DOCSLIB.ORG

Supplementary Tables

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Tables Supplementary Tables Table S1. DNA Sequences used for rtPCR. Target Gene Sequence (from 5’ to 3’) GATCAACCTGGAGTTGTATGCC FHC CTCCCAGTCATCACGGTCTG TTGCAGTGGCAAAGTGGAGA GAPDH CGTGGTTCACACCCATCACAA FHC-complete GGATCCACCATGACCACCGCGTCTCC cDNA AAGCTTGCTCTCATCACCGTGTCCCAG AAGCTTCAGACGTTCTCGCCCAGAGT 5’UTR CCATGGAGGGAGACGCGGTGGTCTT TCTAGAGCTGACTTCCCCAAAGCCA 3’UTR TCTAGAGGGTACCAAAATTCTTTATTTG 1 Table S2. Proteins identified by MALDI TOF/TOF Peptide Cove Protein Gene Accession Theory Score MS/MS Protein ID Countb) rage Sequence confirmed by MS/MS score namea) no. Mr(Da)/ pI c) scored) (n) % C.I.% e) 148 163 MYL3 Myosin light chain 3 P09542.4 22407.3/5.03 4 23 61 VFDKEGNGTVMGAELR 42 98.634 119 126 COTL1 Coactosin-like protein Q9CQI6 15934.0/5.28 9 66 262 ELEEDFIR 55 100 118 126 KELEEDFIR 48 19 30 DDGSAVIWVTFR 80 HINT1 Histidine triad P70349 13768.1/6.39 5 71 55 üü95.578 nucleotide-binding protein 1 152 161 ʿMLRB Myosin regulatory light chain Q3THE2 19766.5/4.71 7 30 199 GNFNYIEFTR 69 100 134 144 2-B, smooth muscle isoform FTDEEVDELYR 81 152 161 ʿMLRB Myosin regulatory light chain Q3THE2 19766.5/4.71 8 44 208 GNFNYIEFTR 77 100 134 144 2-B, smooth muscle isoform FTDEEVDELYR 67 20 32 MTND 1,2-dihydroxy-3-keto-5-methy Q99JT9 21509.6/5.31 14 89 175 AQPDRPVSLEQLR 25 100 41 54 lthiopentene dioxygenase LDADKYENDPELEK 53 107 116 SORCN sorcin Q6P069 21613.3/5.32 12 52 370 QHFISFDSDR 98 100 154 165 ITFDDYIACCVK 67 57 76 CLTQSGIAGGYKPFNLETCR 91 55 64 FRIH Ferritin heavy chain P09528 21053.3/5.53 13 61 280 YFLHQSHEER 31 100 11 23 QNYHQDAEAAINR 99 55 69 YFLHQSHEEREHAEK 26 66 73 FRIL1 Ferritin light chain 1 P29391 20789.5/5.66 13 67 373 LLEFQNDR 57 100 106 121 NLNQALLDLHALGSAR 68 154 VAGPQPAQTGAPQGSLGEYLFE 98 R177 32 44 KAD1 Adenylate kinase isoenzyme 1 Q9R0Y5 21526.1/5.67 10 59 264 YGYTHLSTGDLLR 76 100 84 97 VDSSNGFLIDGYPR 68 150 167 LETYYNATEPVISFYDKR 27 86 100 CPNS1 Calpain small subunit 1 O88456 28444.9/5.41 10 50 401 SHYSNIEANESEEVR 115 100 2 218 236 YADESGNMDFDNFISCLVR 70 62 ILGGVISAISEAAAQYNPEPPPP 114 R85 19 26 OSTF1 Osteoclast stimulating factor 1 Q62422 23767.9/5.46 6 38 205 TDGFGIDTCR 34 100 120 138 DIVEVLFTQPNVELNQQNK 54 58 TGLIPSNYVAEQAESIDNPLHEA 72 AK83 102 113 SERB Phosphoserine phosphatase Q99LS3 25079.8/5.81 14 57 311 NVQVFLISGGFR 74 100 123 134 LNIPTTNVFANR 57 79 92 LLAEHPPHLTPGIR 39 216 226 PRDX4 Peroxiredoxin 4 peroxidase O08807 31033.1/6.67 10 49 303 QITLNDLPVGR 50 100 204 215 GLFIIDDKGVLR 52 190 203 DYGVYLEDSGHTLR 86 51 69 ENECHFYAGGQVYPGEASR 37 66 81 RFA2 Replication protein A 32 kDa Q62193 29699.6/5.76 8 40 100 IGDVEISQVTIVGIIR 27 100 subunit 242 251 TBB3 Tubulin beta-3 chain Q9ERD7 50386.2/4.82 11 28 300 FPGQLNADLR 92 100 104 121 GHYTEGAELVDSVLDVVR 129 138 150 GBB4 Guanine nucleotide-binding P29387.4 37355.0/5.74 3 6 125 ELPGHTGYLSCCR 115 protein subunit beta-4 201 208 ANXA8 Annexin A8 