DOCSLIB.ORG

A Study of Coenzyme a Metabolism and Function in Mammalian Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Study of Coenzyme a Metabolism and Function in Mammalian Cells A Study of Coenzyme A Metabolism and Function in Mammalian Cells A Study of Coenzyme A Metabolism and Function in Mammalian Cells Pascale Monteil A thesis submitted to the University College London in fulfilment with the requirements for the degree of Doctor of Philosophy. London, March 2013 Research Department of Structural and Molecular Biology University College London Gower Street London, WC1E 6BT United Kingdom 1 A Study of Coenzyme A Metabolism and Function in Mammalian Cells Declaration I, Pascale Monteil, declare that all the work presented in this thesis is the result of my own work. The work presented here does not constitute part of any other thesis. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. The work herein was carried out while I was a graduate research student at University College London Research Department of Structural and Molecular Biology under the supervision of Professor Ivan Gout. Mass Spectrometry work was carried out by N. Totty, Cancer Research UK. Pascale Monteil 2 A Study of Coenzyme A Metabolism and Function in Mammalian Cells Abstract CoA is well established as a metabolic cofactor in numerous oxidative and biosynthetic pathways. The levels of CoA usually remain within a tight range, however these have been shown to change in response to nutritional state, fibrate drugs and several pathological conditions. Although the mechanisms that alter CoA levels are not fully understood, the fluctuations in CoA can influence the cellular processes it regulates. The regulatory roles of CoA have mainly been studied in the context of feedback/ feed forward regulation of metabolic pathways or enzymes, yet very little is known about its role as a regulator of cellular function. In addition to its action as a cofactor, a few reports have indicated that CoA binds to and regulates proteins through allosteric and covalent modification, suggesting wider regulatory roles for CoA. The aim of this thesis was therefore to gain a greater understanding of the function of CoA as a regulator of cellular processes. Initially, conditions for extracting and measuring CoA levels in cultured cells were developed and optimised. CoA levels were much lower in cultured HepG2 cells compared to liver and did not respond in the same way when treated with extracellular stimuli. A 2- fold increase in CoA levels, through over-expression of the enzyme PanK1β, did result in the novel finding that CoA has a negative effect on cell growth. This was accompanied by increased acetylation of a large number of proteins and also an increase in lactate production. In addition, affinity purification with CoA Sepharose, followed by mass spectrometry, pulled down several proteins, previously unknown to bind to CoA, which regulate a wide range of cellular processes. Together, the data from this thesis has provided a greater insight into the wider role of CoA as a regulator of cellular function. 3 A Study of Coenzyme A Metabolism and Function in Mammalian Cells Dedication There are a number of people to whom I am greatly indebted for the completion of this thesis. My parents, who gave me the educational platform that provided me with countless opportunities, enabling me to pursue my dreams. My supervisor, Professor Ivan Gout, whose passion for science is truly inspiring, for offering me this PhD position, as well as his advice and expertise. Yugo, the most dedicated postdoc I have ever known, for his constant guidance, support and assistance in the lab. He went above and beyond what I ever expected and I am eternally grateful. My colleagues, Lena, Nadeem, Alex, Eddy, Zeyad, Kamil, Ahmed, Mahmoud, Chris, Dasha, Ganna and Ivan for the discussions that helped solve problems of all sizes as well as the company through this challenging journey. My collaberators at Cancer Research UK (Dr. Nick Totty’s group), for the mass spectrometry work they did. Professor David Saggerson, for sharing his expertise in the field of metabolism and enzymatic assays. Professors Kaila Srai and Finn Werner, for their useful suggestions and alternative points of view during my thesis committee meetings, which were almost like vivas in themselves. My friends, Abi and Andrea as well as my housemate Alex and my sister Lauren for always listening and encouraging me through the difficult times. I am especially thankful to Andrea and Lauren, for taking the time to plough through a thesis that must have seemed like another language to them. I thank you all for these contributions great and small, as without you, this thesis would not have been written. 4 A Study of Coenzyme A Metabolism and Function in Mammalian Cells Table of Contents Declaration ............................................................................................................................... 2 Abstract .................................................................................................................................... 3 Dedication ................................................................................................................................ 4 List of Figures ......................................................................................................................... 13 Abbreviations ......................................................................................................................... 16 Chapter 1:............................................................................................................................... 20 1.1 General Introduction ........................................................................................................ 21 1.2 Coenzyme A ..................................................................................................................... 