DOCSLIB.ORG

Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Theses, Dissertations, and Student Research in Agronomy and Horticulture Department Agronomy and Horticulture 7-2015 Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J. Morton University of Nebraska-Lincoln Follow this and additional works at: http://digitalcommons.unl.edu/agronhortdiss Part of the Agricultural Science Commons, Agronomy and Crop Sciences Commons, Plant Biology Commons, and the Plant Breeding and Genetics Commons Morton, Kyla J., "Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality" (2015). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 88. http://digitalcommons.unl.edu/agronhortdiss/88 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. BIOCHEMICAL AND PROTEOMIC PROFILING OF MAIZE ENDOSPERM TEXTURE AND PROTEIN QUALITY by Kyla J. Morton A DISSERTATION Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Doctor of Philosophy Major: Agronomy and Horticulture (Plant Breeding and Genetics) Under the Supervision of Professor David R. Holding Lincoln, Nebraska July, 2015 BIOCHEMICAL AND PROTEOMIC ANALYSIS OF MAIZE ENDOSPERM KERNEL TEXTURE AND PROTEIN QUALITY Kyla J. Morton, Ph.D. University of Nebraska, 2015 Advisor: David R. Holding The research described herein, focuses on the biochemical and proteomic analysis of the maize endosperm and what influences kernel texture. Quality Protein Maize (QPM) is a hard endosperm version of the high-lysine opaque2 (o2) mutant but the genes involved in modifying the soft o2 endosperm are unknown. Pyrophosphate (PPi)- dependent fructose 6-phosphate 1-phosphotransferase (PFP) catalyzes the ATP- independent conversion of fructose 6-phosphate to fructose 1, 6-bisphosphate in glycolysis. We found a large increase in transcript and protein levels of the alpha regulatory subunit of PFP (PFPα) in QPM endosperm. In vitro enzyme assays show a significant increase in forward PFP activity in developing endosperm extracts of QPM relative to wild type and o2. Furthermore, the O2 regulated pyruvate Pi dikinase (PPDK) gene is reduced in expression and activity in o2. Normal vitreous endosperm in QPM may occur due to modulation of glycolytic flux attributable to increased enzyme activity at two regulatory enzymes of glycolysis, PFP and PPDK. Opaque endosperm is most often attributed to either quantitative or qualitative changes in zein accumulation. However, some opaque endosperm mutants have normal zein accumulation. In order to identify factors involved in vitreous endosperm formation or its disruption (opacity) we conducted shotgun proteomic analysis of the nearly isogenic lines of six opaque endosperm mutant non-zein fractions. Our proteomic data indicates that there is not one specific cause of endosperm opacity apart from the non- ubiquitous reduction of zeins. We suggest that mis-regulation of zein deposition on the ER membrane or improper trafficking either upon loading or unloading from the ER membrane causes cellular stress which could invoke opacity. We also created a mutagenized B73 population (MB73) as an additional method to identify genomic regions and ultimately, genes involved in vitreous and/or opaque endosperm texture as well as create variants with proteomes rebalanced towards improved endosperm protein quality. iv Copyright 2015, Kyla J. Morton v Acknowledgements I would like to express my deepest appreciation and many thanks to my advisor, Dr. David Holding; you have been a tremendous mentor. Thank you for your endless encouragement, support, and patience. I am very fortunate you took me in as a graduate student and allowed me to grow as a research scientist. Your immense knowledge and eagerness for science is something that I will always admire and respect. I could not have asked for a better mentor and advisor. I would also like to thank my supervisory committee members: Dr. Madhavan Soundararajan, Dr. Gautam Sarath and Dr. Jonathan Markham, for their inspiration, guidance and insightful comments on my research and thesis. Thank you to all the present and former members of the lab. Especially, Dr. Lingling Yuan and Dr. Xiaomei Guo, who were so supportive in the beginning of my graduate career as we spent many, many hours in the field together. Also, thank you to Dr. Shangang Jia for his expertise in computational biology and critical insight on my proteomic manuscript. A big thank you to all of the undergraduates who helped with my research including: Leah (Pittard) Fisher, Steven Wahlmeier, Adam Berg, and Michael Miller. I also would like to thank my husband, Zach, for always graciously reminding me what is truly important in life and keeping me grounded in my faith. Many thanks to my parents, Rick and Lois, and my brother, Trent, for their endless love and support in everything I do. vi Funding Acknowledgement This research was supported by the UNL Department of Agronomy and Horticulture and Center for Plant Science Innovation vii Table of Contents LISTS OF MULTIMEDIA OBJECTS .............................................................................. ix CHAPTER 1: Literature Review Introduction ....................................................................................................................2 Figures..........................................................................................................................11 References ....................................................................................................................15 CHAPTER 