O35640 36819.6/5.56 17 63 518 FITILCTR 55 100 253 261 NVHSYFAER 61 158 167 ILVCLLQGSR 54 92 101 TPM3 Tropomyosin alpha-3 chain P21107 32842.8.4.68 12 32 223 IQLVEEELDR 91 100 92 105 IQLVEEELDRAQER 62 309 324 ODPB Pyruvate dehydrogenase E1 Q9D051 38912.0/6.41 10 36 124 IMEGPAFNFLDAPAVR 33 100 component subunit beta, mitochondrial precursor 157 171 PGK1 Phosphoglycerate kinase 1 P09411 44522.0/8.02 8 30 68 LGDVYVNDAFGTAHR 27 99.733 143 151 HNRPC Heterogeneous nuclear Q9Z204 34363.9/4.92 9 39 175 VPPPPPIAR 48 100 51 61 ribonucleoproteins C1/C2 GFAFVQYVNER 43 74 89 MIAGQVLDINLAAEPK 36 3 277 284 ADK Adenosine kinase P55264 40123.5/5.84 18 43 304 TVIFTQGR 31 100 338 348 AGHYAASVIIR 59 350 361 TGCTFPEKPDFH 47 66 79 ERG19 Diphosphomevalonate Q99JF5.2 44044.5/5.89 14 42 134 IWLNGREEDVGQPR 31 100 decarboxylase 152 160 TADBP TAR DNA-binding protein-43 Q921F2 44519.3/6.26 9 24 221 IWLNGREEDVGQPR 23 100 228 238 AFAFVTFADDK 40 276 293 FGGNPGGFGNQGGFGNSR 117 146 154 PAI1 Plasminogen activator P22777.1 45141.2/6.17 21 53 446 QVDFSEVER 42 100 200 210 inhibitor-1 precursor TPFLEASTHQR 80 42 53 VFQQVVQASKDR 56 112 124 NEISTADAIFVQR 73 407 422 DNPEP Aspartyl aminopeptidase Q9Z2W0 52133.7/6.66 9 23 65 NDSPCGTTIGPILASR 21 99.492 HNRH1 Heterogeneous nuclear O35737 49168.4/5.89 12 41 88 üü99.997 ribonucleoprotein H 2ABA Serine/threonine protein Q6P1F6 51659.5/5.82 10 23 66 üü99.597 phosphatase 2A, 55 kDa regulatory subunit B, alpha isoform *TCPB T-complex protein 1 P80314 57441.1/5.97 14 43 115 üü100 207 224 *IMDH1 Inosine-5'-monophosphate P50096 55259.4/6.29 13 36 112 GKLPIVNDQDELVAIIAR 26 100 dehydrogenase 1 349 357 ALDH2 Aldehyde dehydrogenase, P47738 52259.3/6.17 15 33 348 VVGNPFDSR 55 100 397 409 mitochondrial precursor GYFIQPTVFGDVK 46 162 174 TIPIDGDFFSYTR 79 327 340 TFVQENVYDEFVER 70 462 469 SERA D-3-phosphoglycerate Q61753 56549.11/6.12 19 33 293 GQPLLVFR 43 100 237 247 dehydrogenase GGIVDEGALLR 37 365 380 NAGTCLSPAVIVGLLR 68 167 175 G6PD1 Glucose-6-phosphate Q00612 59224.8/6.06 23 43 399 IIVEKPFGR 35 100 4 247 257 1-dehydrogenase X GGYFDEFGIIR 34 475 487 EKPQPIPYVYGSR 55 58 72 DGLLPEDTFIVGYAR 97 128 142 LKHA4 Leukotriene A-4 hydrolase P24527 68977.1/5.98 25 39 239 DGLLPEDTFIVGYAR 22 100 281 289 FUBP1 Far upstream element binding Q91WJ8 68497.0/7.74 21 44 370 DGLLPEDTFIVGYAR 51 100 427 436 protein 1 IAQITGPPDR 49 268 280 IGGNEGIDVPIPR 40 328 340 CQHAAEIITDLLR 67 92 102 EFTU Elongation factor Tu, Q8BFR5 49477.0/7.23 21 59 656 YEEIDNAPEER 91 100 239 252 mitochondrial precursor LLDAVDTYIPVPTR 105 105 120 GITINAAHVEYSTAAR 109 253 271 DLDKPFLLPVESVYSIPGR 173 a) Gene names of differentially expressed proteins were also labelled in the corresponding spots in Fig. S1A. b) Number of unique peptides matched to mass peaks. c) Protein scores were taken from MS+MS/MS database search results using GPS ExplorerTM software (version 3.6). In this program, a mascot score >54 was considered significant (p< 