21 1.2.1 Coenzymes ................................................................................................................ 21 1.2.2 Coenzyme A .............................................................................................................. 21 1.2.3 CoA structure ............................................................................................................ 23 1.2.4 CoA derivatives ......................................................................................................... 23 1.3 Cellular Functions of CoA ................................................................................................. 25 1.3.1 Overview of CoA in metabolism ............................................................................... 25 1.3.2 The role of CoA in energy generation ....................................................................... 25 1.3.3 The role of CoA in Fatty Acid Oxidation .................................................................... 26 1.3.4 The role of CoA in Biosynthetic pathways ................................................................ 29 1.4 Regulation of Proteins and Cellular processes by CoA and CoA thioesters ..................... 33 1.4.1 The role of CoA in the regulation of cellular processes ............................................ 33 1.4.2 Availability as a cofactor or substrate ....................................................................... 33 1.4.3 Regulation through non-covalent interaction .......................................................... 34 5 A Study of Coenzyme A Metabolism and Function in Mammalian Cells 1.4.3.1 Balance between CoASH/CoA thioesters ........................................................... 34 1.4.3.2 Allosteric and other non-covalent interactions ................................................. 36 1.4.4 Regulation through covalent modifications .............................................................. 40 1.5 Control of CoA levels ........................................................................................................ 43 1.5.1 CoA Biosynthetic Pathway ........................................................................................ 43 1.5.2 Regulatory enzymes in CoA Biosynthesis: Pantothenate Kinase .............................. 46 1.5.3 Regulatory enzymes in CoA Biosynthesis: CoA Synthase ......................................... 48 1.5.4 Degradation of CoA ................................................................................................... 49 1.5.5 Conversion of CoASH to other esters ....................................................................... 50 1.5.6 Compartmentalisation of CoA .................................................................................. 50 1.6 CoA homeostasis .............................................................................................................. 51 1.6.1 Basal levels of CoA .................................................................................................... 51 1.6.2 Physiological changes in CoA levels .......................................................................... 52 1.6.3 Pathological conditions which change CoA levels .................................................... 52 1.7 Aim of thesis..................................................................................................................... 54 Chapter 2:............................................................................................................................... 56 Materials and Methods .......................................................................................................... 56 2.1 Materials .........................................................................................................................
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • One Carbon Metabolism and Its Clinical Significance
    One carbon metabolism and its clinical significance Dr. Kiran Meena Department of Biochemistry Class 5 : 10-10-2019 (8:00 to 9:00 AM ) Specific Learning Objectives Describe roles of folic acid, cobalamin and S-adenosylmethionine (SAM) in transfer of one carbon units between molecules, and apply their relevance to disease states Describe synthesis of S-adenosylmethionine and its role in methylation reactions Explain how a cobalamin deficiency leads to a secondary folate deficiency Introduction Human body cannot synthesize folic acid Its also called vitamin B9 give rise to tetrahydrofolate (THF), carry one carbon groups ex. Methyl group Intestines releases mostly N5-methy-THF into blood One-carbon (1C) metabolism, mediated by folate cofactor, supports biosynthesis of purines and pyrimidines, aa homeostasis (glycine, serine and methionine) Table 14.4: DM Vasudevan’ s Textbook of Biochemistry for Medical Students 6th edition Enzyme co-factors involved in aa catabolism Involves one of three co-factors: Biotin, Tetrahydrofolate (THF) and S- adenosylmethionine (SAM) These cofactors transfer one-carbon groups in different oxidation states: 1. Biotin transfers carbon in its most oxidized state CO2, it require for catabolism and utilization of branched chain aa • Biotin responsible for carbon dioxide transfer in several carboxylase enzymes Cont-- 2. Tetrahydrofolate (THF) transfers one-carbon groups in intermediate oxidation states and as methyl groups • Tetrahydrobiopterin (BH4, THB) is a cofactor of degradation of phenylalanine • Oxidised form of THF, folate is vitamin for mammals • It converted into THF by DHF reductase 3. S-adenosylmethionine (SAM) transfers methyl groups, most reduced state of carbon THF and SAM imp in aa and nucleotide metabolism SAM used in biosynthesis of creatine, phosphatidylcholine, plasmenylcholine and epinephrine, also methylated DNA, RNA and proteins Enzymes use cobalamin as a cofactor 1.