2: Investigation of the Role of Pyrophosphate-Dependent Glycolytic Enzymes in Maize Endosperm Abstract ........................................................................................................................19 Introduction ..................................................................................................................20 Methods........................................................................................................................24 Results ..........................................................................................................................30 Discussion ....................................................................................................................41 Figures..........................................................................................................................47 References ....................................................................................................................55 CHAPTER 3: Proteomic Profiling of Maize Opaque Endosperm Mutants Reveals Selective Accumulation of Lysine-Enriched Proteins and New Insight into the ER- Secretory Pathway Abstract ........................................................................................................................59 Introduction ..................................................................................................................60 Methods........................................................................................................................65 Results ..........................................................................................................................70 Discussion ....................................................................................................................82 viii Figures..........................................................................................................................91 References ..................................................................................................................100 CHAPTER 4: Analysis of Proteome Rebalancing in Selected B73 Maize Deletion Mutants Abstract ......................................................................................................................106 Methods......................................................................................................................107 Results and Discussion ..............................................................................................108 Figures........................................................................................................................111 References ..................................................................................................................115 APPENDIX 1: Supplemental Data from Chapter 3 Figure and Tables .......................................................................................................116 ix LISTS OF MULTIMEDIA OBJECTS: CHAPTER 1: Literature Review Figure 1.1 Mature Maize Kernel Composition ............................................................11 Figure 1.2 ER Protein Body Formation in Maize Kernels ..........................................11 Figure 1.3 Proteome Rebalancing in opaque2 Increases Whole Kernel Lysine and Tryptophan Content. ....................................................................................12 Figure 1.4 Numerous, Small Gamma-zein-rich Protein Bodies Create a Different Type of Vitreous Endosperm in QPM. ........................................................12
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • ASPA Gene Aspartoacylase
    ASPA gene aspartoacylase Normal Function The ASPA gene provides instructions for making an enzyme called aspartoacylase. In the brain, this enzyme breaks down a compound called N-acetyl-L-aspartic acid (NAA) into aspartic acid (an amino acid that is a building block of many proteins) and another molecule called acetic acid. The production and breakdown of NAA appears to be critical for maintaining the brain's white matter, which consists of nerve fibers surrounded by a myelin sheath. The myelin sheath is the covering that protects nerve fibers and promotes the efficient transmission of nerve impulses. The precise function of NAA is unclear. Researchers had suspected that it played a role in the production of the myelin sheath, but recent studies suggest that NAA does not have this function. The enzyme may instead be involved in the transport of water molecules out of nerve cells (neurons). Health Conditions Related to Genetic Changes Canavan disease More than 80 mutations in the ASPA gene are known to cause Canavan disease, which is a rare inherited disorder that affects brain development. Researchers have described two major forms of this condition: neonatal/infantile Canavan disease, which is the most common and most severe form, and mild/juvenile Canavan disease. The ASPA gene mutations that cause the neonatal/infantile form severely impair the activity of aspartoacylase, preventing the breakdown of NAA and allowing this substance to build up to high levels in the brain. The mutations that cause the mild/juvenile form have milder effects on the enzyme's activity, leading to less accumulation of NAA.
    [Show full text]
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pantothenate Kinase-Associated Neurodegeneration
    Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration.