0.05). d) MS/MS scores were the ion scores taken from the MS/MS peptide spectra search results using GPS ExplorerTM software (Version 3.6). e) Protein score C.I. percent was based on the MS and MS/MS spectra search. # represents the same protein identified from the different spots in 2D-gels. * represents the protein mixture of the same spot. 5 Table S3. Protein expression levels and biological function Ratio of protein Gene Protein name expression levels Biological Function name (0h:12h:24h:48h) MYL3 Myosin light chain 3 1:2.99:3.27:5.16 cardiac muscle contraction COTL1 Coactosin-like protein 1:1.29:1.49:5.02 defence response to fungi HINT1 Histidine triad 1.87:1.62:1.42:1 signal transduction nucleotide-binding protein 1 #MLRB Myosin regulatory light 1:1.04:1.25:1.61 regulation of muscle contraction chain 2-B, smooth muscle isoform #MLRB Myosin regulatory light 1.12:1:1.50:1.42 regulation of muscle contraction chain 2-B, smooth muscle isoform MTND 1,2-dihydroxy-3-keto-5-me 2.87:2.55:1.52:1 amino acid metabolic process thylthiopentene dioxygenase SORCN sorcin 1.01:1:1.32:1.50 signal transduction FRIH Ferritin heavy chain 2.77:1.36:1:1.07 homeostatic process FRIL1 Ferritin light chain 1 2.46:1.72:1.81:1 homeostatic process KAD1 Adenylate kinase 1:1.42:3.15:7.57 nucleotide kinase activity isoenzyme 1 CPNS1 Calpain small subunit 1 1:1.11:1.45:1.76 regulation of cell proliferation OSTF1 Osteoclast stimulating 1:1.21:1.35:1.65 signal transduction factor 1 SERB Phosphoserine phosphatase 1.80:1.40:1.79:1 amino acid metabolic process PRDX4 Peroxiredoxin 4 peroxidase1.67:1.32:1.57:1 signal transduction RFA2 Replication protein A 32 2.47:2.21:2.49:1 DNA metabolic process kDa subunit TBB3 Tubulin beta-3 chain 1:1.07:1.40:1.27 cytoskeleton organization and biogenesis GBB4 Guanine 1:1.04:1.34:1.69 signal transduction nucleotide-binding protein subunit beta-4 ANXA8 Annexin A8 1:1.13:1.83:2.70 mRNA metabolic process TPM3 Tropomyosin alpha-3 chain 1.98:2.82:3.32:1 cell motion ODPB Pyruvate dehydrogenase 1:1.70:1.94:2.55 coenzyme metabolic process E1 component subunit beta, mitochondrial precursor 6 PGK1 Phosphoglycerate kinase 1 1.73:1.53:1.65:1 carbohydrate metabolic process HNRPC Heterogeneous nuclear 1:1.62:1.36:2.50 RNA metabolic process ribonucleoproteins C1/C2 ADK Adenosine kinase 1:1.16:1.34:1.88 nucleoside metabolic process ERG19 Diphosphomevalonate 1.97:1.66:1.43:1 cellular lipid metabolic process decarboxylase TADBP TAR DNA-binding 0:1.04:1.01:1 RNA biosynthetic process protein-43 PAI1 Plasminogen activator 1:3.21:3.26:5.27 hemostasis,blood coagulation inhibitor-1 precursor DNPEP Aspartyl aminopeptidase 1:1.01:3.45:5.47 peptide metabolic process HNRH1 Heterogeneous nuclear 1.32:1:1.65:1.72 RNA metabolic process ribonucleoprotein H 2ABA Serine/threonine protein 1:1.19:1.55:1.81 cellular protein metabolic process phosphatase 2A, 55 kDa regulatory subunit B, alpha isoform *TCPB T-complex