DOCSLIB.ORG

Roles of Snrk1, ADK, and APT1 in the Cellular Stress Response and Antiviral Defense

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Roles of Snrk1, ADK, and APT1 in the Cellular Stress Response and Antiviral Defense Roles of SnRK1, ADK, and APT1 in the Cellular Stress Response and Antiviral Defense Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Gireesha T. Mohannath, M.S. Plant Cellular and Molecular Biology Graduate Program The Ohio State University 2010 Dissertation Committee: Dr. David M. Bisaro, Advisor Dr. Erich Grotewold Dr. Venkat Gopalan Dr. Jyan-Chyun Jang Copyright by Gireesha T. Mohannath 2010 ABSTRACT Members of the SNF1/AMPK/SnRK1 family of kinases are highly conserved. Representatives include SNF1 kinase (sucrose non-fermenting 1) in yeast, SnRK1 (SNF1-related kinase 1) in plants, and AMPK (AMP-activated protein kinase) in animals. These Ser/Thr kinases play a central role in the regulation of metabolism. In response to nutritional and environmental stresses that deplete ATP, they turn off energy-consuming biosynthetic pathways and turn on alternative ATP-generating systems as part of the cellular stress response (CSR). However, the mechanisms that activate these enzyme complexes are not completely understood. These kinases function as heterotrimeric complexes. The catalytic subunit consists of an N-terminal kinase domain with an activation loop that contains a conserved threonine residue which must be phosphorylated for activity. Following phosphorylation by upstream kinase(s), 5'-AMP is known to allosterically stimulate AMPK activity and to inhibit its inactivation due to dephosphorylation of subunit at Thr172 by protein phosphatase 2C (PP2C). Direct allosteric stimulation of the SnRK1 complex by 5'-AMP has yet to be demonstrated. However, 5'-AMP has been shown to suppress dephosphorylation of SnRK1 by PP2C. Adenosine kinase (ADK) phosphorylates adenosine to 5'-AMP. ADK and SnRK1 play key roles in antiviral defense, and geminivirus AL2 and L2 proteins inactivate both ii kinases. Because ADK generates 5'-AMP that is known to activate CSR, this study hypothesizes that ADK contributes to rapid activation of the CSR. In support of this hypothesis, we showed that ADK and SnRK1 form a complex in vivo. This study also demonstrates an increase in SnRK1 activity in transgenic Arabidopsis plants over-expressing ADK, and a 4-6 fold in vitro stimulation of ADK by SnRK1. Interestingly, ADK stimulation does not require SnRK1 kinase activity. We conclude that SnRK1 and ADK mutually stimulate each other to rapidly activate CSR. SnRK1 phosphorylates ADK in vitro, and we speculate that this phosphorylation might be playing a role in negative regulation of the SnRK1-ADK complex. Adenine phosphoribosyl transferase 1 (APT1) also generates 5'-AMP. We hypothesize that APT1 might also play a role in activating CSR. In vitro and in vivo data is presented in this thesis to demonstrate interaction between SnRK1 and APT1. Also, SnRK1 is shown to phosphorylate APT1 in vitro. We speculate that SnRK1, ADK, and APT1 might form a ternary complex that could play critical roles in detecting and responding to cellular stress. We also show that four different geminivirus proteins, AL2, L2, AV2, and C1 interact with SnRK1, ADK, and APT1, and discuss the possible consequences of these interactions. Finally, we hypothesize that, as an antiviral defense, SnRK1 might play a role in regulating protein synthesis, and in support of this idea we observed phosphorylation of translation initiation factors eIF-2 and eIF-(iso)4E by SnRK1 in vitro. Future experiments have been proposed to confirm this hypothesis. iii Taken together, the findings from this study further our understanding on the potential roles of SnRK1, in conjunction with ADK and APT1, in sensing and mediating responses to various kinds of biotic and abiotic stresses. iv Dedicated to my family and teachers v ACKNOWLEDGEMENTS Mathrudevobhava, Pithrudevobhava, and Gurudevobhava, (The mother, the father, and the teacher to be revered as God) I begin my acknowledgements by expressing the deepest gratitude to my advisor, Dr. David Bisaro, for his support, critical comments, and the invaluable knowledge I received from him during my tenure in his lab. I will be forever grateful to him for encouraging me to be innovative and exploratory. He greatly helped me to become a better scientist. I am sincerely grateful to my committee members Drs. Erich Grotewold, Venkat Gopalan and J.C. Jang for their time, unwavering support, guidance and advice. I have been fortunate to have these accomplished scientists as my committee members as their input into my research was very useful and has been highly valued. From bottom of my heart I thank my current and former lab colleagues Dr. Kenn Buckley, Dr. Cody Buchmann, Dr. Priya Raja, and Jamie Wolf, for their consistent