DOCSLIB.ORG

Prokaryotic Type II and Type III Pantothenate Kinases: the Same Monomer Fold Creates Dimers with Distinct Catalytic Properties

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prokaryotic Type II and Type III Pantothenate Kinases: the Same Monomer Fold Creates Dimers with Distinct Catalytic Properties View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Structure 14, 1251–1261, August 2006 ª2006 Elsevier Ltd All rights reserved DOI 10.1016/j.str.2006.06.008 Prokaryotic Type II and Type III Pantothenate Kinases: The Same Monomer Fold Creates Dimers with Distinct Catalytic Properties Bum Soo Hong,1,6 Mi Kyung Yun,3,6 Yong-Mei Zhang,4 from their bacterial counterparts (Calder et al., 1999), Shigeru Chohnan,4,7 Charles O. Rock,4,5 and they are feedback inhibited by CoA or its thioesters Stephen W. White,3,5 Suzanne Jackowski,4,5 to achieve a tight and tissue-specific regulation of the Hee-Won Park,1,2 and Roberta Leonardi4,* cofactor level (Rock et al., 2000, 2002; Zhang et al., 1 Structural Genomics Consortium 2005). 2 Department of Pharmacology Bacteria possess three types of pantothenate kinases University of Toronto (CoaAs) that differ in sequence, regulation, substrate af- Toronto, Ontario M5G 1L5 finity, and specificity (Brand and Strauss, 2005; Leonardi Canada et al., 2005a; Vallari et al., 1987). The type I CoaA is 3 Department of Structural Biology widely distributed, and the prototypical member is the 4 Department of Infectious Diseases Escherichia coli CoaA (EcCoaA), which is encoded by St. Jude Children’s Research Hospital the coaA gene (Song and Jackowski, 1992, 1994) and Memphis, Tennessee 38105 is regulated through feedback inhibition by CoA and 5 Department of Molecular Sciences CoA thioesters (Vallari et al., 1987). EcCoaA is a dimer University of Tennessee Health Science Center of identical subunits and is structurally classified as Memphis, Tennessee 38163 a P loop kinase containing a Walker A motif (Ivey et al., 2004; Yun et al., 2000). The pantothenate kinase from Staphylococcus aureus (SaCoaA) is the prototypical Summary type II enzyme, and it is refractory to feedback inhibition by CoA or its thioesters (Leonardi et al., 2005a). This lack Three distinct isoforms of pantothenate kinase (CoaA) of regulation allows the accumulation of millimolar con- in bacteria catalyze the first step in coenzyme A bio- centrations of CoA, which is the major intracellular thiol synthesis. The structures of the type II (Staphylococ- in this organism (delCardayre et al., 1998). There is par- cus aureus, SaCoaA) and type III (Pseudomonas aeru- ticular interest in the type II SaCoaA protein because it is ginosa, PaCoaA) enzymes reveal that they assemble related to the four eukaryotic isoforms of pantothenate nearly identical subunits with actin-like folds into di- kinase, PanK1a, PanK1b, PanK2, and PanK3 (Cheek mers that exhibit distinct biochemical properties. et al., 2005). Alignment of the human PanK2 and SaCoaA PaCoaA has a fully enclosed pantothenate binding sequences (Figure 1A) reveals that the region of greatest pocket and requires a monovalent cation to weakly similarity corresponds to the conserved phosphate bind ATP in an open cavity that does not interact binding P loop DxGG(T,S)T(S,G)xxK(R,C) motif charac- with the adenine nucleotide. Pantothenate binds to teristic of members of the acetate and sugar kinases/ an open pocket in SaCoaA that strongly binds ATP Hsc70/actin (ASKHA) family (Bork et al., 1992; Kabsch by using a classical P loop architecture coupled with and Holmes, 1995). Finally, a number of bacteria, includ- specific interactions with the adenine moiety. The Pa- ing pathogens such as Helicobacter pylori and Pseudo- CoaAPan binary complex explains the resistance of monas aeruginosa, possess a type III enzyme. The type bacteria possessing this isoform to the pantothena- III CoaA from H. pylori, HpCoaA, is not regulated by mide antibiotics, and the similarity between SaCoaA CoA or its thioesters, and, unlike the type I and II CoaAs and human pantothenate