protein 1 1.86:1.99:1.20:1 cellular protein metabolic process *IMDH1 Inosine-5'-monophosphate 1.86:1.99:1.20:1 IMP dehydrogenase activity dehydrogenase 1 ALDH2 Aldehyde dehydrogenase, 1.64:1.48:1:1.75 carbohydrate metabolic process mitochondrial precursor SERA D-3-phosphoglycerate 2.84:3.00: 2.37:1 brain development dehydrogenase G6PD1 Glucose-6-phosphate 1.43:1.51:1.23:1 glucose metabolic process 1-dehydrogenase X LKHA4 Leukotriene A-4 hydrolase 1.03:1:1.20:1.51 inflammatory response FUBP1 Far upstream element 2.93:1.77:1:2.34 RNA biosynthetic process binding protein 1 EFTU Elongation factor Tu, 1.42:1.11:1.11:1 translational elongation mitochondrial precursor # represents the same protein identified from the different spots in 2D-gels.
Load more

Recommended publications
  • Nucleotide Sequence and Analysis of the 58.3 to 65.5-Kb Early Region of Bacteriophage T4
    Volume 14 Number 21 1986 Nucleic Acids Research Nucleotide sequence and analysis of the 58.3 to 65.5-kb early region of bacteriophage T4 Kristoffer Valerie 13.4, John Stevens', Mark Lynch'5, Earl E.Henderson12 and Jon K.de Riel1 'Fels Research Institute, and 2Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140, USA and 3Department of Biochemistry and Biotechnology, Royal Institute of Technology, S-100 44 Stockholm, Sweden Received 21 July 1986; Revised and Accepted 30 September 1986 ABSTRACT The complete 7.2-kb nucleotide sequence from the 58.3 to 65.5-kb early region of bacteriophage T4 has been determined by Maxam and Gilbert sequencing. Computer analysis revealed at least 20 open reading frames (ORFs) within this sequence. All major ORFs are transcribed from the left strand, suggesting that they are expressed early during infection. Among the ORFs, we have identified the pIIII, II, denV and tk genes. The ORFs are very tightly spaced, even over Lapping in some instances, and when ORF interspacing occurs, promoter-like sequences can be implicated. Several of the sequences preceding the ORFs, in particular those at ipIII, ipII, denV, and orf6l.9, can potentially form stable stem-loop structures. INTRODUCTION Recently, considerable progress has been made studying the bacteriophage T4 genome at the molecular level due to the development of T4 strains with unmod- ified DNA suitable for digestion with restriction endonucleases (1). Many T4 genes have since been cloned, sequenced, and their gene products overproduced in Escherichia coli (for review see ref. 2). A majority of the T4 genes studied so far have been essential and non-essential genes with well-characterized pheno- types.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Electrophoretic Variation in Adenylate Kinase Ofneisseria