moral and technical support throughout my tenure in the lab. Specifically, I cannot forget the technical help and advice I received from Drs. Buckley and Buchmann during my early days as a graduate student. I am immensely thankful to Veena Patil (my wife), Dr. Youn Lee, and Allie Varner for helping me in my project. I highly value their contributions to my projects. I would also like to acknowledge the other current and past members of the Bisaro lab who have been helpful in various ways: Xiaojuan Yang, Dr. vi Hui Wang, Dr. Lin Hui, Dr. Shaheen Asad, Dr. Mohammed Mubeen, Isaac Heard, Sizhun Lee, Jeff Ostler, Brad Sanville, and other undergraduate students. Definitely I won‘t forget the help and the various constructive conversations I had with students, postdocs, and faculty members from different departments especially from Molecular Genetics/Plant Cellular and Molecular Biology (PCMB). I am also thankful to current PCMB staff: Eduardo Acosta, Rene Reese, Laurel Shannon, and Joan Leonard for their help. A special acknowledgement to Dr. Biao Ding for his permission to use his confocal and fluorescent microscopes. Also, my sincere thanks to the staff of the biotechnology center: Melinda Parker, Diane Furtney, Dave Long, Scott Hines, Joe Takayama and MCDB secretary, Jan Zinich for all of their help, and I offer my sincere acknowledgements to ABRC for their Arabidopsis mutants and DNA clones. I owe a great debt of gratitude to all of my family members: My mother, father, brother, sister, and their family members for their kind and compassionate support throughout my career. Without their support I wound not have made it U.S. for my education. Although for my efforts I am the only person who receives Ph.D., my wife is an exemplary partner in all of my efforts and I share with her whatever I receive. It would have been impossible to pursue my doctoral studies but for my wife‘s moral support, tolerance, understanding, and help. Many of my teachers, friends and relatives, in conjunction with my family, gave me the strength to propel myself forward through the most difficult and trying times of my graduate career. I don‘t know how I would have managed without their support. vii I am extremely grateful to PCMB and CLSE for funding me every quarter throughout my Ph.D. years by employing me as a graduate teaching associate. I think because of their support I became a better teacher and received ‗Molecular Genetics Teaching Award‘. Finally, I bow with reverence to The Ohio State University. Go Bucks! viii VITA 1993 – 1997………………. B.S., Agricultural Sciences, UAS, Dharwad, India 1997 – 1999………………. M.S., Genetics & Plant Breeding, UAS, Bangalore, India 1999 – 2003………………. Research Associate, UAS, Bangalore, India 2003 – present……………... Graduate Teaching and Research Associate, the Ohio State University. (UAS: University of Agricultural Sciences) PUBLICATIONS Research Publications: 1. Buchmann, R.C., Asad, S., Wolf, J.N., Mohannath, G., and Bisaro, D.M. (2009). Geminivirus AL2 and L2 proteins suppress transcriptional gene silencing and cause genome-wide reductions in cytosine methylation. J. Virol. 83(10): 5005-5013) (featured in the “Spotlight” section of the journal) 2. Girish, T.N., Gireesha, T.M. Vaishali, M.G., Hanamareddy, B.G., and Hittalmani, S. (2006). Response of a new IR50/Moroberekan recombinant inbred population of rice (Oryza sativa L.) from an indica x japonica cross for growth and yield traits under aerobic conditions. Euphytica 152: 149-161. 3. Nadaradjan, S., Gireesha, T. M., Sheshashayee, M. S., Shankar, A. G., Prasad, T. G., and Udayakumar, M. (2003). Progress in genetic polymorphism studies via molecular markers in groundnut (Arachis hypogaea L.) - A review. J. Plant Biol. 30 (3): 285 – 292. ix 4. Toorchi, M., Shashidhar, H.E., Gireesha, T.M., and Hittalmani, S. (2003). Performance of backcross transgressant doubled haploid lines of rice under contrasting moisture regimes: Yield components and Marker heterozygosity. Crop Science 43:1448-1456. 5. Toorchi, M., Shashidhar, H.E., Hittalmani, S., and Gireesha, T.M. (2002). Rice root morphology under contrasting moisture regimes and contribution of molecular marker heterozygosity. Euphytica 126(2): 251-257. 6. Gireesha, T. M., Shashidhar, H. E., and Hittalmani, S. (2000), Genetics of root morphology and related traits in an indica-indica based mapping populations of rice (Oryza sativa L.). Res. on Crops 1(2): 208-215. FIELDS OF STUDY Major Field: Plant Cellular and Molecular Biology x TABLE OF CONTENTS Abstract ..................................................................... ……………………………………..ii Dedication ............................................................................................................................v Acknowledgements .........................................................................................................
