DOCSLIB.ORG

Biochemical Characterization of Pantoate Kinase, a Novel Enzyme Necessary for Coenzyme a Biosynthesis in the Archaea

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biochemical Characterization of Pantoate Kinase, a Novel Enzyme Necessary for Coenzyme a Biosynthesis in the Archaea Biochemical Characterization of Pantoate Kinase, a Novel Enzyme Necessary for Coenzyme A Biosynthesis in the Archaea Hiroya Tomita,a Yuusuke Yokooji,a Takuya Ishibashi,a Tadayuki Imanaka,b,c and Haruyuki Atomia,c Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, Kyoto University Katsura, Nishikyo-ku, Kyoto, Japana; Department of Biotechnology, College of Life Sciences, Ritsumeikan University Noji-Higashi, Kusatsu, Shiga, Japanb; and JST, CREST, Sanbancho, Chiyoda-ku, Tokyo, Japanc Although bacteria and eukaryotes share a pathway for coenzyme A (CoA) biosynthesis, we previously clarified that most archaea utilize a distinct pathway for the conversion of pantoate to 4=-phosphopantothenate. Whereas bacteria/eukaryotes use pantothe- nate synthetase and pantothenate kinase (PanK), the hyperthermophilic archaeon Thermococcus kodakarensis utilizes two novel enzymes: pantoate kinase (PoK) and phosphopantothenate synthetase (PPS). Here, we report a detailed biochemical examina- tion of PoK from T. kodakarensis. Kinetic analyses revealed that the PoK reaction displayed Michaelis-Menten kinetics toward ATP, whereas substrate inhibition was observed with pantoate. PoK activity was not affected by the addition of CoA/acetyl-CoA. Interestingly, PoK displayed broad nucleotide specificity and utilized ATP, GTP, UTP, and CTP with comparable kcat/Km values. Sequence alignment of 27 PoK homologs revealed seven conserved residues with reactive side chains, and variant proteins were constructed for each residue. Activity was not detected when mutations were introduced to Ser104, Glu134, and Asp143, suggest- ing that these residues play vital roles in PoK catalysis. Kinetic analysis of the other variant proteins, with mutations S28A, H131A, R155A, and T186A, indicated that all four residues are involved in pantoate recognition and that Arg155 and Thr186 play important roles in PoK catalysis. Gel filtration analyses of the variant proteins indicated that Thr186 is also involved in dimer assembly. A sequence comparison between PoK and other members of the GHMP kinase family suggests that Ser104 and -Glu134 are involved in binding with phosphate and Mg2؉, respectively, while Asp143 is the base responsible for proton abstrac tion from the pantoate hydroxy group. oenzyme A (CoA) is an important coenzyme that is found in identified two novel enzymes, pantoate kinase (PoK) and phos- Call three domains of life. CoA forms high-energy thioester phopantothenate synthetase (PPS), that can convert pantoate to bonds with various carboxylic acids and plays a central role in 4=-phosphopantothenate, replacing the missing PS/PanK path- carbon and energy metabolism. Its derivatives, such as acetyl- way (Fig. 1)(33). In the PoK/PPS pathway, the order of the con- CoA, succinyl-CoA, malonyl-CoA, and hydroxymethylglu- densation reaction with ␤-alanine and the phosphorylation reac- taryl-CoA, are key metabolites in a wide range of pathways tion are reversed compared to the classical PS and PanK reactions. which include sugar breakdown and ␤-oxidation, as well as the Disruption of the individual genes in the hyperthermophilic ar- biosynthesis of fatty acids and isoprenoid compounds. chaeon Thermococcus kodakarensis led to strains that could only In bacteria and eukaryotes, the mechanism of CoA biosynthe- grow with the addition of exogenous CoA or 4=-phosphopanto- sis has been examined in detail, and it is now known that they thenate to the medium, confirming their involvement in CoA bio- share common reactions (14, 27). CoA is synthesized from pan- synthesis in this archaeon. Genes homologous to the two genes tothenate via five enzymatic reactions: pantothenate kinase (TK2141, encoding PoK, and TK1686, encoding PPS) are present (PanK), 4=-phosphopantothenoylcysteine synthetase (PPCS), 4=- in almost all archaeal genomes with the exception of those of the phosphopantothenoylcysteine decarboxylase (PPCDC), 4=-phos- Thermoplasmatales and Nanoarchaeum equitans, strongly suggest- phopantetheine adenylyltransferase (PPAT), and dephospho- ing that the majority of the archaea utilize this pathway for CoA CoA kinase (DPCK). In addition, microorganisms and plants can biosynthesis (33). Concerning the members of the Thermoplas- synthesize pantothenate from L-valine and ␤-alanine through matales, there are genes that display structural similarity with the four enzymatic reactions: aminotransferase (AT), ketopantoate bacterial/eukaryotic PanK in the genomes of Ferroplasma