    [Show full text]
  • A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration
    IJMCM Case Report Autumn 2016, Vol 5, No 4 A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration Soudeh Ghafouri-Fard 1, Vahid Reza Yassaee 2, Alireza Rezayi 3, Feyzollah Hashemi-Gorji 2, Nasrin Alipour 2, ∗ Mohammad Miryounesi 2 1. Department of Medical Genetics, Shahid Beheshti University of Medical sciences, Tehran, Iran. 2. Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 3. Pediatric Neurology Department, Loghman Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 29 June 2016; Accepted 14 August 2016; Published 23 October 2016 Pantothenate kinase- associated neurodegeneration (PKAN) syndrome is a rare autosomal recessive disorder characterized by progressive extrapyramidal dysfunction and iron accumulation in the brain and axonal spheroids in the central nervous system. It has been shown that the disorder is caused by mutations in PANK2 gene which codes for a mitochondrial enzyme participating in coenzyme A biosynthesis. Here we report two cases of classic PKAN syndrome with early onset of neurodegenerative disorder. Mutational analysis has revealed that both are homozygous for a novel nonsense mutation in PANK2 gene (c.T936A (p.C312X)). The high prevalence of consanguineous marriages in Iran raises the likelihood of occurrence of autosomal recessive disorders such as PKAN and necessitates proper premarital genetic counseling. Further research is needed to provide the data on the prevalence of PKAN and identification of common PANK2 mutations in Iranian population. Key words : PANK2 , pantothenate kinase-associated neurodegeneration, mutation antothenate kinase-associated neurodegen- weighted which is due to iron deposition in the Peration (PKAN) syndrome is a rare autosomal periphery (hypointensity) and necrosis on its central recessive disorder characterized by progressive part (hyperintensity) (2).
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Global Histone Modification Fingerprinting in Human Cells Using
    OPEN Citation: Cell Death Discovery (2017) 3, 16077; doi:10.1038/cddiscovery.2016.77 Official journal of the Cell Death Differentiation Association www.nature.com/cddiscovery ARTICLE Global histone modification fingerprinting in human cells using epigenetic reverse phase protein array Marina Partolina1,HazelCThoms1, Kenneth G MacLeod2, Giovanny Rodriguez-Blanco1,MatthewNClarke1, Anuroop V Venkatasubramani1,3, Rima Beesoo4, Vladimir Larionov5, Vidushi S Neergheen-Bhujun4, Bryan Serrels2, Hiroshi Kimura6, Neil O Carragher2 and Alexander Kagansky1,7 The balance between acetylation and deacetylation of histone proteins plays a critical role in the regulation of genomic functions. Aberrations in global levels of histone modifications are linked to carcinogenesis and are currently the focus of intense scrutiny and translational research investments to develop new therapies, which can modify complex disease pathophysiology through epigenetic control. However, despite significant progress in our understanding of the molecular mechanisms of epigenetic machinery in various genomic contexts and cell types, the links between epigenetic modifications and cellular phenotypes are far from being clear. For example, enzymes controlling histone modifications utilize key cellular metabolites associated with intra- and extracellular feedback loops, adding a further layer of complexity to this process. Meanwhile, it has become increasingly evident that new assay technologies which provide robust and precise measurement of global histone modifications are required,
    [Show full text]
  • Generated by SRI International Pathway Tools Version 25.0, Authors S
    Authors: Pallavi Subhraveti Ron Caspi Quang Ong Peter D Karp An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Ingrid Keseler Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000725805Cyc: Streptomyces xanthophaeus Cellular Overview Connections between pathways are omitted for legibility.
    [Show full text]
  • Identification of Proteins Differentially Expressed in the Conventional Renal Cell Carcinoma by Proteomic Analysis
    J Korean Med Sci 2005; 20: 450-5 Copyright � The Korean Academy ISSN 1011-8934 of Medical Sciences Identification of Proteins Differentially Expressed in the Conventional Renal Cell Carcinoma by Proteomic Analysis Renal cell carcinoma (RCC) is one of the most malignant tumors in urology, and Jeong Seok Hwa, Hyo Jin Park*, due to its insidious onset patients frequently have advanced disease at the time of Jae Hun Jung, Sung Chul Kam, clinical presentation. Thus, early detection is crucial in management of RCC. To Hyung Chul Park, Choong Won Kim*, identify tumor specific proteins of RCC, we employed proteomic analysis. We pre- Kee Ryeon Kang*, Jea Seog Hyun, Ky Hyun Chung pared proteins from conventional RCC and the corresponding normal kidney tis- sues from seven patients with conventional RCC. The expression of proteins was Department of Urology and Biochemistry*, College of determined by silver stain after two-dimensional polyacrylamide gel electrophore- Medicine and Institute of Health Science, sis (2D-PAGE). The overall protein expression patterns in the RCC and the normal Gyeongsang National University, Jinju, Korea kidney tissues were quite similar except some areas. Of 66 differentially expressed Received : 29 December 2004 protein spots (p<0.05 by Student t-test), 8 different proteins from 11 spots were Accepted : 13 January 2005 identified by MALDI-TOF-MS. The expression of the following proteins was repress- ed (p<0.05); aminoacylase-1, enoyl-CoA hydratase, aldehyde reductase, tropo- Address for correspondence myosin -4 chain, agmatinase and ketohexokinase. Two proteins, vimentin and -1 Jeong Seok Hwa, M.D. Department of Urology, College of Medicine, antitrypsin precursor, were dominantly expressed in RCC (p<0.05).