Load more

Recommended publications
  • Nucleotide Sequence and Analysis of the 58.3 to 65.5-Kb Early Region of Bacteriophage T4
    Volume 14 Number 21 1986 Nucleic Acids Research Nucleotide sequence and analysis of the 58.3 to 65.5-kb early region of bacteriophage T4 Kristoffer Valerie 13.4, John Stevens', Mark Lynch'5, Earl E.Henderson12 and Jon K.de Riel1 'Fels Research Institute, and 2Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140, USA and 3Department of Biochemistry and Biotechnology, Royal Institute of Technology, S-100 44 Stockholm, Sweden Received 21 July 1986; Revised and Accepted 30 September 1986 ABSTRACT The complete 7.2-kb nucleotide sequence from the 58.3 to 65.5-kb early region of bacteriophage T4 has been determined by Maxam and Gilbert sequencing. Computer analysis revealed at least 20 open reading frames (ORFs) within this sequence. All major ORFs are transcribed from the left strand, suggesting that they are expressed early during infection. Among the ORFs, we have identified the pIIII, II, denV and tk genes. The ORFs are very tightly spaced, even over Lapping in some instances, and when ORF interspacing occurs, promoter-like sequences can be implicated. Several of the sequences preceding the ORFs, in particular those at ipIII, ipII, denV, and orf6l.9, can potentially form stable stem-loop structures. INTRODUCTION Recently, considerable progress has been made studying the bacteriophage T4 genome at the molecular level due to the development of T4 strains with unmod- ified DNA suitable for digestion with restriction endonucleases (1). Many T4 genes have since been cloned, sequenced, and their gene products overproduced in Escherichia coli (for review see ref. 2). A majority of the T4 genes studied so far have been essential and non-essential genes with well-characterized pheno- types.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • (LRV1) Pathogenicity Factor
    Antiviral screening identifies adenosine analogs PNAS PLUS targeting the endogenous dsRNA Leishmania RNA virus 1 (LRV1) pathogenicity factor F. Matthew Kuhlmanna,b, John I. Robinsona, Gregory R. Bluemlingc, Catherine Ronetd, Nicolas Faseld, and Stephen M. Beverleya,1 aDepartment of Molecular Microbiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bDepartment of Medicine, Division of Infectious Diseases, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; cEmory Institute for Drug Development, Emory University, Atlanta, GA 30329; and dDepartment of Biochemistry, University of Lausanne, 1066 Lausanne, Switzerland Contributed by Stephen M. Beverley, December 19, 2016 (sent for review November 21, 2016; reviewed by Buddy Ullman and C. C. Wang) + + The endogenous double-stranded RNA (dsRNA) virus Leishmaniavirus macrophages infected in vitro with LRV1 L. guyanensis or LRV2 (LRV1) has been implicated as a pathogenicity factor for leishmaniasis Leishmania aethiopica release higher levels of cytokines, which are in rodent models and human disease, and associated with drug-treat- dependent on Toll-like receptor 3 (7, 10). Recently, methods for ment failures in Leishmania braziliensis and Leishmania guyanensis systematically eliminating LRV1 by RNA interference have been − infections. Thus, methods targeting LRV1 could have therapeutic ben- developed, enabling the generation of isogenic LRV1 lines and efit. Here we screened a panel of antivirals for parasite and LRV1 allowing the extension of the LRV1-dependent virulence paradigm inhibition, focusing on nucleoside analogs to capitalize on the highly to L. braziliensis (12). active salvage pathways of Leishmania, which are purine auxo- A key question is the relevancy of the studies carried out in trophs.