acidar- hydroxymethyltransferase (KPHMT), ketopantoate reductase manus and Picrophilus torridus. The PanK from P. torridus has (KPR), and pantothenate synthetase (PS). been examined and shown to exhibit PanK activity (28). The gene Although much knowledge has accumulated on CoA biosyn- that encodes PS in these organisms has yet to be identified. thesis in bacteria and eukaryotes, the corresponding pathway in Based on its primary structure, PoK is structurally related to archaea has not been well examined. A number of genes that dis- members of the GHMP kinase superfamily (33). This family com- play similarity to bacterial/eukaryotic genes are present on the archaeal genomes, including those encoding PPCS, PPCDC, and PPAT. Among these, the PPCS and PPCDC from Methanocaldo- Received 1 December 2011 Accepted 27 July 2012 coccus jannaschii (13) and the PPAT from Pyrococcus abyssi (1, 17) Published ahead of print 3 August 2012 have been biochemically characterized. A striking observation was Address correspondence to Haruyuki Atomi, [email protected]. that almost all of the archaeal genomes did not harbor genes cor- Supplemental material for this article may be found at http://jb.asm.org/. responding to PS and PanK. Genes predicted to be involved in Copyright © 2012, American Society for Microbiology. All Rights Reserved. these reactions have been studied in Methanosarcina mazei (7, 23). doi:10.1128/JB.06624-11 By taking a comparative genomics approach, we have previously Reproduced from J. Bacteriol. 194: 5434-5443 (2012). 120 inant route for CoA biosynthesis in the archaea, in this study, we have performed the first detailed biochemical analysis of PoK. Here, we focused on the reaction kinetics, substrate specificity, and moreover, identification of the amino acid residues involved in the catalysis of this novel enzyme, which can be considered a new archaeal member of the GHMP kinase superfamily. MATERIALS AND METHODS Strains, media, and culture conditions. Cultivation of T. kodakarensis KOD1 (2, 16) and its derivative strains was performed under anaerobic conditions at 85°C in a nutrient-rich medium (ASW-YT) or a synthetic medium (ASW-AA). ASW-YT medium consists of 0.8ϫ artificial seawa- ter (ASW), 5.0 g literϪ1 yeast extract, 5.0 g literϪ1 tryptone, and 0.8 mg literϪ1 resazurine. Prior to inoculation, 5.0 g literϪ1 sodium pyruvate (ASW-YT-Pyr medium) or 2.0 g literϪ1 elemental sulfur (ASW-YT-S0 medium) and Na2S were added to the medium until it became colorless. ASW-AA medium consisted of 0.8ϫ ASW, a mixture of 20 amino acids, modified Wolfe’s trace minerals, a vitamin mixture, and 2.0 g literϪ1 elemental sulfur (19, 25). In the case of plate culture used to isolate trans- formants, elemental sulfur and Na2S9H2O were replaced with 2 ml of a polysulfide solution (10 g Na2S9H2O and 3 g sulfur flowers in 15 ml H2O) per liter and 10 g literϪ1 Gelrite was added to solidify the medium. Specific modifications of the medium to isolate transformants are described in the respective sections below. Escherichia coli DH5␣ used for plasmid con- struction was cultivated at 37°C in Luria-Bertani (LB) medium containing ampicillin (100 mg literϪ1). Unless mentioned otherwise, all chemicals were purchased from Wako Pure Chemicals (Osaka, Japan) or Nacalai FIG 1 Two pathways from pantoate to 4=-phosphopantothenate. Bacteria and Tesque (Kyoto, Japan). eukaryotes use the PS/PanK pathway (left), whereas most archaea utilize the Production and purification of the wild-type pantoate kinase. The PoK/PPS pathway (right). TK2141 gene encoding pantoate kinase (PoK), with a His6 tag on its N terminus, was overexpressed in T. kodakarensis. The TK2141 overexpres- sion strain (ETK2141) (33) was cultivated in ASW-YT-Pyr for 12 h at prises a vast number of proteins that include the galactokinases, 85°C. Cells were harvested, resuspended in 20 mM potassium phosphate homoserine kinases, mevalonate kinases, and phosphomeval- buffer (pH 7.4) containing 0.5 M KCl and 40 mM imidazole, and dis- ϫ onate kinases (3). Many members of the GHMP family are in- rupted by sonication. After centrifugation (20,000 g, 15 min), the su- volved in intermediary metabolism and utilize ATP to phosphor- pernatant was applied to His GraviTrap (GE Healthcare Biosciences, Pis- ylate their specific substrates. These kinases harbor a common cataway, NJ), and the His-tagged proteins were eluted with 20 mM potassium phosphate (pH 7.4), 0.5 M KCl, and 0.5 M imidazole. After the loop sequence rich in glycine/serine residues (4), which, in the buffer was exchanged for 50 mM Tris-HCl (pH 8.0) using a PD-10 col- case of human mevalonate kinase (MvK), has been biochemically umn (GE Healthcare Biosciences), the sample was applied to anion-ex- 2ϩ shown to be involved in binding with