    [Show full text]
  • Mobile Loop Dynamics in Adenosyltransferase Control
    Mobile loop dynamics in adenosyltransferase control binding and reactivity of coenzyme B12 Romila Mascarenhasa,1, Markus Ruetza,1, Liam McDevitta, Markos Koutmosb,c, and Ruma Banerjeea,2 aDepartment of Biological Chemistry, University of Michigan, Ann Arbor, MI 48109-0600; bDepartment of Chemistry, University of Michigan, Ann Arbor, MI 48109-0600, and cDepartment of Biophysics, University of Michigan, Ann Arbor, MI 48109-0600 Edited by Amie K. Boal, Pennsylvania State University, State College, PA, and accepted by Editorial Board Member Stephen J. Benkovic October 20, 2020 (received for review April 16, 2020) Cobalamin is a complex organometallic cofactor that is processed Human and Methylobacterium extorquens (Me) ATR, which have and targeted via a network of chaperones to its dependent been characterized most extensively, also double as chaperones, enzymes. AdoCbl (5′-deoxyadenosylcobalamin) is synthesized transferring AdoCbl directly to MCM (Fig. 1A) rather than re- from cob(II)alamin in a reductive adenosylation reaction catalyzed leasing the high-value product into solution (12–17). Cofactor by adenosyltransferase (ATR), which also serves as an escort, de- loading onto MCM is gated by the GTPase activity of the G livering AdoCbl to methylmalonyl-CoA mutase (MCM). The mech- protein chaperone CblA (18). Despite the overall structural and anism by which ATR signals that its cofactor cargo is ready functional conservation of the cofactor loading processes, there (AdoCbl) or not [cob(II)alamin] for transfer to MCM, is not known. are important differences in regulation between the human (19) In this study, we have obtained crystallographic snapshots that – reveal ligand-induced ordering of the N terminus of Mycobacte- and the better-characterized bacterial systems (15 17).
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Electronic Supplementary Material (ESI) for Molecular Biosystems
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2015 Table S5 Mass data of proteins identified with label free shotgun proteomics a #Alt. Proteins; b Scores; c #Peptides; d SC [%]; e RMS90 [ppm]; f Rank; g Median(Controls:GLP1); h #(Controls:GLP1); i CV [%](Controls:GLP1); l Median(Controls:Palmitate); m #(Controls:Palmitate) ; n CV [%](Controls:Palmitate); o Median(Controls:GLP1 + Palmitate); p #(Controls:GLP1 + Palmitate); q CV [%](Controls:GLP1 + Palmitate) MW OK Accession Protein pI a b c d e f g h i l m n o p q [kDa] 78 kDa glucose-regulated protein OS=Rattus 1672.6 true GRP78_RAT 72.3 4.9 1 22 39 1.48 1 1.16 6 20.53 1.18 9 9.56 1.24 10 13.52 norvegicus GN=Hspa5 PE=1 SV=1 (M:1672.6) Endoplasmin OS=Rattus norvegicus 1253.0 true ENPL_RAT 92.7 4.6 1 23 29 3.34 2 0.85 8 33.34 1.19 6 39.58 1.18 10 28.11 GN=Hsp90b1 PE=1 SV=2 (M:1253.0) Stress-70 protein, mitochondrial OS=Rattus 1138.8 true GRP75_RAT 73.8 5.9 1 17 28.7 1.18 3 1.21 5 7.62 0.78 1 1.1 8 8.04 norvegicus GN=Hspa9 PE=1 SV=3 (M:1138.8) Protein disulfide-isomerase A3 OS=Rattus 1035.4 true PDIA3_RAT 56.6 5.8 1 16 35.2 2.84 4 0.94 3 17.22 1.15 4 26.62 1.25 4 7.86 norvegicus GN=Pdia3 PE=1 SV=2 (M:1035.4) Aconitate hydratase, mitochondrial 983.8 true ACON_RAT OS=Rattus norvegicus GN=Aco2 PE=1 85.4 8.7 1 19 31.4 2.72 5 0.89 2 23.6 1.21 2 9.25 0.89 3 32.87 (M:983.8) SV=2 60 kDa heat shock protein, mitochondrial 906.9 true CH60_RAT OS=Rattus norvegicus GN=Hspd1 PE=1 60.9 5.8 1 13 32.5 3.26 6 1.05 5 13.15 1.01 2 32.54 1.01
    [Show full text]
  • The Biosynthetic Gene Cluster for the Anticancer Drug Bleomycin From
    Journal of Industrial Microbiology & Biotechnology (2001) 27, 378–385 D 2001 Nature Publishing Group 1367-5435/01 $17.00 www.nature.com/jim The biosynthetic gene cluster for the anticancer drug bleomycin from Streptomyces verticillus ATCC15003 as a model for hybrid peptide–polyketide natural product biosynthesis B Shen, L Du, C Sanchez, DJ Edwards, M Chen and JM Murrell Department of Chemistry, University of California, Davis, One Shields Avenue, Davis, CA 95616, USA The hybrid peptide–polyketide backbone of bleomycin (BLM) is assembled by the BLM megasynthetase that consists of both nonribosomal peptide synthetase (NRPS) and polyketide synthase (PKS) modules. BlmIX/BlmVIII/BlmVII constitute a natural hybrid NRPS/PKS/NRPS system, serving as a model for both hybrid NRPS/PKS and PKS/NRPS systems. Sequence analysis and functional comparison of domains and modules of BlmIX/BlmVIII/BlmVII with those of nonhybrid NRPS and PKS systems suggest that (1) the same catalytic sites appear to be conserved in both hybrid NRPS–PKS and nonhybrid NRPS or PKS systems, with the exception of the KS domains in the hybrid NRPS/PKS systems that are unique; (2) specific interpolypeptide linkers may play a critical role in intermodular communication to facilitate transfer of the growing intermediates between the interacting NRPS and/or PKS modules; and (3) posttranslational modification of the BLM megasynthetase has been accomplished by a single PPTase with a broad substrate specificity toward the apo forms of both acyl carrier proteins (ACPs) and peptidyl carrier