    [Show full text]
  • Electrophoretic Variation in Adenylate Kinase Ofneisseria
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 10535-10539, November 1995 Genetics Electrophoretic variation in adenylate kinase of Neisseria meningitidis is due to inter- and intraspecies recombination (natural transformation/linkage disequilibrium/mosaic genes/multilocus enzyme electrophoresis/nonclonal population structure) EDWARD FEIL, GILL CARPENTER, AND BRIAN G. SPRATT* Molecular Microbiology Group, School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, United Kingdom Communicated by John Maynard Smith, University of Sussex, Falmer, Brighton, United Kingdom, August 7, 1995 ABSTRACT In prokaryotic and eukaryotic organisms, their growth cycles and the availability of this mechanism of the electrophoretic variation in housekeeping enzymes from genetic exchange appears to have a profound effect on their natural populations is assumed to have arisen by the accu- evolution and population biology (3, 13-17). mulation of stochastic predominantly neutral mutations. In Caugant et al. (18) carried out an extensive MLEE survey of the naturally transformable bacterium Neisseria meningitidis, meningococci, analyzing variation at 15 enzyme loci in 688 we show that variation in the electrophoretic mobility of isolates recovered predominantly from patients with invasive adenylate kinase is due to inter- and intraspecies recombina- disease. Although the results from this survey appeared to tion rather than mutation. The nucleotide sequences of the imply relatively high levels of linkage disequilibrium, it has adenylate kinase gene (adk) from isolates that express the been pointed out (3, 17) that artificially high levels of linkage predominant slow electrophoretic variant were rather uni- disequilibrium may result from sampling bias, in this case form, differing in sequence at an average of 1.1% of nucleotide through the disproportionately high frequency in the data set sites.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • B Number Gene Name Mrna Intensity Mrna
    sample) total list predicted B number Gene name assignment mRNA present mRNA intensity Gene description Protein detected - Membrane protein membrane sample detected (total list) Proteins detected - Functional category # of tryptic peptides # of tryptic peptides # of tryptic peptides detected (membrane b0002 thrA 13624 P 39 P 18 P(m) 2 aspartokinase I, homoserine dehydrogenase I Metabolism of small molecules b0003 thrB 6781 P 9 P 3 0 homoserine kinase Metabolism of small molecules b0004 thrC 15039 P 18 P 10 0 threonine synthase Metabolism of small molecules b0008 talB 20561 P 20 P 13 0 transaldolase B Metabolism of small molecules chaperone Hsp70; DNA biosynthesis; autoregulated heat shock b0014 dnaK 13283 P 32 P 23 0 proteins Cell processes b0015 dnaJ 4492 P 13 P 4 P(m) 1 chaperone with DnaK; heat shock protein Cell processes b0029 lytB 1331 P 16 P 2 0 control of stringent response; involved in penicillin tolerance Global functions b0032 carA 9312 P 14 P 8 0 carbamoyl-phosphate synthetase, glutamine (small) subunit Metabolism of small molecules b0033 carB 7656 P 48 P 17 0 carbamoyl-phosphate synthase large subunit Metabolism of small molecules b0048 folA 1588 P 7 P 1 0 dihydrofolate reductase type I; trimethoprim resistance Metabolism of small molecules peptidyl-prolyl cis-trans isomerase (PPIase), involved in maturation of b0053 surA 3825 P 19 P 4 P(m) 1 GenProt outer membrane proteins (1st module) Cell processes b0054 imp 2737 P 42 P 5 P(m) 5 GenProt organic solvent tolerance Cell processes b0071 leuD 4770 P 10 P 9 0 isopropylmalate
    [Show full text]
  • Recombinant Human Adenosine Kinase/ADK