Mg and ATP. The specific change chromatography (HiTrap Q HP; GE Healthcare Biosciences), and residue involved in this binding (Ser146) is highly conserved proteins were eluted with a linear gradient of NaCl (0 to 1.0 M) in 50 mM among the members of the GHMP family (4). Glu193 from this Tris-HCl (pH 8.0) at a flow rate of 2.5 ml minϪ1. The protein concentra- enzyme has also been shown to be involved in ATP binding (18). tion was determined with the Bio-Rad protein assay system (Bio-Rad, Furthermore, mutagenesis studies on Asp204 have indicated that Hercules, CA), using bovine serum albumin as a standard. this residue functions as the catalytic base to enhance the nucleo- Examinations of pantoate kinase activity. PoK activity was measured philicity of the hydroxy group to attack the ATP ␥-phosphate by quantifying the ADP generated from the PoK reaction with the pyru- (18). Both of these residues are conserved in a wide range of vate kinase/lactate dehydrogenase (PK/LDH) reaction.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of
    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
    [Show full text]
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pantothenate Kinase-Associated Neurodegeneration
    Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration.
    [Show full text]
  • A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration
    IJMCM Case Report Autumn 2016, Vol 5, No 4 A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration Soudeh Ghafouri-Fard 1, Vahid Reza Yassaee 2, Alireza Rezayi 3, Feyzollah Hashemi-Gorji 2, Nasrin Alipour 2, ∗ Mohammad Miryounesi 2 1. Department of Medical Genetics, Shahid Beheshti University of Medical sciences, Tehran, Iran. 2. Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 3. Pediatric Neurology Department, Loghman Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 29 June 2016; Accepted 14 August 2016; Published 23 October 2016 Pantothenate kinase- associated neurodegeneration (PKAN) syndrome is a rare autosomal recessive disorder characterized by progressive extrapyramidal dysfunction and iron accumulation in the brain and axonal spheroids in the central nervous system. It has been shown that the disorder is caused by mutations in PANK2 gene which codes for a mitochondrial enzyme participating in coenzyme A biosynthesis. Here we report two cases of classic PKAN syndrome with early onset of neurodegenerative disorder. Mutational analysis has revealed that both are homozygous for a novel nonsense mutation in PANK2 gene (c.T936A (p.C312X)). The high prevalence of consanguineous marriages in Iran raises the likelihood of occurrence of autosomal recessive disorders such as PKAN and necessitates proper premarital genetic counseling. Further research is needed to provide the data on the prevalence of PKAN and identification of common PANK2 mutations in Iranian population. Key words : PANK2 , pantothenate kinase-associated neurodegeneration, mutation antothenate kinase-associated neurodegen- weighted which is due to iron deposition in the Peration (PKAN) syndrome is a rare autosomal periphery (hypointensity) and necrosis on its central recessive disorder characterized by progressive part (hyperintensity) (2).
    [Show full text]
  • The Mechanism of GHMP Kinases by QM/MM Studies
    The Role of Arg228 in the phosphorylation of galactokinase: The mechanism of GHMP kinases by QM/MM studies Huang, M., Li, X., Zou, J-W., & Timson, D. J. (2013). The Role of Arg228 in the phosphorylation of galactokinase: The mechanism of GHMP kinases by QM/MM studies. Biochemistry, 52(28), 4858. https://doi.org/10.1021/bi400228e Published in: Biochemistry Document Version: Early version, also known as pre-print Queen's University Belfast - Research Portal: Link to publication record in Queen's University Belfast Research Portal General rights Copyright for the publications made accessible via the Queen's University Belfast Research Portal is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The Research Portal is Queen's institutional repository that provides access to Queen's research output. Every effort has been made to ensure that content in the Research Portal does not infringe any person's rights, or applicable UK laws. If you discover content in the Research Portal that you believe breaches copyright or violates any law, please contact [email protected]. Download date:01. Oct. 2021 Article pubs.acs.org/biochemistry Role of Arg228 in the Phosphorylation of Galactokinase: The Mechanism of GHMP Kinases by Quantum Mechanics/Molecular Mechanics Studies † † ‡ § Meilan Huang,*, Xiaozhou Li, Jian-Wei Zou, and David J. Timson † School of Chemistry and Chemical Engineering, Queen’s University Belfast, David Keir Building, Stranmillis Road, Belfast BT9 5AG, U.K.