    [Show full text]
  • CUMMINGS-DISSERTATION.Pdf (4.094Mb)
    D-AMINOACYLASES AND DIPEPTIDASES WITHIN THE AMIDOHYDROLASE SUPERFAMILY: RELATIONSHIP BETWEEN ENZYME STRUCTURE AND SUBSTRATE SPECIFICITY A Dissertation by JENNIFER ANN CUMMINGS Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY December 2010 Major Subject: Chemistry D-AMINOACYLASES AND DIPEPTIDASES WITHIN THE AMIDOHYDROLASE SUPERFAMILY: RELATIONSHIP BETWEEN ENZYME STRUCTURE AND SUBSTRATE SPECIFICITY A Dissertation by JENNIFER ANN CUMMINGS Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Frank Raushel Committee Members, Paul Lindahl David Barondeau Gregory Reinhart Head of Department, David Russell December 2010 Major Subject: Chemistry iii ABSTRACT D-Aminoacylases and Dipeptidases within the Amidohydrolase Superfamily: Relationship Between Enzyme Structure and Substrate Specificity. (December 2010) Jennifer Ann Cummings, B.S., Southern Oregon University; M.S., Texas A&M University Chair of Advisory Committee: Dr. Frank Raushel Approximately one third of the genes for the completely sequenced bacterial genomes have an unknown, uncertain, or incorrect functional annotation. Approximately 11,000 putative proteins identified from the fully-sequenced microbial genomes are members of the catalytically diverse Amidohydrolase Superfamily. Members of the Amidohydrolase Superfamily separate into 24 Clusters of Orthologous Groups (cogs). Cog3653 includes proteins annotated as N-acyl-D-amino acid deacetylases (DAAs), and proteins within cog2355 are homologues to the human renal dipeptidase. The substrate profiles of three DAAs (Bb3285, Gox1177 and Sco4986) and six microbial dipeptidase (Sco3058, Gox2272, Cc2746, LmoDP, Rsp0802 and Bh2271) were examined with N-acyl-L-, N-acyl-D-, L-Xaa-L-Xaa, L-Xaa-D-Xaa and D-Xaa-L-Xaa substrate libraries.
    [Show full text]
  • WO2019226953A1.Pdf
    ) ( 2 (51) International Patent Classification: Street, Brookline, MA 02446 (US). WILSON, Christo¬ C12N 9/22 (2006.01) pher, Gerard; 696 Main Street, Apartment 311, Waltham, MA 0245 1(US). DOMAN, Jordan, Leigh; 25 Avon Street, (21) International Application Number: Somverville, MA 02143 (US). PCT/US20 19/033 848 (74) Agent: HEBERT, Alan, M. et al. ;Wolf, Greenfield, Sacks, (22) International Filing Date: P.C., 600 Atlanitc Avenue, Boston, MA 02210-2206 (US). 23 May 2019 (23.05.2019) (81) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of national protection av ailable) . AE, AG, AL, AM, (26) Publication Language: English AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (30) Priority Data: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, 62/675,726 23 May 2018 (23.05.2018) US HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, 62/677,658 29 May 2018 (29.05.2018) US KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (71) Applicants: THE BROAD INSTITUTE, INC. [US/US]; MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 415 Main Street, Cambridge, MA 02142 (US). PRESI¬ OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, DENT AND FELLOWS OF HARVARD COLLEGE SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, [US/US]; 17 Quincy Street, Cambridge, MA 02138 (US).
    [Show full text]