DOCSLIB.ORG

Pantothenate Kinase-Associated Neurodegeneration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pantothenate Kinase-Associated Neurodegeneration Neurology International 2018; volume 10:7516 Pantothenate kinase-associated toms.4-6 This review aims to describe the neurodegeneration: clinical manifestation, pathophysiology and Correspondence: Saeed Razmeh, Yasuj the treatment of PKAN disease. University of Medical Sciences, Kohgiluyeh Clinical aspects, diagnosis and Boyer-Ahmad Province, Yasuj, Shahid and treatments Motahari Blvd, Iran. E-mail: [email protected] 1 2 Materials and Methods Saeed Razmeh, Amir Hassan Habibi, Key words: Pantothenate Kinase-Associated 2 2 Maryam Orooji, Elham Alizadeh, Etiology Neurodegeneration, Neurodegeneration with 3 Karim Moradiankokhdan, The iron normally accumulated in the brain iron accumulation. Behroz Razmeh3 basal ganglia, hippocampus, cerebellar Contributions: the authors contributed equally. 1Yasuj University of Medical Sciences, nuclei and another subcortical region.7 The 2 Yasuj; Iran University of Medical PKAN characterized by a mutation in the Conflict of interest: the authors declare no Sciences, Tehran; 3Kermanshah PANK 2 that codes the pantothenate kinase potential conflict of interest. University of Medical Sciences, 2. Mutations are missense, duplication, Kermanshah, Iran deletion, splice site mutation and deletion of Funding: none. exon.8 This protein kinase is responsible for the phosphorylation of pantothenate and Received for publication: 30 November 2017. this product combine with cysteine. The Revision received: 29 December 2017. Accepted for publication: 4 February 2018. Abstract cysteine increase in the globus pallidus of patients with PKAN that in association with This work is licensed under a Creative iron produce free radicals and cell dama- Pantothenate Kinase-Associated Commons Attribution NonCommercial 4.0 9,10 Neurodegeneration (PKAN) is an autoso- ge. The Mutations of PANK2 also found License (CC BY-NC 4.0). mal recessive disorder characterized by a in patients with HARP (hypoprebetalipo- mutation in the PANK2 gene. The clinical proteinemia, acanthocytosis, retinitis pig- ©Copyright S. Razmeh et al., 2018 presentation may range from only speech mentosa, and pallidal degeneration). The Licensee PAGEPress, Italy disorder to severe generalized dystonia, HARP is rare disease and has mental decli- Neurology International 2018; 10:7516 spasticity, Visual loss, dysphagia and ne, abnormal movement and vision loss.11 doi:10.4081/ni.2018.7516 dementia. The hallmark of this disease is eyes of the tiger sign in the medial aspect of Diagnosis bilateral globus pallidus on T2-weighted Today, the PKAN disease is diagnosed MRI that is a hyperintense lesion surround- by magnetic resonance imaging and con- Classification and presentations ed by hypointensity. Common treatments 12 firmed with the genetic test. Susceptibility It separated into classic and atypical for PKAN disease include anticholinergics, weighted imaging (SWI) and field dependent form. The classic form starts in early child- botulinum toxin, Oral and Intrathecal R2 increase (FDRI) are the choice methods hood with rapid progression of symptoms baclofen, Iron chelation drugs and surgical for the diagnosis of this disease and FDRI is including Parkinsonism, dystonia, cognitive procedures such as ablative pallidotomy or more sensitive than SWI for detection of decline and dementia, dysarthria, spasticity, thalamotomy, Deep brain stimulation. brain iron.13 We can also use the cranial There are many controversies about the seizure, optic atrophy, pigmentary retinopa- sonography that detects the over load of iron thy that disable the patient very sever. pathogenesis and treatment of this disease, 14 in midbrain. The hallmark of this disease in Atypical form of disease has later onset and and in recent years interesting studies have the BRAIN MRI is eye of the tiger sign. The been done on PKAN disease and other sim- less common than classic form and it may eye of the tiger is a hyperintense lesion sur- not be recognized by aging and has milder ilar diseases. This review summarizes the rounded by hypointensity in the medial clinical presentation, etiology, imaging symptoms with slow progression in com- aspect of bilateral globus pallidus on T2- 20,21 modalities and treatment. pared to classic type. The neuropsychi- weighted MRI. Central hyperintensity shows atric disorder includes Obsessive- gliosis in globus pallidus and the surround- Compulsive Disorder (OCD) , depression ing hypointensity showing iron deposition and schizophrenia-like psychosis.22 In study (Figures 1 and 2).15 All of the patients with Introduction that assessed the Intellectual and adaptive eye-of-the-tiger sign don’t have PANK2 behavior functioning 16 children and adults Neurodegeneration with brain iron mutation, Streckera et al. report a patient with PKAN, there is varied cognitive