oncogene 22, 8460–8471. https://doi.org/10.1038/sj.onc.1206897 13. Homo sapiens poly(ADP-ribose) polymerase 1 (PARP1), mRNA, n.d, Ncbi.nlm.nih.gov, retieved from: https://www.ncbi.nlm.nih.gov/nuccore/NM_001618.4?report=GenBank 14. Loughlin, F., E., et al., (2018). The Solution Structure of FUS Bound to RNA Reveals a Bipartite Mode of RNA Recognition with Both Sequence and Shape Specificity, Molecular Cell, 73, p. 490–504, DOI:https://doi.org/10.1016/j.molcel.2018.11.012 15. Antolín, A. A., & Mestres, J. (2014). Linking off-target kinase pharmacology to the differential cellular effects observed among PARP inhibitors. Oncotarget, 5(10), 3023–3028. https://doi.org/10.18632/oncotarget.1814 16. Poly(ADP-ribose) polymerase 1 (PARP1), n.d., UniProtKB, retieved from: https://www.uniprot.org/uniprot/P09874#interaction 17. PARP1, poly(ADP-ribose) polymerase 1, Homo Sapiens, Minor Intron-Containing Gene Information, MIDB. Retrieved from: https://midb.pnb.uconn.edu/gene/1097#heading1236

23 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

18. Do, K., & Chen, A. P. (2013). Molecular pathways: targeting PARP in cancer treatment. Clinical cancer research : an official journal of the American Association for Cancer Research, 19(5), 977–984. https://doi.org/10.1158/1078-0432.CCR-12-0163 19. PARP1 gene, (n.d.). GeneCards, retrieved from: https://www.genecards.org/cgi- bin/carddisp.pl?gene=PARP1#proteins 20. Nile, D.L., Rae, C., Hyndman, I.J. et al., (2016). An evaluation in vitro of PARP-1 inhibitors, rucaparib and olaparib, as radiosensitisers for the treatment of neuroblastoma, BMC Cancer, 16 (621). https://doi.org/10.1186/s12885-016-2656-8 21. Wang, P., Xue, L., Wang, L., Tang, H., Lv, C., & Xue, Q. (2020). Long noncoding RNA DLX6-AS1 promotes migration and invasion of breast cancer cells by upregulating FUS. Panminerva medica, 10.23736/S0031-0808.19.03773-X. Advance online publication. https://doi.org/10.23736/S0031- 0808.19.03773-X 22. Xiang, Y., Laurent, B., Hsu, C. H., Nachtergaele, S., Lu, Z., Sheng, W., Xu, C., Chen, H., Ouyang, J., Wang, S., Ling, D., Hsu, P. H., Zou, L., Jambhekar, A., He, C., & Shi, Y. (2017). RNA m6A methylation regulates the ultraviolet-induced DNA damage response. Nature, 543(7646), 573–576. https://doi.org/10.1038/nature21671 23. Singatulina, A. S., Hamon, L., Sukhanova, M. V., Desforges, B., Joshi, V., Bouhss, A., Lavrik, O. I., & Pastré, D. (2019). PARP-1 Activation Directs FUS to DNA Damage Sites to Form PARG-Reversible Compartments Enriched in Damaged DNA. Cell reports, 27(6), 1809–1821.e5. https://doi.org/10.1016/j.celrep.2019.04.031 24. Ke, S., Pandya-Jones, A., Saito, Y., Fak, J. J., Vågbø, C. B., Geula, S., Hanna, J. H., Black, D. L., Darnell, J. E., Jr, & Darnell, R. B. (2017). m6A mRNA modifications are deposited in nascent pre-mRNA and are not required for splicing but do specify cytoplasmic turnover. Genes & development, 31(10), 990–1006. https://doi.org/10.1101/gad.301036.117 25. Song, H., Feng, X., Zhang, H., Luo, Y., Huang, J., Lin, M., Jin, J., Ding, X., Wu, S., Huang, H., Yu, T., Zhang, M., Hong, H., Yao, S., Zhao, Y., & Zhang, Z. (2019). METTL3 and ALKBH5 oppositely regulate m6A modification of TFEB mRNA, which dictates the fate of hypoxia/reoxygenation-treated cardiomyocytes. Autophagy, 15(8), 1419–1437. https://doi.org/10.1080/15548627.2019.1586246 26. Zhao, X., Yang, Y., Sun, B. F., Shi, Y., Yang, X., Xiao, W., Hao, Y. J., Ping, X. L., Chen, Y. S., Wang, W. J., Jin, K. X., Wang, X., Huang, C. M., Fu, Y., Ge, X. M., Song, S. H., Jeong, H. S., Yanagisawa, H., Niu, Y., Jia, G. F., … Yang, Y. G. (2014). FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell research, 24(12), 1403–1419. https://doi.org/10.1038/cr.2014.151 27. Latorre, E., Torregrossa, R., Wood, M. E., Whiteman, M., & Harries, L. W. (2018). Mitochondria-targeted hydrogen sulfide attenuates endothelial senescence by selective induction of splicing factors HNRNPD and SRSF2. Aging, 10(7), 1666–1681. https://doi.org/10.18632/aging.101500 28. Min KW, Jo MH, Shin S, Davila S, Zealy RW, Kang SI, Lloyd LT, Hohng S, Yoon JH. AUF1 facilitates microRNA-mediated gene silencing. Nucleic Acids Res. 2017 Jun 2;45(10):6064-6073. doi: 10.1093/nar/gkx149. PMID: 28334781; PMCID: PMC5449627. 29. Dvinge, H., Kim, E., Abdel-Wahab, O., & Bradley, R. K. (2016). RNA splicing factors as oncoproteins and tumour suppressors. Nature reviews. Cancer, 16(7), 413–430. https://doi.org/10.1038/nrc.2016.51 30. Singh, N. N., Seo, J., Ottesen, E. W., Shishimorova, M., Bhattacharya, D., & Singh, R. N. (2011). TIA1 prevents skipping of a critical exon associated with spinal muscular atrophy. Molecular and cellular biology, 31(5), 935–954. https://doi.org/10.1128/MCB.00945-10 31. Wu, L., Wu, D., Ning, J., Liu, W., & Zhang, D. (2019). Changes of N6-methyladenosine modulators promote breast cancer progression. BMC cancer, 19(1), 326. https://doi.org/10.1186/s12885-019-5538-z 24 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