kinase 2 explains the molec- that have similar Kms for the substrates in the micro- ular basis for the development of the neurodegenera- molar range (Leonardi et al., 2005a; Song and Jacko- tive phenotype in three mutations in the human wski, 1994), it exhibits an unusually high Km for ATP protein. (w10 mM) (Brand and Strauss, 2005). The absence of any obvious sequence similarity be- tween the three types of bacterial CoaAs, and their strik- Introduction ingly different biochemical properties, prompted us to investigate the structural basis of this diversity. Our Coenzyme A (CoA) is an indispensable cofactor in all bi- study reports the crystal structures of the type II ological systems, where it functions as the major acyl SaCoaAAMP-PNP complex, the type III PaCoaA apo- group carrier (Leonardi et al., 2005b). The universal enzyme, and the PaCoaAPan complex. Both enzymes CoA biosynthetic pathway consists of five enzymatic share the same actin-like monomer fold, but they asso- steps, the first of which is the phosphorylation of panto- ciate to form two very different dimeric architectures. thenate (Pan), or vitamin B5, catalyzed by pantothenate Furthermore, by combining the structural information kinase. Pantothenate kinase is the key regulatory step in on how SaCoaA and PaCoaA bind the phosphoryl donor CoA biosynthesis (Leonardi et al., 2005b). The eukary- and Pan, respectively, we can assemble an accurate otic pantothenate kinase isoforms (PanKs) are distinct picture of the catalytic ternary complex for each en- zyme. These models provide a structural framework for understanding the substrate specificities of each en- *Correspondence: [email protected] zyme and their distinct catalytic mechanisms. Both the 6 These authors contributed equally to this work. 7 Present address: Department of Bioresource Science, College of type I and type II CoaAs recognize the pantothenamide Agriculture, Ibaraki University, 3-21-1 Chu-ou, Ami, Ibaraki class of antimetabolites (Leonardi et al., 2005a; Strauss 300-0393, Japan. and Begley, 2002), whereas the type III CoaAs do not Structure 1252 see the Supplemental Data available with this article on- line). The monomer structures are very similar and com- prise two a/b domains, and each domain contains a mixed five-stranded b sheet surrounded by a helices (Figures 2A and 2C). Domain I consists of strands b1– b5 in the order 3-2-1-4-5 with strand b2 antiparallel to the others, and helices a1, a2, a3, and a8. Domain II con- tains strands b6–b10 in the order 8-7-6-9-10 with strand b7 antiparallel to the others, and helices a3, a4, a5, a6, a7, and a8. The folding topologies of each domain are identical and place them in the actin superfamily. They are tightly associated such that helices a3 and a8 are common to each domain at the domain interface, with the C-terminal a8 completing the domain I substructure. A structural similarity search of the protein database with the VAST program revealed that the fold of SaCoaA and PaCoaA places them in the ASKHA superfamily (Bork et al., 1992; Cheek et al., 2002; Kabsch and Holmes, 1995). Members of this family have the same relative orientations of domains I and II. The classic P loops in the kinase fold are between the first and second b strands of each domain (strands b1 and b2 of domain I and strands b6 and b7 of domain II), and these meet at the center of the domain interface. The domain I P loop has the classical signature sequence, whereas do- main II can be considered a ‘‘pseudo kinase’’ domain. Domain II is larger than domain I by virtue of two addi- tional helices, a4 and a5, and an extended a6 compared to its counterpart, a1(Figures 2A and 2C). Both proteins crystallized as a dimer in the asymmet- Figure 1. Alignment of Type II and Type III CoaAs ric unit, and the monomers of this dimer are related by (A) Alignment of the primary sequences of SaCoaA and human a noncrystallographic 2-fold rotation axis. The dimen- PanK2. Residues highlighted in red were investigated by site-di- sions of the dimers are consistent with the hydrody- rected mutagenesis, and those indicated with an asterisk (*) are con- namic data on the two soluble proteins (Figure S1)(Leo- served between SaCoaA and human PanK2 and are mutated in nardi et al., 2005a). Although the SaCoaA and PaCoaA PKAN patients. The residues in the dimer interface conserved be- tween the two proteins are indicated with a ‘‘+.’’ monomers have very similar structures, they each con- (B) Alignment of the primary sequences of the type III CoaAs from tain a loop region that is absent from the other enzyme, P. aeruginosa (NCBI gij15599475), B. subtilis (NCBI gij16077138, which results in their assembly into dimers with dis- corrected in GenBank acc. #AY912104), and H. pylori (NCBI tinctly different architectures (Figures 2B and 2D). Sa- gij15645481). Sequence identities are: PaCoaA/BsCoaA = 19%, CoaA contains a loop between helices a4 and a5 that PaCoaA/HpCoaA = 21%, HpCoaA/BsCoaA = 14%, and PaCoaA/ packs against a6(Figure 2B). Conversely, PaCoaA has SaCoaA = 12%. The residues in the dimer interface conserved in b a at least two of the three sequences are indicated with a ‘‘+.’’ a loop inserted between 5 and 3 that contains a short b ribbon that associates with the outside b8 strand of the domain II b sheet (Figure 2D). Although both loops con- accept these compounds as substrates (Brand and tribute to the monomer-monomer interface, they do so Strauss, 2005). The different dimeric structures of in different ways. The SaCoaA loop mainly interacts SaCoaA and PaCoaA explain the resistance of P. aerugi- with a40, whereas the PaCoaA loop interacts with the nosa to the pantothenamide class of drugs. Finally, the a50–a60 loop (the prime sign indicates an element in the structure of the SaCoaAAMP-PNP binary complex pro- other monomer). As a result, the long a6 helices within vides insights into the structure and catalytic mecha- the SaCoaA dimer interact extensively via a parallel nism of the mammalian pantothenate kinases.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
    [Show full text]
  • PANK2 Gene Pantothenate Kinase 2
    PANK2 gene pantothenate kinase 2 Normal Function The PANK2 gene provides instructions for making an enzyme called pantothenate kinase 2. This enzyme is active in specialized cellular structures called mitochondria, which are the cell's energy-producing centers. Within mitochondria, pantothenate kinase 2 regulates the formation of a molecule called coenzyme A. Coenzyme A is found in all living cells, where it is essential for the body's production of energy from carbohydrates, fats, and some protein building blocks (amino acids). PANK2 is one of four human genes that provide instructions for making versions of pantothenate kinase. The functions of these different versions probably vary among tissue types and parts of the cell. The version produced by the PANK2 gene is active in cells throughout the body, including nerve cells in the brain. Health Conditions Related to Genetic Changes Pantothenate kinase-associated neurodegeneration About 100 mutations in the PANK2 gene have been identified in people with pantothenate kinase-associated neurodegeneration. Typically, people with the more severe, early-onset form of the disorder have PANK2 mutations that prevent cells from producing any functional pantothenate kinase 2. People affected by the atypical, later- onset form usually have mutations that change single amino acids in the enzyme, which makes the enzyme unstable or disrupts its activity. In some cases, single amino acid changes allow the enzyme to retain some function. The most common PANK2 mutation replaces the amino acid glycine with the amino acid arginine at position 411 of the enzyme (written as Gly411Arg or G411R). When pantothenate kinase 2 is altered or missing, the normal production of coenzyme A is disrupted and potentially harmful compounds can build up in the brain.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pantothenate Kinase-Associated Neurodegeneration
    Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration.