accumulation (NBIA) is a wide number of with multiple system atrophy (MSA) and expression, also there was an inverse corre- neurodegenerative disorders characterized systemic lupus erythematodes that has typi- lation between the onset of the disease and by iron accumulation in the brain, especial- cal Eye of the Tiger sign in T2-weighted the cognitive impairment.23 The ophthalmo- 16 ly basal ganglia, substantia nigari, hip- MRI. Chaw-Liang Chang also reported a logic manifestation is variable and includes 1,2 pocampus and cerebellar nuclei. The typ- patient with cervical dystonia that has Eye of saccadic pursuits, convergence impairment, ical presentation of NBIA disorder includes the Tiger without evidence of PANK2 gene vertical hypermetric saccades, square wave 17 dystonia, Parkinsonism, choreoathetosis, mutation. This sign also reported in a jerks and pigmentary retinopathy.24 mental dysfunction, spasticity, visual distur- patient with mitochondrial membrane pro- bance and bulbar dysfunction.3 The most tein associatedneurodegeneration (MPAN).18 common form of NBIA is PKAN also The brain MRI may be normal in the Early known as NBIA-1 that is an autosomal Stages of Classic Pantothenate Kinase Treatment recessive disorder characterized by a muta- Associated Neurodegeneration and after the tion in the PANK 2 at locus 20 P12.3 This progression of disease, the Eye of the Tiger Medications disease also has various psychiatry symp- sign appear.19 There is currently no suitable therapy [page 32] [Neurology International 2018; 10:7516] Review Figure 1. T2 weighted Brain magnetic res- onance imaging of the patient that shows hyperintense lesion surrounded by hypointensity in the medial aspect of bilat- eral globus pallidus (eye-of-the-tiger). Figure 2. Susceptibility weighted imaging (SWI) of the PKAN patient that shows hypointense lesion in the medial aspect of bilateral globus pallidus. for PKAN patients and different available stimulation.33 In PKAN patients that have brain iron accumulation: from genes to drugs don’t effect on disease progression.25 severe dystonia, spasticity and pain, pathogenesis. Semin Pediatr Neurol Dystonia can be profoundly disabling in the intrathecal baclofen (ITB) pump can allevi- 2006;13:182-5. affected patients and progresses over time ate the symptoms.34 Blair Ford et al. shows 2. Thomas M, Hayflick SJ, Jankovic J. and involves many parts of the body. It usu- intrathecal baclofen is more effective if the Clinical heterogeneity of neurodegener- ally treated with anticholinergics, botu- dystonia is associated with spasticity and ation with brain iron accumulation and linum toxin, Oral and Intrathecal baclofen, pain35 it can also use intraventricular. In a pantothenatekinase-associated neurode- benzodiazepines, Clonidine, gabapentin, study of Albright et al on ten patients with generation. Movement Disord 2004; pregabalin, tetrabenazine and other anti- severe generalized secondary and heredode- 19:36-42. spasticity drugs, alone or in combina- generative dystonia, Intraventricular 3. Hogarth P. Neurodegeneration with tion.26,27 Vitamin B5 (pantothenate) may be baclofen was effective on dystonia.36 brain iron accumulation: diagnosis and able to improve PKAN patients by increas- management. J Mov Disord 2015;8:1- ing levels of CoA and recovery of mito- Iron chelation 13. chondrial dysfunction. In mouse models of The drugs currently used include 4. Hayflick SJ, Westaway SK, Levinson PKAN with a high-fat ketogenic diet, this deferiprone, deferoxamine and B, et al. Genetic, clinical, and radi- drug was able to prevent some neurological deferasirox.37 Nowadays, Deferiprone have ographic delineation of PKAN disease. symptoms, But to investigate its effects, attracted the attention of many researchers. N Engl J Med 2003;348:33-40. clinical trial studies should be conducted in It can cross the blood-brain barrier to 5. Gregory A, Polster BJ, Hayflick SJ. 28-30 the future. remove iron and prevent its accumula- Clinical and genetic delineation of neu- tion.38,39 In studies that investigated the rodegeneration with brain iron accumu- Surgery effect of deferiprone on the NBIA patients, lation. J Med Genet 2009;46:73-80. Surgical procedures such as Deep brain the use of this drug was safe and without 6. Pawar Y, Kalra G. A case of PKAN dis- stimulation are now used for PKAN dis- adverse effects. In these studies, ease presenting as catatonic schizophre- ease.The benefit effect of Deep brain stimu- deferiprone reduced iron load in brain nia. Indian J Psychiatry 2013;55:386-9. lation, can occur quickly after surgery, But imaging and in clinical evaluations, variable 7.Hayflick SJ, Westaway SK, Levinsonetal B. Genetic clinical, and due to the progressive nature of the disease, results were obtained which
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pantothenate Kinase-Associated Neurodegeneration
    Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration.