    [Show full text]
  • Chapter 7. "Coenzymes and Vitamins" Reading Assignment
    Chapter 7. "Coenzymes and Vitamins" Reading Assignment: pp. 192-202, 207-208, 212-214 Problem Assignment: 3, 4, & 7 I. Introduction Many complex metabolic reactions cannot be carried out using only the chemical mechanisms available to the side-chains of the 20 standard amino acids. To perform these reactions, enzymes must rely on other chemical species known broadly as cofactors that bind to the active site and assist in the reaction mechanism. An enzyme lacking its cofactor is referred to as an apoenzyme whereas the enzyme with its cofactor is referred to as a holoenzyme. Cofactors are subdivided into essential ions and organic molecules known as coenzymes (Fig. 7.1). Essential ions, commonly metal ions, may participate in substrate binding or directly in the catalytic mechanism. Coenzymes typically act as group transfer agents, carrying electrons and chemical groups such as acyl groups, methyl groups, etc., depending on the coenzyme. Many of the coenzymes are derived from vitamins which are essential for metabolism, growth, and development. We will use this chapter to introduce all of the vitamins and coenzymes. In a few cases--NAD+, FAD, coenzyme A--the mechanisms of action will be covered. For the remainder of the water-soluble vitamins, discussion of function will be delayed until we encounter them in metabolism. We also will discuss the biochemistry of the fat-soluble vitamins here. II. Inorganic cation cofactors Many enzymes require metal cations for activity. Metal-activated enzymes require or are stimulated by cations such as K+, Ca2+, or Mg2+. Often the metal ion is not tightly bound and may even be carried into the active site attached to a substrate, as occurs in the case of kinases whose actual substrate is a magnesium-ATP complex.
    [Show full text]
  • Tricarboxylic Acid (TCA) Cycle Intermediates: Regulators of Immune Responses
    life Review Tricarboxylic Acid (TCA) Cycle Intermediates: Regulators of Immune Responses Inseok Choi , Hyewon Son and Jea-Hyun Baek * School of Life Science, Handong Global University, Pohang, Gyeongbuk 37554, Korea; [email protected] (I.C.); [email protected] (H.S.) * Correspondence: [email protected]; Tel.: +82-54-260-1347 Abstract: The tricarboxylic acid cycle (TCA) is a series of chemical reactions used in aerobic organisms to generate energy via the oxidation of acetylcoenzyme A (CoA) derived from carbohydrates, fatty acids and proteins. In the eukaryotic system, the TCA cycle occurs completely in mitochondria, while the intermediates of the TCA cycle are retained inside mitochondria due to their polarity and hydrophilicity. Under cell stress conditions, mitochondria can become disrupted and release their contents, which act as danger signals in the cytosol. Of note, the TCA cycle intermediates may also leak from dysfunctioning mitochondria and regulate cellular processes. Increasing evidence shows that the metabolites of the TCA cycle are substantially involved in the regulation of immune responses. In this review, we aimed to provide a comprehensive systematic overview of the molecular mechanisms of each TCA cycle intermediate that may play key roles in regulating cellular immunity in cell stress and discuss its implication for immune activation and suppression. Keywords: Krebs cycle; tricarboxylic acid cycle; cellular immunity; immunometabolism 1. Introduction The tricarboxylic acid cycle (TCA, also known as the Krebs cycle or the citric acid Citation: Choi, I.; Son, H.; Baek, J.-H. Tricarboxylic Acid (TCA) Cycle cycle) is a series of chemical reactions used in aerobic organisms (pro- and eukaryotes) to Intermediates: Regulators of Immune generate energy via the oxidation of acetyl-coenzyme A (CoA) derived from carbohydrates, Responses.