32. Du, W. W., Yang, W., Li, X., Awan, F. M., Yang, Z., Fang, L., Lyu, J., Li, F., Peng, C., Krylov, S. N., Xie, Y., Zhang, Y., He, C., Wu, N., Zhang, C., Sdiri, M., Dong, J., Ma, J., Gao, C., Hibberd, S., … Yang, B. B. (2018). A circular RNA circ-DNMT1 enhances breast cancer progression by activating autophagy. Oncogene, 37(44), 5829–5842. https://doi.org/10.1038/s41388-018-0369-y 33. Arnould, L., Gelly, M., Penault-Llorca, F., Benoit, L., Bonnetain, F., Migeon, C., Cabaret, V., Fermeaux, V., Bertheau, P., Garnier, J., Jeannin, J. F., & Coudert, B. (2006). Trastuzumab-based treatment of HER2- positive breast cancer: an antibody-dependent cellular cytotoxicity mechanism?. British journal of cancer, 94(2), 259–267. https://doi.org/10.1038/sj.bjc.6602930 34. Bock, F. J., Todorova, T. T., & Chang, P. (2015). RNA Regulation by Poly(ADP-Ribose) Polymerases. Molecular cell, 58(6), 959–969. https://doi.org/10.1016/j.molcel.2015.01.037

25 Reem Alsayed 3/26/21 03-545, S21 Professor Ihab Younis

Appendix: Supplementary Table 1. Ranking of RNA binding proteins

Correlation Correlation Functional relevance to Relevance of RBP in breast with breast Relevance of RBP in with PARP1 total percent RBP minor intron splicing /10 cancer /5 cancera /5 PARP1 /5 expressiona /2 /27 relevance

PARP1 might recruit Has a confirmed function Upregulated (Wang, et al., FUS for DNA damage in minor intron splicing 2020) repair (Singatulina, r= FUS (Molecular Cell) 10 5 r= 0.304 2.5 2019) 0.264 1 22.5 83.3

In charge of m6A Changes of N6- Inhibition of m6A modifications, which methyladenosine methylation leads to some papers say are modulators promote breast similar phenotype as involved in splicing (Ke, cancer progression (Wu, PARP inhibition et al., 2017; Song, et al., r= - 2019) (Xiang, et al., 2017) ALKBH5 2019; Zhou, et al., 2014) 4 5 r= 0.059 0 0.0153 0 12.5 46.3

There is only some relevance to splicing, no Binds and regulates minor intron splicing oncogenic genes in breast known (Lattore, 2018; cancer (Du, 2018) r= hnRNPD Min, 2017) 5 5 r= 0.332 3 N/A 0.136 0.5 13.5 50.0

Important function in Correlation of tumor splicing alone without works in synergy with response with level of minor intron splicing PARP1 when cell is immune cell infiltration (Dvinge, 2016; Singh r= - stressed (Bock, 2015) r= - (Arnould, 2006) TIA1 2011) 8 4 0.0353 0 0.0480 0 14 51.9

a. This was found from Xena Browser