    [Show full text]
  • A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration
    IJMCM Case Report Autumn 2016, Vol 5, No 4 A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration Soudeh Ghafouri-Fard 1, Vahid Reza Yassaee 2, Alireza Rezayi 3, Feyzollah Hashemi-Gorji 2, Nasrin Alipour 2, ∗ Mohammad Miryounesi 2 1. Department of Medical Genetics, Shahid Beheshti University of Medical sciences, Tehran, Iran. 2. Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 3. Pediatric Neurology Department, Loghman Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 29 June 2016; Accepted 14 August 2016; Published 23 October 2016 Pantothenate kinase- associated neurodegeneration (PKAN) syndrome is a rare autosomal recessive disorder characterized by progressive extrapyramidal dysfunction and iron accumulation in the brain and axonal spheroids in the central nervous system. It has been shown that the disorder is caused by mutations in PANK2 gene which codes for a mitochondrial enzyme participating in coenzyme A biosynthesis. Here we report two cases of classic PKAN syndrome with early onset of neurodegenerative disorder. Mutational analysis has revealed that both are homozygous for a novel nonsense mutation in PANK2 gene (c.T936A (p.C312X)). The high prevalence of consanguineous marriages in Iran raises the likelihood of occurrence of autosomal recessive disorders such as PKAN and necessitates proper premarital genetic counseling. Further research is needed to provide the data on the prevalence of PKAN and identification of common PANK2 mutations in Iranian population. Key words : PANK2 , pantothenate kinase-associated neurodegeneration, mutation antothenate kinase-associated neurodegen- weighted which is due to iron deposition in the Peration (PKAN) syndrome is a rare autosomal periphery (hypointensity) and necrosis on its central recessive disorder characterized by progressive part (hyperintensity) (2).
    [Show full text]
  • Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Theses, Dissertations, and Student Research in Agronomy and Horticulture Department Agronomy and Horticulture 7-2015 Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J. Morton University of Nebraska-Lincoln Follow this and additional works at: http://digitalcommons.unl.edu/agronhortdiss Part of the Agricultural Science Commons, Agronomy and Crop Sciences Commons, Plant Biology Commons, and the Plant Breeding and Genetics Commons Morton, Kyla J., "Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality" (2015). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 88. http://digitalcommons.unl.edu/agronhortdiss/88 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. BIOCHEMICAL AND PROTEOMIC PROFILING OF MAIZE ENDOSPERM TEXTURE AND PROTEIN QUALITY by Kyla J. Morton A DISSERTATION Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Doctor of Philosophy Major: Agronomy and Horticulture (Plant Breeding and Genetics) Under the Supervision of Professor David R. Holding Lincoln, Nebraska July, 2015 BIOCHEMICAL AND PROTEOMIC ANALYSIS OF MAIZE ENDOSPERM KERNEL TEXTURE AND PROTEIN QUALITY Kyla J. Morton, Ph.D. University of Nebraska, 2015 Advisor: David R. Holding The research described herein, focuses on the biochemical and proteomic analysis of the maize endosperm and what influences kernel texture.