    [Show full text]
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Acetyl Coenzyme a (Sodium Salt) 08/19
    FOR RESEARCH ONLY! Acetyl Coenzyme A (sodium salt) 08/19 ALTERNATE NAMES: S-[2-[3-[[4-[[[5-(6-aminopurin-9-yl)-4-hydroxy-3-phosphonooxyoxolan-2-yl]methoxy- hydroxyphosphoryl]oxy-hydroxyphosphoryl]oxy-2-hydroxy-3,3- dimethylbutanoyl]amino]propanoylamino]ethyl] ethanethioate, sodium; S-acetate coenzyme A, trisodium salt; Acetyl CoA, trisodium salt; Acetyl-S- CoA, trisodium salt CATALOG #: B2844-1 1 mg B2844-5 5 mg STRUCTURE: MOLECULAR FORMULA: C₂₃H₃₈N₇O₁₇P₃S•3Na MOLECULAR WEIGHT: 878.5 CAS NUMBER: 102029-73-2 APPEARANCE: A crystalline solid PURITY: ≥90% ~10 mg/ml in PBS, pH 7.2 SOLUBILITY: DESCRIPTION: Acetyl-CoA is an essential cofactor and carrier of acyl groups in enzymatic reactions. It is formed either by the oxidative decarboxylation of pyruvate, β-oxidation of fatty acids or oxidative degradation of certain amino acids. It is an intermediate in fatty acid and amino acid metabolism. It is the starting compound for the citric acid cycle. It is a precursor for the neurotransmitter acetylcholine. It is required for acetyltransferases and acyltransferases in the post-translational modification of proteins. STORAGE TEMPERATURE: -20ºC HANDLING: Do not take internally. Wear gloves and mask when handling the product! Avoid contact by all modes of exposure. REFERENCES: 1. Palsson-McDermott, E.M., and O'Neill, L.A. The Warburg effect then and now: From cancer to inflammatory diseases. BioEssays 35(11), 965-973 (2013). 2. Akram, M. Citric acid cycle and role of its intermediates in metabolism. Cell Biochemistry and Biophysics 68(3), 475-478 (2014). 3. Miura, Y. The biological significance of ω-oxidation of fatty acids.
    [Show full text]
  • Murine Neonatal Ketogenesis Preserves Mitochondrial Energetics by Preventing Protein Hyperacetylation
    ARTICLES https://doi.org/10.1038/s42255-021-00342-6 Murine neonatal ketogenesis preserves mitochondrial energetics by preventing protein hyperacetylation Yuichiro Arima 1,2,13 ✉ , Yoshiko Nakagawa3,13, Toru Takeo 3,13, Toshifumi Ishida 1, Toshihiro Yamada1, Shinjiro Hino4, Mitsuyoshi Nakao4, Sanshiro Hanada 2, Terumasa Umemoto 2, Toshio Suda2, Tetsushi Sakuma 5, Takashi Yamamoto5, Takehisa Watanabe6, Katsuya Nagaoka6, Yasuhito Tanaka6, Yumiko K. Kawamura7,8, Kazuo Tonami7, Hiroki Kurihara7, Yoshifumi Sato9, Kazuya Yamagata9,10, Taishi Nakamura 1,11, Satoshi Araki1, Eiichiro Yamamoto1, Yasuhiro Izumiya1,12, Kenji Sakamoto1, Koichi Kaikita1, Kenichi Matsushita 1, Koichi Nishiyama2, Naomi Nakagata3 and Kenichi Tsujita1,10 Ketone bodies are generated in the liver and allow for the maintenance of systemic caloric and energy homeostasis during fasting and caloric restriction. It has previously been demonstrated that neonatal ketogenesis is activated independently of starvation. However, the role of ketogenesis during the perinatal period remains unclear. Here, we show that neonatal ketogen- esis plays a protective role in mitochondrial function. We generated a mouse model of insufficient ketogenesis by disrupting the rate-limiting hydroxymethylglutaryl-CoA synthase 2 enzyme gene (Hmgcs2). Hmgcs2 knockout (KO) neonates develop microvesicular steatosis within a few days of birth. Electron microscopic analysis and metabolite profiling indicate a restricted energy production capacity and accumulation of acetyl-CoA in Hmgcs2 KO mice. Furthermore,
    [Show full text]