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 10535-10539, November 1995 Genetics Electrophoretic variation in adenylate kinase of Neisseria meningitidis is due to inter- and intraspecies recombination (natural transformation/linkage disequilibrium/mosaic genes/multilocus enzyme electrophoresis/nonclonal population structure) EDWARD FEIL, GILL CARPENTER, AND BRIAN G. SPRATT* Molecular Microbiology Group, School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, United Kingdom Communicated by John Maynard Smith, University of Sussex, Falmer, Brighton, United Kingdom, August 7, 1995 ABSTRACT In prokaryotic and eukaryotic organisms, their growth cycles and the availability of this mechanism of the electrophoretic variation in housekeeping enzymes from genetic exchange appears to have a profound effect on their natural populations is assumed to have arisen by the accu- evolution and population biology (3, 13-17). mulation of stochastic predominantly neutral mutations. In Caugant et al. (18) carried out an extensive MLEE survey of the naturally transformable bacterium Neisseria meningitidis, meningococci, analyzing variation at 15 enzyme loci in 688 we show that variation in the electrophoretic mobility of isolates recovered predominantly from patients with invasive adenylate kinase is due to inter- and intraspecies recombina- disease. Although the results from this survey appeared to tion rather than mutation. The nucleotide sequences of the imply relatively high levels of linkage disequilibrium, it has adenylate kinase gene (adk) from isolates that express the been pointed out (3, 17) that artificially high levels of linkage predominant slow electrophoretic variant were rather uni- disequilibrium may result from sampling bias, in this case form, differing in sequence at an average of 1.1% of nucleotide through the disproportionately high frequency in the data set sites.
    [Show full text]
  • B Number Gene Name Mrna Intensity Mrna
    sample) total list predicted B number Gene name assignment mRNA present mRNA intensity Gene description Protein detected - Membrane protein membrane sample detected (total list) Proteins detected - Functional category # of tryptic peptides # of tryptic peptides # of tryptic peptides detected (membrane b0002 thrA 13624 P 39 P 18 P(m) 2 aspartokinase I, homoserine dehydrogenase I Metabolism of small molecules b0003 thrB 6781 P 9 P 3 0 homoserine kinase Metabolism of small molecules b0004 thrC 15039 P 18 P 10 0 threonine synthase Metabolism of small molecules b0008 talB 20561 P 20 P 13 0 transaldolase B Metabolism of small molecules chaperone Hsp70; DNA biosynthesis; autoregulated heat shock b0014 dnaK 13283 P 32 P 23 0 proteins Cell processes b0015 dnaJ 4492 P 13 P 4 P(m) 1 chaperone with DnaK; heat shock protein Cell processes b0029 lytB 1331 P 16 P 2 0 control of stringent response; involved in penicillin tolerance Global functions b0032 carA 9312 P 14 P 8 0 carbamoyl-phosphate synthetase, glutamine (small) subunit Metabolism of small molecules b0033 carB 7656 P 48 P 17 0 carbamoyl-phosphate synthase large subunit Metabolism of small molecules b0048 folA 1588 P 7 P 1 0 dihydrofolate reductase type I; trimethoprim resistance Metabolism of small molecules peptidyl-prolyl cis-trans isomerase (PPIase), involved in maturation of b0053 surA 3825 P 19 P 4 P(m) 1 GenProt outer membrane proteins (1st module) Cell processes b0054 imp 2737 P 42 P 5 P(m) 5 GenProt organic solvent tolerance Cell processes b0071 leuD 4770 P 10 P 9 0 isopropylmalate