    [Show full text]
  • A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration
    IJMCM Case Report Autumn 2016, Vol 5, No 4 A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration Soudeh Ghafouri-Fard 1, Vahid Reza Yassaee 2, Alireza Rezayi 3, Feyzollah Hashemi-Gorji 2, Nasrin Alipour 2, ∗ Mohammad Miryounesi 2 1. Department of Medical Genetics, Shahid Beheshti University of Medical sciences, Tehran, Iran. 2. Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 3. Pediatric Neurology Department, Loghman Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 29 June 2016; Accepted 14 August 2016; Published 23 October 2016 Pantothenate kinase- associated neurodegeneration (PKAN) syndrome is a rare autosomal recessive disorder characterized by progressive extrapyramidal dysfunction and iron accumulation in the brain and axonal spheroids in the central nervous system. It has been shown that the disorder is caused by mutations in PANK2 gene which codes for a mitochondrial enzyme participating in coenzyme A biosynthesis. Here we report two cases of classic PKAN syndrome with early onset of neurodegenerative disorder. Mutational analysis has revealed that both are homozygous for a novel nonsense mutation in PANK2 gene (c.T936A (p.C312X)). The high prevalence of consanguineous marriages in Iran raises the likelihood of occurrence of autosomal recessive disorders such as PKAN and necessitates proper premarital genetic counseling. Further research is needed to provide the data on the prevalence of PKAN and identification of common PANK2 mutations in Iranian population. Key words : PANK2 , pantothenate kinase-associated neurodegeneration, mutation antothenate kinase-associated neurodegen- weighted which is due to iron deposition in the Peration (PKAN) syndrome is a rare autosomal periphery (hypointensity) and necrosis on its central recessive disorder characterized by progressive part (hyperintensity) (2).
    [Show full text]
  • High Throughput Computational Mouse Genetic Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.278465; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. High Throughput Computational Mouse Genetic Analysis Ahmed Arslan1+, Yuan Guan1+, Zhuoqing Fang1, Xinyu Chen1, Robin Donaldson2&, Wan Zhu, Madeline Ford1, Manhong Wu, Ming Zheng1, David L. Dill2* and Gary Peltz1* 1Department of Anesthesia, Stanford University School of Medicine, Stanford, CA; and 2Department of Computer Science, Stanford University, Stanford, CA +These authors contributed equally to this paper & Current Address: Ecree Durham, NC 27701 *Address correspondence to: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.278465; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Background: Genetic factors affecting multiple biomedical traits in mice have been identified when GWAS data that measured responses in panels of inbred mouse strains was analyzed using haplotype-based computational genetic mapping (HBCGM). Although this method was previously used to analyze one dataset at a time; but now, a vast amount of mouse phenotypic data is now publicly available, which could lead to many more genetic discoveries. Results: HBCGM and a whole genome SNP map covering 53 inbred strains was used to analyze 8462 publicly available datasets of biomedical responses (1.52M individual datapoints) measured in panels of inbred mouse strains. As proof of concept, causative genetic factors affecting susceptibility for eye, metabolic and infectious diseases were identified when structured automated methods were used to analyze the output.
    [Show full text]
  • Ipsc-Derived Neuronal Models of PANK2- Associated Neurodegeneration Reveal Mitochondrial Dysfunction Contributing to Early Disease
    RESEARCH ARTICLE iPSC-derived neuronal models of PANK2- associated neurodegeneration reveal mitochondrial dysfunction contributing to early disease Charles Arber1*, Plamena R. Angelova1, Sarah Wiethoff1, Yugo Tsuchiya2, Francesca Mazzacuva3, Elisavet Preza1, Kailash P. Bhatia1, Kevin Mills3, Ivan Gout2, Andrey Y. Abramov1, John Hardy1, James A. Duce4, Henry Houlden1, Selina Wray1 a1111111111 a1111111111 1 Department of Molecular Neuroscience, Institute of Neurology, University College London, London, United Kingdom, 2 Institute of Structural and Molecular Biology, University College London, London, United a1111111111 Kingdom, 3 Centre for Translational Omics, Genetics and Genomic Medicine Programme, UCL Institute of a1111111111 Child Health, London, United Kingdom, 4 School of Molecular and Cellular Biology, Faculty of Biological a1111111111 Sciences, University of Leeds, Leeds, United Kingdom * [email protected] OPEN ACCESS Abstract Citation: Arber C, Angelova PR, Wiethoff S, Tsuchiya Y, Mazzacuva F, Preza E, et al. (2017) Mutations in PANK2 lead to neurodegeneration with brain iron accumulation. PANK2 has a iPSC-derived neuronal models of PANK2- role in the biosynthesis of coenzyme A (CoA) from dietary vitamin B5, but the neuropatho- associated neurodegeneration reveal mitochondrial logical mechanism and reasons for iron accumulation remain unknown. In this study, atypi- dysfunction contributing to early disease. PLoS cal patient-derived fibroblasts were reprogrammed into induced pluripotent stem cells ONE 12(9): e0184104. https://doi.org/10.1371/ journal.pone.0184104 (iPSCs) and subsequently differentiated into cortical neuronal cells for studying disease mechanisms in human neurons. We observed no changes in PANK2 expression between Editor: Fanis Missirlis, CINVESTAV-IPN, MEXICO control and patient cells, but a reduction in protein levels was apparent in patient cells.