    [Show full text]
  • The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis
    THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG (Under the Direction of Maor Bar-Peled) ABSTRACT The synthesis of polysaccharides, glycoproteins, glycolipids, glycosylated secondary metabolites and hormones requires a large number of glycosyltransferases and a constant supply of nucleotide sugars. In plants, photosynthesis and the NDP-sugar inter-conversion pathway are the major entry points to form NDP-sugars. In addition to these pathways is the salvage pathway, a less understood metabolism that provides the flux of NDP-sugars. This latter pathway involves the hydrolysis of glycans to free sugars, sugar transport, sugar phosphorylation and nucleotidylation. The balance between glycan synthesis and recycling as well as its regulation at various plant developmental stages remains elusive as many of the molecular components are unknown. To understand how the salvage pathway contributes to the sugar flux and cell wall biosynthesis, my research focused on the functional identification of salvage pathway sugar kinases and NDP-sugar pyrophosphorylases. This research led to the first identification and enzymatic characterization of galacturonic acid kinase (GalA kinase), galactokinase (GalK), a broad UDP-sugar pyrophosphorylase (sloppy), two promiscuous UDP-GlcNAc pyrophosphorylases (GlcNAc-1-P uridylyltransferases), as well as UDP-sugar pyrophosphorylase paralogs from Trypanosoma cruzi and Leishmania major. To evaluate the salvage pathway in plant biology, we further investigated a sugar kinase mutant: galacturonic acid kinase mutant (galak) and determined if and how galak KO mutant affects the synthesis of glycans in Arabidopsis. Feeding galacturonic acid to the seedlings exhibited a 40-fold accumulation of free GalA in galak mutant, while the wild type (WT) plant readily metabolizes the fed-sugar.
    [Show full text]
  • Review Galactokinase: Structure, Function and Role in Type II
    CMLS, Cell. Mol. Life Sci. 61 (2004) 2471–2484 1420-682X/04/202471-14 DOI 10.1007/s00018-004-4160-6 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review Galactokinase: structure, function and role in type II galactosemia H. M. Holden a,*, J. B. Thoden a, D. J. Timson b and R. J. Reece c,* a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 (USA), Fax: +1 608 262 1319, e-mail: [email protected] b School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, (United Kingdom) c School of Biological Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, (United Kingdom), Fax: +44 161 275 5317, e-mail: [email protected] Received 13 April 2004; accepted 7 June 2004 Abstract. The conversion of beta-D-galactose to glucose unnatural sugar 1-phosphates. Additionally, galactoki- 1-phosphate is accomplished by the action of four en- nase-like molecules have been shown to act as sensors for zymes that constitute the Leloir pathway. Galactokinase the intracellular concentration of galactose and, under catalyzes the second step in this pathway, namely the con- suitable conditions, to function as transcriptional regula- version of alpha-D-galactose to galactose 1-phosphate. tors. This review focuses on the recent X-ray crystallo- The enzyme has attracted significant research attention graphic analyses of galactokinase and places the molecu- because of its important metabolic role, the fact that de- lar architecture of this protein in context with the exten- fects in the human enzyme can result in the diseased state sive biochemical data that have accumulated over the last referred to as galactosemia, and most recently for its uti- 40 years regarding this fascinating small molecule ki- lization via ‘directed evolution’ to create new natural and nase.