    [Show full text]
  • O O2 Enzymes Available from Sigma Enzymes Available from Sigma
    COO 2.7.1.15 Ribokinase OXIDOREDUCTASES CONH2 COO 2.7.1.16 Ribulokinase 1.1.1.1 Alcohol dehydrogenase BLOOD GROUP + O O + O O 1.1.1.3 Homoserine dehydrogenase HYALURONIC ACID DERMATAN ALGINATES O-ANTIGENS STARCH GLYCOGEN CH COO N COO 2.7.1.17 Xylulokinase P GLYCOPROTEINS SUBSTANCES 2 OH N + COO 1.1.1.8 Glycerol-3-phosphate dehydrogenase Ribose -O - P - O - P - O- Adenosine(P) Ribose - O - P - O - P - O -Adenosine NICOTINATE 2.7.1.19 Phosphoribulokinase GANGLIOSIDES PEPTIDO- CH OH CH OH N 1 + COO 1.1.1.9 D-Xylulose reductase 2 2 NH .2.1 2.7.1.24 Dephospho-CoA kinase O CHITIN CHONDROITIN PECTIN INULIN CELLULOSE O O NH O O O O Ribose- P 2.4 N N RP 1.1.1.10 l-Xylulose reductase MUCINS GLYCAN 6.3.5.1 2.7.7.18 2.7.1.25 Adenylylsulfate kinase CH2OH HO Indoleacetate Indoxyl + 1.1.1.14 l-Iditol dehydrogenase L O O O Desamino-NAD Nicotinate- Quinolinate- A 2.7.1.28 Triokinase O O 1.1.1.132 HO (Auxin) NAD(P) 6.3.1.5 2.4.2.19 1.1.1.19 Glucuronate reductase CHOH - 2.4.1.68 CH3 OH OH OH nucleotide 2.7.1.30 Glycerol kinase Y - COO nucleotide 2.7.1.31 Glycerate kinase 1.1.1.21 Aldehyde reductase AcNH CHOH COO 6.3.2.7-10 2.4.1.69 O 1.2.3.7 2.4.2.19 R OPPT OH OH + 1.1.1.22 UDPglucose dehydrogenase 2.4.99.7 HO O OPPU HO 2.7.1.32 Choline kinase S CH2OH 6.3.2.13 OH OPPU CH HO CH2CH(NH3)COO HO CH CH NH HO CH2CH2NHCOCH3 CH O CH CH NHCOCH COO 1.1.1.23 Histidinol dehydrogenase OPC 2.4.1.17 3 2.4.1.29 CH CHO 2 2 2 3 2 2 3 O 2.7.1.33 Pantothenate kinase CH3CH NHAC OH OH OH LACTOSE 2 COO 1.1.1.25 Shikimate dehydrogenase A HO HO OPPG CH OH 2.7.1.34 Pantetheine kinase UDP- TDP-Rhamnose 2 NH NH NH NH N M 2.7.1.36 Mevalonate kinase 1.1.1.27 Lactate dehydrogenase HO COO- GDP- 2.4.1.21 O NH NH 4.1.1.28 2.3.1.5 2.1.1.4 1.1.1.29 Glycerate dehydrogenase C UDP-N-Ac-Muramate Iduronate OH 2.4.1.1 2.4.1.11 HO 5-Hydroxy- 5-Hydroxytryptamine N-Acetyl-serotonin N-Acetyl-5-O-methyl-serotonin Quinolinate 2.7.1.39 Homoserine kinase Mannuronate CH3 etc.
    [Show full text]
  • Biochemical Characterization of Pantoate Kinase, a Novel Enzyme Necessary for Coenzyme a Biosynthesis in the Archaea
    Biochemical Characterization of Pantoate Kinase, a Novel Enzyme Necessary for Coenzyme A Biosynthesis in the Archaea Hiroya Tomita,a Yuusuke Yokooji,a Takuya Ishibashi,a Tadayuki Imanaka,b,c and Haruyuki Atomia,c Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, Kyoto University Katsura, Nishikyo-ku, Kyoto, Japana; Department of Biotechnology, College of Life Sciences, Ritsumeikan University Noji-Higashi, Kusatsu, Shiga, Japanb; and JST, CREST, Sanbancho, Chiyoda-ku, Tokyo, Japanc Although bacteria and eukaryotes share a pathway for coenzyme A (CoA) biosynthesis, we previously clarified that most archaea utilize a distinct pathway for the conversion of pantoate to 4=-phosphopantothenate. Whereas bacteria/eukaryotes use pantothe- nate synthetase and pantothenate kinase (PanK), the hyperthermophilic archaeon Thermococcus kodakarensis utilizes two novel enzymes: pantoate kinase (PoK) and phosphopantothenate synthetase (PPS). Here, we report a detailed biochemical examina- tion of PoK from T. kodakarensis. Kinetic analyses revealed that the PoK reaction displayed Michaelis-Menten kinetics toward ATP, whereas substrate inhibition was observed with pantoate. PoK activity was not affected by the addition of CoA/acetyl-CoA. Interestingly, PoK displayed broad nucleotide specificity and utilized ATP, GTP, UTP, and CTP with comparable kcat/Km values. Sequence alignment of 27 PoK homologs revealed seven conserved residues with reactive side chains, and variant proteins were constructed for each residue. Activity was not detected when mutations were introduced to Ser104, Glu134, and Asp143, suggest- ing that these residues play vital roles in PoK catalysis. Kinetic analysis of the other variant proteins, with mutations S28A, H131A, R155A, and T186A, indicated that all four residues are involved in pantoate recognition and that Arg155 and Thr186 play important roles in PoK catalysis.