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Blueprint Genetics ADK Single Gene Test
    ADK single gene test Test code: S02595 Phenotype information Hypermethioninemia due to adenosine kinase deficiency Alternative gene names AK Panels that include the ADK gene Comprehensive Metabolism Panel Organic Acidemia/Aciduria & Cobalamin Deficiency Panel Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this test’) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations This test does not detect the following: Complex inversions Gene conversions Balanced translocations Mitochondrial DNA variants Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above non-coding variants covered by the test). This test may not reliably detect the following: Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Indels larger than 50bp Single exon deletions or duplications https://blueprintgenetics.com/ Variants within pseudogene regions/duplicated segments The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
    [Show full text]
  • The Metabolic Building Blocks of a Minimal Cell Supplementary
    The metabolic building blocks of a minimal cell Mariana Reyes-Prieto, Rosario Gil, Mercè Llabrés, Pere Palmer and Andrés Moya Supplementary material. Table S1. List of enzymes and reactions modified from Gabaldon et. al. (2007). n.i.: non identified. E.C. Name Reaction Gil et. al. 2004 Glass et. al. 2006 number 2.7.1.69 phosphotransferase system glc + pep → g6p + pyr PTS MG041, 069, 429 5.3.1.9 glucose-6-phosphate isomerase g6p ↔ f6p PGI MG111 2.7.1.11 6-phosphofructokinase f6p + atp → fbp + adp PFK MG215 4.1.2.13 fructose-1,6-bisphosphate aldolase fbp ↔ gdp + dhp FBA MG023 5.3.1.1 triose-phosphate isomerase gdp ↔ dhp TPI MG431 glyceraldehyde-3-phosphate gdp + nad + p ↔ bpg + 1.2.1.12 GAP MG301 dehydrogenase nadh 2.7.2.3 phosphoglycerate kinase bpg + adp ↔ 3pg + atp PGK MG300 5.4.2.1 phosphoglycerate mutase 3pg ↔ 2pg GPM MG430 4.2.1.11 enolase 2pg ↔ pep ENO MG407 2.7.1.40 pyruvate kinase pep + adp → pyr + atp PYK MG216 1.1.1.27 lactate dehydrogenase pyr + nadh ↔ lac + nad LDH MG460 1.1.1.94 sn-glycerol-3-phosphate dehydrogenase dhp + nadh → g3p + nad GPS n.i. 2.3.1.15 sn-glycerol-3-phosphate acyltransferase g3p + pal → mag PLSb n.i. 2.3.1.51 1-acyl-sn-glycerol-3-phosphate mag + pal → dag PLSc MG212 acyltransferase 2.7.7.41 phosphatidate cytidyltransferase dag + ctp → cdp-dag + pp CDS MG437 cdp-dag + ser → pser + 2.7.8.8 phosphatidylserine synthase PSS n.i. cmp 4.1.1.65 phosphatidylserine decarboxylase pser → peta PSD n.i.