    [Show full text]
  • From Ginkgo Biloba
    INTERNATIONAL JOURNAL OF AGRICULTURE & BIOLOGY ISSN Print: 1560–8530; ISSN Online: 1814–9596 17–1230/2018/20–5–1080–1088 DOI: 10.17957/IJAB/15.0612 http://www.fspublishers.org Full Length Article Transcriptome-Guided Gene Isolation, Characterization and Expression Analysis of a Phosphomevalonate Kinase Gene (GbPMK) from Ginkgo biloba Qiling Song, Xiangxiang Meng, Yongling Liao, Weiwei Zhang, Jiabao Ye and Feng Xu* College of Horticulture and Gardening, Yangtze University, Jingzhou, 434025, China *For correspondence: [email protected] Abstract Terpenoids are main active ingredients of Ginkgo biloba. Phosphomethoxylate kinase (PMK) is one of the core enzyme in the mevalonate pathway, one of the two pathways in plants that can synthase terpenoids. In this study, a novel PMK gene (designated as GbPMK) was cloned from G. biloba. The expression profile of GbPMK in different tissues (roots, stems, leaves, male strobili, female strobili, and fruits) and under the treatments of hormones and stresses were investigated by qRT- PCR. Bioinformatics analysis indicated that the cDNA sequence of GbPMK contained a 1557-bp open reading frame encoding 519 amino acids. Protein structure analysis showed that the GbPMK protein had four conserved domains and one conserved region of the GHMP kinase family. Phylogenetic tree analysis revealed that GbPMK possessed a conserved sequence structure and sequence characteristics. The qRT-PCR analysis results showed that GbPMK exhibited tissue-specific expression, with the highest expression in leaves and the lowest expression in male strobili. GbPMK exerted different degrees of response to treatments with MeJA, ABA, Eth, SA, dark and low temperature but did not respond to wound treatment.
    [Show full text]
  • Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Theses, Dissertations, and Student Research in Agronomy and Horticulture Department Agronomy and Horticulture 7-2015 Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J. Morton University of Nebraska-Lincoln Follow this and additional works at: http://digitalcommons.unl.edu/agronhortdiss Part of the Agricultural Science Commons, Agronomy and Crop Sciences Commons, Plant Biology Commons, and the Plant Breeding and Genetics Commons Morton, Kyla J., "Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality" (2015). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 88. http://digitalcommons.unl.edu/agronhortdiss/88 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. BIOCHEMICAL AND PROTEOMIC PROFILING OF MAIZE ENDOSPERM TEXTURE AND PROTEIN QUALITY by Kyla J. Morton A DISSERTATION Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Doctor of Philosophy Major: Agronomy and Horticulture (Plant Breeding and Genetics) Under the Supervision of Professor David R. Holding Lincoln, Nebraska July, 2015 BIOCHEMICAL AND PROTEOMIC ANALYSIS OF MAIZE ENDOSPERM KERNEL TEXTURE AND PROTEIN QUALITY Kyla J. Morton, Ph.D. University of Nebraska, 2015 Advisor: David R. Holding The research described herein, focuses on the biochemical and proteomic analysis of the maize endosperm and what influences kernel texture.
    [Show full text]
  • Chandran Et Al. Supporting Info.Pdf
    Supporting Information (SI) Appendix Part 1. Impact of tissue preparation, LMD, and RNA amplification on array output. p. 2 Text S1: Detailed Experimental Design and Methods Figure S1A: Correlation analysis indicates tissue preparation has minimal impact on ATH1 array output. Figure S1B: Correlation analysis indicates RNA degradation does not significantly impact array output. Figure S1C: Correlation analysis indicates two-round amplification does not significantly impact array output. Figure S1D: Independent biological replicates of LMD samples are highly correlated. Figure S1E: Validation of LMD array expression by qPCR. Table S1: Tissue preparation-associated genes Part 2. Analysis of LMD and parallel whole leaf array data. p. 13 Table S2A: Known PM-impacted genes enriched in LMD dataset Table S2B: Dataset of LMD and whole leaf genes with PM-altered expression Table S2C: LMD PM MapMan Results and Bins Table S2D: ics1 vs. WT LMD PM MapMan Results and Bins Table S2E: Infection site-specific changes for redox and calcium categories Table S2F: cis-acting regulatory element motif analysis Part 3. Process network construction p. 149 3A. Photosynthesis 3B. Cold/dehydration response Part 4. Powdery mildew infection of WT and myb3r4 mutants p. 173 Text S4: Detailed Experimental Design and Methods (supplement to manuscript) Figure S4A. Uninfected 4 week old WT and myb3r4 plants Figure S4B. myb3r4 mutants exhibit reduced visible PM growth and reproduction Figure S4C. PM-infected WT and myb3r4 mutants do not exhibit cell death Figure S4D. Endoreduplication occurs at site of PM infection not distal to infection Figure S4E. Ploidy correlates with nuclear size. Part 1. Impact of tissue preparation, LMD, and RNA amplification on array output.
    [Show full text]