    [Show full text]
  • Mutations in the Pantothenate Kinase of Plasmodium Falciparum Confer Diverse Sensitivity Profiles to Antiplasmodial Pantothenate Analogues
    bioRxiv preprint doi: https://doi.org/10.1101/137182; this version posted July 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Mutations in the pantothenate kinase of Plasmodium falciparum confer diverse sensitivity profiles to antiplasmodial pantothenate analogues Erick T. Tjhin1, Christina Spry1, Alan L. Sewell2, Annabelle Hoegl3, Leanne Barnard4, Anna E. Sexton5, Vanessa M. Howieson1, Alexander G. Maier1, Darren J. Creek5, Erick Strauss4, Rodolfo Marquez2,6, Karine Auclair3 and Kevin J. Saliba1,7,* 1. Research School of Biology, The Australian National University, Canberra, Australia 2. Department of Chemistry, University of Glasgow, Glasgow, United Kingdom 3. Department of Chemistry, McGill University, Montreal, Quebec, Canada 4. Department of Biochemistry, Stellenbosch University, Matieland, South Africa 5. Monash Institute of Pharmaceutical Sciences, Monash University, Melbourne, Australia 6. Department of Chemistry, Xi’an Jiaotong-Liverpool University, Suzhou, China 7. Medical School, The Australian National University, Canberra, Australia * To whom correspondence should be addressed: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/137182; this version posted July 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract The malaria-causing blood stage of Plasmodium falciparum requires extracellular pantothenate for proliferation.
    [Show full text]
  • 07 Nov 2016 FINAL 1 Consensus Clinical Management Guidelines for Pantothenate Kinase-Associated Neurodegeneration (PKAN) Penelo
    Consensus Clinical Management Guidelines for Pantothenate Kinase-Associated Neurodegeneration (PKAN) Penelope Hogarth1,2, Manju A. Kurian3, Allison Gregory1, Barbara Csányi3, Tamara Zagustin4, Tomasz Kmiec5, Patricia Wood6, Angelika Klucken7, Natale Scalise8, Francesca Sofia8, Thomas Klopstock9,10,11, Giovanna Zorzi12, Nardo Nardocci12, Susan J. Hayflick1,2* 1Department of Molecular & Medical Genetics, Oregon Health & Science University, Portland USA 2Department of Neurology, Oregon Health & Science University, Portland USA 3Molecular Neurosciences, Developmental Neurosciences Programme, UCL Institute of Child Health, London UK 4Department of Physiatry, Children’s Healthcare of Atlanta, Georgia USA 5Department of Child Neurology, The Children’s Memorial Health Institute, Warsaw Poland 6NBIA Disorders Association, El Cajon CA USA 7Hoffunngsbaum e.V., Velbert Germany 8AISNAF – Associazione Italiana Sindromi Neurodegenerative Da Accumulo Di Ferro, Rossano Italy 9Department of Neurology, Friedrich-Baur-Institute, Ludwig-Maximilians- University, Munich, Germany 10German Center for Neurodegenerative Diseases (DZNE), Munich, Germany 11Munich Cluster for Systems Neurology (SyNergy), Munich, Germany 07 Nov 2016 FINAL 1 12Department of Pediatric Neuroscience, IRCCS Foundation Neurological Institute C. Besta, Milan Italy * Correspondence to: Susan J. Hayflick, MD, Molecular & Medical Genetics, mailcode L103, Oregon Health & Science University, Portland OR 97239 503.494.7703 07 Nov 2016 FINAL 2 Introduction Pantothenate kinase-associated neurodegeneration (PKAN, formerly Hallervorden– Spatz syndrome, OMIM #234200) is the most common neurodegeneration with brain iron accumulation (NBIA) disorder, with an estimated incidence of 1-3 per million1 and accounting for about half of NBIA cases.2 As is the case for most rare disorders, evidence-based guidance for the clinical management of PKAN is limited, often relying instead on anecdotal evidence, case reports and small series studies.