    [Show full text]
  • The Target Landscape of N4-Hydroxycytidine Based on Its Chemical Neighborhood Jordi Mestres*
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.30.016485; this version posted April 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The target landscape of N4-hydroxycytidine based on its chemical neighborhood Jordi Mestres* Research Group on Systems Pharmacology, Research Program on Biomedical Informatics (GRIB), IMIM Hospital del Mar Medical Research Institute and University Pompeu Fabra, Parc de Recerca Biomedica (PRBB), Doctor Aiguader 88, 08003 Barcelona, Catalonia, Spain; and Chemotargets SL, Parc Cientific de Barcelona (PCB), Baldiri Reixac 4, 08028 Barcelona, Catalonia, Spain Abstract N4-hydroxycytidine (NHC) has been recently reported to have promising antiviral activity against SARS-CoV-2. To join worldwide efforts in identifying potential drug targets against this pandemic, the target landscape of NHC was defined by extracting all known targets of its chemical neighborhood, including drugs, analogues, and metabolites, and by performing target predictions from two independent platforms, following the recent Public Health Assessment via Structural Evaluation (PHASE) protocol. The analysis provides a list of over 30 protein targets that could be useful in future design activities of new COVID-19 antivirals. The relevance for existing drugs within the same chemical space, such as remdesivir, is also discussed. * Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.03.30.016485; this version posted April 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • NIPRO Enzymes
    Thermostable Enzymes for Clinical Chemistry NIPRO Enzymes From Zymomonas mobilis ALCOHOL DEHYDROGENASE (ZM-ADH) GLUCOKINASE (ZM-GlcK) GLUCOSE-6-PHOSPHATE DEHYDROGENASE (ZM-G6PDH) From Bacillus stearothermophilus ACETATE KINASE (AK) ADENYLATE KINASE (AdK) ALANINE DEHYDROGENASE (AlaDH) ALANINE RACEMASE (AlaR) DIAPHORASE Ⅰ [EC 1.6.99.-] (Di-1) GLUCOKINASE (GlcK) α-GLUCOSIDASE (α-Glu) LEUCINE DEHYDROGENASE (LeuDH) PHOSPHOFRUCTOKINASE (PFK) PHOSPHOGLUCOSE ISOMERASE (PGI) PHOSPHOTRANSACETYLASE (PTA) POLYNUCLEOTIDE PHOSPHORYLASE (PNPase) PYRUVATE KINASE (PK) SUPEROXIDE DISMUTASE (SOD) From Others DIAPHORASE22 (Di-22) GALACTOSE DEHYDROGENASE (GalDH) GLUCOKINASE2 (GlcK2) GLUCOSE DEHYDROGENASE (GlcDH2) D-LACTATE DEHYDROGENASE (D-LDH) MALATE DEHYDROGENASE (MDH) MUTAROTASE (MRO) PHENYLALANINE DEHYDROGENASE (PheDH) 6-PHOSPHOGLUCONATE DEHYDROGENASE (6PGDH) SORBITOL DEHYDROGENASE (SorDH) ご照会は下記へお願い申し上げます。 For more information, please contact ニプロ株式会社 NIPRO CORPORATION 本 社/〒531-8510 大阪市北区本庄西3丁目9番3号 3-9-3,Honjo-Nishi,Kita-ku Tel (06)6373-3168 Osaka 531-8510 Japan Phone +81 6 6373 3168 e-mail : [email protected] Fax +81 6 6373 8978 http://www.nipro.co.jp/ja/ Bacillus stearothermophilus is used as a synonym of Geobacillus stearothermophilus . 2016.04 Ｑｕａｌｉｔｙ The Quality Management System of Uji Factory, NIPRO Corp. has been certified as to meet the requirements of ISO9001 in the scope of The Development and Production of Enzymes for Analytical Reagents and Industrial Use by JAPAN CHEMICAL QUALITY ASSURANCE LTD. ISO9001 ニプロ株式会社 国内事業部 宇治工場 NIPRO ENZYMES ALCOHOL DEHYDROGENASE (ZM-ADH) [EC 1 .1 .1 .1] from Zymomonas mobilis Alcohol + NAD+ ↔ Aldehyde + NADH + H+ SPECIFICATION State : Lyophilized Specific activity : more than 400 U/mg protein Contaminants : (as ZM-ADH activity = 100 %) Glucose-6-phosphate dehydrogenase < 0.10 % Glucokinase < 0.02 % Pyruvate kinase < 0.02 % NADH oxidase < 0.01 % Lactate dehydrogenase < 0.01 % PROPERTIES Molecular weight : ca.