    [Show full text]
  • Novel Homozygous PANK2 Mutation Identified in a Consanguineous Chinese Pedigree with Pantothenate Kinase-Associated Neurodegeneration
    BIOMEDICAL REPORTS 5: 217-220, 2016 Novel homozygous PANK2 mutation identified in a consanguineous Chinese pedigree with pantothenate kinase-associated neurodegeneration YAN-FANG LI1*, HONG-FU LI2*, YAN-BIN ZHANG3 and JI-MIN WU2 Departments of 1Pediatrics and 2Neurology, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310009; 3Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350004, P.R. China Received April 4, 2016; Accepted June 27, 2016 DOI: 10.3892/br.2016.715 Abstract. Pantothenate kinase-associated neurodegeneration is the most common form of neurodegeneration with brain (PKAN) is a rare autosomal recessive neurodegenerative iron accumulation (NBIA) (2). Clinically, it is characterized disorder resulting from pantothenate kinase 2 (PANK2) gene by childhood onset of dystonia, dysarthria, rigidity, and mutations. It is clinically characterized by early onset of extra- choreoathetosis, with or without pigmentary retinopathy, optic pyramidal symptoms, with or without pigmentary retinopathy, atrophy, and acanthocytosis (3). Approximately one-third of optic atrophy and acanthocytosis. The specific radiographic the PKAN patients showed cognitive decline or dementia (3). appearance of PKAN is the eye-of-the-tiger sign. However, In typical PKAN, symptoms present within the first decade there are few studies regarding PKAN patients of Chinese Han of life and usually rapidly progress, culminating in early ancestry. In the present study, a Chinese 20-year-old female mortality. However, in atypical PKAN, the onset of extrapy- with an 8-year history of unsteady walking and involuntary ramidal symptoms is later, and the progression is slower and movements is described. Brain magnetic resonance imaging more variable.
    [Show full text]
  • Overexpression of Human Mutant PANK2 Proteins Affects Development and Motor Behavior of Zebrafish Embryos
    NeuroMolecular Medicine (2019) 21:120–131 https://doi.org/10.1007/s12017-018-8508-8 ORIGINAL PAPER Overexpression of Human Mutant PANK2 Proteins Affects Development and Motor Behavior of Zebrafish Embryos D. Khatri1 · D. Zizioli1 · A. Trivedi1 · G. Borsani1 · E. Monti1 · D. Finazzi1,2 Received: 2 June 2018 / Accepted: 17 August 2018 / Published online: 23 August 2018 © Springer Science+Business Media, LLC, part of Springer Nature 2018 Abstract Pantothenate Kinase-Associated Neurodegeneration (PKAN) is a genetic and early-onset neurodegenerative disorder char- acterized by iron accumulation in the basal ganglia. It is due to mutations in Pantothenate Kinase 2 (PANK2), an enzyme that catalyzes the phosphorylation of vitamin B5, first and essential step in coenzyme A (CoA) biosynthesis. Most likely, an unbalance of the neuronal levels of this important cofactor represents the initial trigger of the neurodegenerative process, yet a complete understanding of the connection between PANK2 malfunctioning and neuronal death is lacking. Most PKAN patients carry mutations in both alleles and a loss of function mechanism is proposed to explain the pathology. When PANK2 mutants were analyzed for stability, dimerization capacity, and enzymatic activity in vitro, many of them showed proper- ties like the wild-type form. To further explore this aspect, we overexpressed the wild-type protein, two mutant forms with reduced kinase activity and two retaining the catalytic activity in zebrafish embryos and analyzed the morpho-functional consequences. While the wild-type protein had no effects, all mutant proteins generated phenotypes that partially resembled those observed in pank2 and coasy morphants and were rescued by CoA and vitamin B5 supplementation.