    [Show full text]
  • 12) United States Patent (10
    US007635572B2 (12) UnitedO States Patent (10) Patent No.: US 7,635,572 B2 Zhou et al. (45) Date of Patent: Dec. 22, 2009 (54) METHODS FOR CONDUCTING ASSAYS FOR 5,506,121 A 4/1996 Skerra et al. ENZYME ACTIVITY ON PROTEIN 5,510,270 A 4/1996 Fodor et al. MICROARRAYS 5,512,492 A 4/1996 Herron et al. 5,516,635 A 5/1996 Ekins et al. (75) Inventors: Fang X. Zhou, New Haven, CT (US); 5,532,128 A 7/1996 Eggers Barry Schweitzer, Cheshire, CT (US) 5,538,897 A 7/1996 Yates, III et al. s s 5,541,070 A 7/1996 Kauvar (73) Assignee: Life Technologies Corporation, .. S.E. al Carlsbad, CA (US) 5,585,069 A 12/1996 Zanzucchi et al. 5,585,639 A 12/1996 Dorsel et al. (*) Notice: Subject to any disclaimer, the term of this 5,593,838 A 1/1997 Zanzucchi et al. patent is extended or adjusted under 35 5,605,662 A 2f1997 Heller et al. U.S.C. 154(b) by 0 days. 5,620,850 A 4/1997 Bamdad et al. 5,624,711 A 4/1997 Sundberg et al. (21) Appl. No.: 10/865,431 5,627,369 A 5/1997 Vestal et al. 5,629,213 A 5/1997 Kornguth et al. (22) Filed: Jun. 9, 2004 (Continued) (65) Prior Publication Data FOREIGN PATENT DOCUMENTS US 2005/O118665 A1 Jun. 2, 2005 EP 596421 10, 1993 EP 0619321 12/1994 (51) Int. Cl. EP O664452 7, 1995 CI2O 1/50 (2006.01) EP O818467 1, 1998 (52) U.S.
    [Show full text]
  • SUPPORTING INFORMATION for Regulation of Gene Expression By
    SUPPORTING INFORMATION for Regulation of gene expression by the BLM helicase correlates with the presence of G4 motifs Giang Huong Nguyen1,2, Weiliang Tang3, Ana I. Robles1, Richard P. Beyer4, Lucas T. Gray5, Judith A. Welsh1, Aaron J. Schetter1, Kensuke Kumamoto1,6, Xin Wei Wang1, Ian D. Hickson2,7, Nancy Maizels5, 3,8 1 Raymond J. Monnat, Jr. and Curtis C. Harris 1Laboratory of Human Carcinogenesis, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, U.S.A; 2Department of Medical Oncology, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, Oxford, U.K.; 3Department of Pathology, University of Washington, Seattle, WA U.S.A.; 4 Center for Ecogenetics and Environmental Health, University of Washington, Seattle, WA U.S.A.; 5Department of Immunology and Department of Biochemistry, University of Washington, Seattle, WA U.S.A.; 6Department of Organ Regulatory Surgery, Fukushima Medical University, Fukushima, Japan; 7Cellular and Molecular Medicine, Nordea Center for Healthy Aging, University of Copenhagen, Denmark; 8Department of Genome Sciences, University of WA, Seattle, WA U.S.A. SI Index: Supporting Information for this manuscript includes the following 19 items. A more detailed Materials and Methods section is followed by 18 Tables and Figures in order of their appearance in the manuscript text: 1) SI Materials and Methods 2) Figure S1. Study design and experimental workflow. 3) Figure S2. Immunoblot verification of BLM depletion from human fibroblasts. 4) Figure S3. PCA of mRNA and miRNA expression in BLM-depleted human fibroblasts. 5) Figure S4. qPCR confirmation of mRNA array data. 6) Table S1. BS patient and control detail.
    [Show full text]