    [Show full text]
  • Dynamic Epigenetic Regulation of Glioblastoma Tumorigenicity Through
    Dynamic epigenetic regulation of glioblastoma PNAS PLUS tumorigenicity through LSD1 modulation of MYC expression David Kozonoa,1, Jie Lib,1, Masayuki Nittaa, Oltea Sampetreanc, David Gondab, Deepa S. Kushwahaa, Dmitry Merzona, Valya Ramakrishnanb, Shan Zhua, Kaya Zhua, Hiroko Matsuid, Olivier Harismendyd, Wei Huae, Ying Maoe, Chang-Hyuk Kwonf, Hideyuki Sayac, Ichiro Nakanof, Donald P. Pizzog, Scott R. VandenBergg, and Clark C. Chenb,2 aDepartment of Radiation Oncology, Dana-Farber Cancer Institute, Boston, MA 02215; bDivision of Neurosurgery, University of California, San Diego, La Jolla, CA 92093; cDivision of Gene Regulation, Keio University School of Medicine, Tokyo 160-8582, Japan; dDepartment of Pediatrics and Rady Children’s Hospital, University of California, San Diego, La Jolla, CA 92093; eDepartment of Neurosurgery, Huashan Hospital, Fudan University, Shanghai 200040, China; fDepartment of Neurological Surgery, Ohio State University Medical Center, Columbus, OH 43210; and gDepartment of Pathology, University of California, San Diego, La Jolla, CA 92037 Edited by William A Weiss, University of California, San Francisco, CA, and accepted by the Editorial Board June 15, 2015 (received for review January 29, 2015) The available evidence suggests that the lethality of glioblastoma is glioblastoma cells into a stem-like state, including avian myelo- driven by small subpopulations of cells that self-renew and exhibit cytomatosis viral oncogene homolog (MYC) (11), oligodendrocyte tumorigenicity. It remains unclear whether tumorigenicity exists as lineage transcription factor 2 (OLIG2), SRY (sex determining a static property of a few cells or as a dynamically acquired prop- region Y)-box 2 (SOX2), and POU class 3 homeobox 2 (POU3F2) erty. We used tumor-sphere and xenograft formation as assays for (12).
    [Show full text]
  • PRODUCTS and SERVICES Target List
    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ～ClariCELL™ ～ Targets P.18 Detection of Protein-Protein Interactions ～ProbeX™～ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ～Premium～ P.20-21 FastLane™ Structures ～Standard～ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1～3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
    [Show full text]
  • Adenosine Kinase Inhibition Selectively Promotes Rodent and Porcine Islet Β-Cell Replication
    Adenosine kinase inhibition selectively promotes rodent and porcine islet β-cell replication Justin P. Annesa,b, Jennifer Hyoje Ryua, Kelvin Lama, Peter J. Carolana,c, Katrina Utza, Jennifer Hollister-Lockd, Anthony C. Arvanitesa, Lee L. Rubina, Gordon Weird, and Douglas A. Meltona,e,1 aDepartment of Stem Cell and Regenerative Biology, Harvard Stem Cell Institute, Cambridge, MA 02138; bDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; cDivision of Gastroenterology, Department of Medicine, Massachusetts General Hospital, Boston, MA 02114; dSection of Islet Cell and Regenerative Biology, Joslin Diabetes Center, Department of Medicine, Harvard Medical School, Boston, MA 02115; and eHoward Hughes Medical Institute, Harvard University, Cambridge, MA 02138 Contributed by Douglas A. Melton, January 21, 2012 (sent for review October 1, 2011) Diabetes is a pathological condition characterized by relative insulin with the intent of finding compounds for the treatment of T2DM deficiency, persistent hyperglycemia, and, consequently, diffuse (27). Unfortunately, this study did not identify compounds with micro- and macrovascular disease. One therapeutic strategy is to β-cell-selective replication-promoting activity. Therefore, it is likely amplify insulin-secretion capacity by increasing the number of the that these molecular targets have an unacceptable risk profile for insulin-producing β cells without triggering a generalized prolifera- use in vivo. One explanation for why only nonspecific mitogenic tive response. Here, we present the development of a small-molecule compounds were found is that the screen was performed on a re- screening platform for the identification of molecules that increase versibly transformed cell line that may no longer retain metabolic β characteristics of primary β cells.
    [Show full text]