    Recombinant Human Adenosine Kinase/ADK Catalog Number: 8024-AK DESCRIPTION Source E. coli­derived Ala2­His362 with a C­terminal 6­His tag Accession # P55263 N­terminal Sequence Ala2 Analysis Predicted Molecular 41 kDa Mass SPECIFICATIONS SDS­PAGE 43­45 kDa, reducing conditions Activity Measured by its ability to phosphorylate Adenosine. The specific activity is >7 pmol/min/μg, as measured under the described conditions. Endotoxin Level <1.0 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS­PAGE under reducing conditions and visualized by Colloidal Coomassie® Blue stain at 5 μg per lane. Formulation Supplied as a 0.2 μm filtered solution in Tris and NaCl. See Certificate of Analysis for details. Activity Assay Protocol Materials l Assay Buffer: (10X) 250 mM HEPES, 1.5 M NaCl, 100 mM MgCl2, 100 mM CaCl2 pH 7.0 (supplied in kit) l Recombinant Human Adenosine Kinase/ADK (Catalog # 8024­AK) l Adenosine (Sigma, Catalog # A9251), 10 mM stock in deionized water l Adenosine triphosphate (ATP) (Sigma, Catalog # A7699), 10 mM stock in deionized water l Universal Kinase Activity Kit (Catalog # EA004) l 96­well Clear Plate (Costar, Catalog # 92592) l Plate Reader (Model: SpectraMax Plus by Molecular Devices) or equivalent Assay 1. Prepare 1X Assay Buffer by diluting 10X Assay Buffer in deionized water. 2. Dilute 1 mM Phosphate Standard provided by the Universal Kinase Activity Kit by adding 40 µL of the 1 mM Phosphate Standard to 360 µL of 1X Assay Buffer for a 100 µM stock. 3. Prepare standard curve by performing seven one­half serial dilutions of the 100 µM Phosphate stock in 1X Assay Buffer.
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Blueprint Genetics ADK Single Gene Test
    ADK single gene test Test code: S02595 Phenotype information Hypermethioninemia due to adenosine kinase deficiency Alternative gene names AK Panels that include the ADK gene Comprehensive Metabolism Panel Organic Acidemia/Aciduria & Cobalamin Deficiency Panel Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this test’) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations This test does not detect the following: Complex inversions Gene conversions Balanced translocations Mitochondrial DNA variants Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above non-coding variants covered by the test). This test may not reliably detect the following: Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Indels larger than 50bp Single exon deletions or duplications https://blueprintgenetics.com/ Variants within pseudogene regions/duplicated segments The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
    [Show full text]
  • Focus on the A3 Adenosine Receptor
    JOURNAL OF CELLULAR PHYSIOLOGY 186:19±23 (2001) Differential Effect of Adenosine on Tumor and Normal Cell Growth: Focus on the A3 Adenosine Receptor GIL OHANA, SARA BAR-YEHUDA, FAINA BARER, AND PNINA FISHMAN* Laboratory of Clinical and Tumor Immunology, The Felsenstein Medical Research Center, Tel-Aviv University, Rabin Medical Center, Petach-Tikva, Israel Adenosine is an ubiquitous nucleoside present in all body cells. It is released from metabolically active or stressed cells and subsequently acts as a regulatory mole- cule through binding to speci®c A1, A2A,A2B and A3 cell surface receptors. The synthesis of agonists and antagonists to the adenosine receptors and their cloning enabled the exploration of their physiological functions. As nearly all cells express speci®c adenosine receptors, adenosine serves as a physiological regulator and acts as a cardioprotector, neuroprotector, chemoprotector, and as an immuno- modulator. At the cellular level, activation of the receptors by adenosine initiates signal transduction mechanisms through G-protein associated receptors. Adeno- sine's unique characteristic is to differentially modulate normal and transformed cell growth, depending upon its extracellular concentration, the expression of adenosine cell surface receptors, and the physiological state of the target cell. Stimulation of cell proliferation following incubation with adenosine has been demonstrated in a variety of normal cells in the range of low micromolar con- centrations, including mesangial and thymocyte cells, Swiss mouse 3T3 ®bro- blasts, and bone marrow cells. Induction of apoptosis in tumor or normal cells was shown at higher adenosine concentrations (>100 mM) such as in leukemia HL-60, lymphoma U-937, A431 epidermoid cells, and GH3 tumor pituitary cell lines.