    [Show full text]
  • Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Theses, Dissertations, and Student Research in Agronomy and Horticulture Department Agronomy and Horticulture 7-2015 Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J. Morton University of Nebraska-Lincoln Follow this and additional works at: http://digitalcommons.unl.edu/agronhortdiss Part of the Agricultural Science Commons, Agronomy and Crop Sciences Commons, Plant Biology Commons, and the Plant Breeding and Genetics Commons Morton, Kyla J., "Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality" (2015). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 88. http://digitalcommons.unl.edu/agronhortdiss/88 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. BIOCHEMICAL AND PROTEOMIC PROFILING OF MAIZE ENDOSPERM TEXTURE AND PROTEIN QUALITY by Kyla J. Morton A DISSERTATION Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Doctor of Philosophy Major: Agronomy and Horticulture (Plant Breeding and Genetics) Under the Supervision of Professor David R. Holding Lincoln, Nebraska July, 2015 BIOCHEMICAL AND PROTEOMIC ANALYSIS OF MAIZE ENDOSPERM KERNEL TEXTURE AND PROTEIN QUALITY Kyla J. Morton, Ph.D. University of Nebraska, 2015 Advisor: David R. Holding The research described herein, focuses on the biochemical and proteomic analysis of the maize endosperm and what influences kernel texture.
    [Show full text]
  • Molecular Analysis of PANK2 Gene in Two Thai Classic Pantothenate
    Case Report iMedPub Journals Journal of Neurology and Neuroscience 2018 www.imedpub.com Vol.9 No.6:275 ISSN 2171-6625 DOI: 10.21767/2171-6625.1000275 Molecular Analysis of PANK2 Gene in Two Thai Classic Pantothenate Kinase- Associated Neurodegeneration (PKAN) Patients Piradee Suwanpakdee1, Napakjira Likasitthananon1, Charcrin Nabangchang1, Yutthana Pansuwan2, Siriporn Pattharathitikul3 and Boonchai Boonyawat4 1Division of Neurology, Department of Pediatrics, Phramongkutklao Hospital and Phramongkutklao College of Medicine, Bangkok, Thailand 2Phramongkutklao Hospital and Phramongkutklao College of Medicine, Bangkok, Thailand 3Division of Pediatrics, Prapokklao Hospital, Bangkok, Thailand 4Division of Genetics, Department of Pediatrics, Phramongkutklao Hospital and Phramongkutklao College of Medicine, Bangkok, Thailand *Corresponding author: Dr. Piradee Suwanpakdee, MD, Division of Neurology, Department of Pediatrics, Phramongkutklao Hospital and Phramongkutklao College of Medicine, 315 Ratchawithi Rd, Thung Phaya Thai, Ratchathewi district, Bangkok 10400, Thailand, Tel: +66814383634; E-mail: [email protected] Rec Date: October 25, 2018; Acc Date: November 10, 2018, 2018; Pub Date: November 14, 2018 Citation: Suwanpakdee P, Likasitthananon N, Nabangchang C, Pansuwan Y, Pattharathitikul S, et al. (2018) Molecular Analysis of PANK2 Gene in Two Thai Classic Pantothenate Kinase-Associated Neurodegeneration (PKAN) Patients. J Neurol Neurosci Vol.9 No.6:275. Keywords: Molecular analysis; PANK2 gene; Pantothenate Abstract kinase-associated neurodegeneration (PKAN); Thailand Background: Pantothenate kinase-associated neurodegeneration (PKAN) is a rare neurodegenerative Introduction disorder that occurs due to autosomal recessive Pantothenate kinase-associated neurodegeneration (PKAN, mutations in the PANK2 gene. Several of these pathogenic mutations have been identified, and ethnic differences OMIM 234220), previously named Hallervorden-Spatz seem to play an important role in the clinical outcomes of syndrome, is a rare autosomal recessive neurodegeneration this disease.
    [Show full text]