    [Show full text]
  • A Novel Adenosine Kinase from Bombyx Mori: Enzymatic Activity, Structure, and Biological Function
    International Journal of Molecular Sciences Article A Novel Adenosine Kinase from Bombyx mori: Enzymatic Activity, Structure, and Biological Function Kai Song 1, Yu Li 1, Huawei He 1,2,3,* , Lina Liu 1, Ping Zhao 1,3, Qingyou Xia 1,3 and Yejing Wang 2,* 1 State Key Laboratory of Silkworm Genome Biology, Biological Science Research Center, Southwest University, Beibei, Chongqing 400715, China 2 College of Biotechnology, Southwest University, Beibei, Chongqing 400715, China 3 Chongqing Key Laboratory of Sericultural Science, Chongqing Engineering and Technology Research Center for Novel Silk Materials, Southwest University, Beibei, Chongqing 400715, China * Correspondence: [email protected] (H.H.); [email protected] (Y.W.); Tel.: +86-23-6825-1575 (H.H. & Y.W.) Received: 6 July 2019; Accepted: 29 July 2019; Published: 31 July 2019 Abstract: Adenosine kinase (ADK) is the first enzyme in the adenosine remediation pathway that catalyzes adenosine phosphorylation into adenosine monophosphate, thus regulating adenosine homeostasis in cells. To obtain new insights into ADK from Bombyx mori (BmADK), we obtained recombinant BmADK, and analyzed its activity, structure, and function. Gel-filtration showed BmADK was a monomer with molecular weight of approximately 38 kDa. Circular dichroism spectra indicated BmADK had 36.8% α-helix and 29.9% β-strand structures, respectively. The structure of BmADK was stable in pH 5.0–11.0, and not affected under 30 ◦C. The melting temperature and the enthalpy and entropy changes in the thermal transition of BmADK were 46.51 0.50 C, 253.43 0.20 KJ/mol, ± ◦ ± and 0.79 0.01 KJ/(mol K), respectively.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,689,046 B2 Mayall Et Al
    USOO9689046B2 (12) United States Patent (10) Patent No.: US 9,689,046 B2 Mayall et al. (45) Date of Patent: Jun. 27, 2017 (54) SYSTEM AND METHODS FOR THE FOREIGN PATENT DOCUMENTS DETECTION OF MULTIPLE CHEMICAL WO O125472 A1 4/2001 COMPOUNDS WO O169245 A2 9, 2001 (71) Applicants: Robert Matthew Mayall, Calgary (CA); Emily Candice Hicks, Calgary OTHER PUBLICATIONS (CA); Margaret Mary-Flora Bebeselea, A. et al., “Electrochemical Degradation and Determina Renaud-Young, Calgary (CA); David tion of 4-Nitrophenol Using Multiple Pulsed Amperometry at Christopher Lloyd, Calgary (CA); Lisa Graphite Based Electrodes', Chem. Bull. “Politehnica” Univ. Kara Oberding, Calgary (CA); Iain (Timisoara), vol. 53(67), 1-2, 2008. Fraser Scotney George, Calgary (CA) Ben-Yoav. H. et al., “A whole cell electrochemical biosensor for water genotoxicity bio-detection”. Electrochimica Acta, 2009, 54(25), 6113-6118. (72) Inventors: Robert Matthew Mayall, Calgary Biran, I. et al., “On-line monitoring of gene expression'. Microbi (CA); Emily Candice Hicks, Calgary ology (Reading, England), 1999, 145 (Pt 8), 2129-2133. (CA); Margaret Mary-Flora Da Silva, P.S. et al., “Electrochemical Behavior of Hydroquinone Renaud-Young, Calgary (CA); David and Catechol at a Silsesquioxane-Modified Carbon Paste Elec trode'. J. Braz. Chem. Soc., vol. 24, No. 4, 695-699, 2013. Christopher Lloyd, Calgary (CA); Lisa Enache, T. A. & Oliveira-Brett, A. M., "Phenol and Para-Substituted Kara Oberding, Calgary (CA); Iain Phenols Electrochemical Oxidation Pathways”, Journal of Fraser Scotney George, Calgary (CA) Electroanalytical Chemistry, 2011, 1-35. Etesami, M. et al., “Electrooxidation of hydroquinone on simply prepared Au-Pt bimetallic nanoparticles'. Science China, Chem (73) Assignee: FREDSENSE TECHNOLOGIES istry, vol.
    [Show full text]