1 Genetic Disruption of Adenosine Kinase in Mouse Pancreatic Β-Cells

Home , Adenosine kinase, ADK (gene)

Page 1 of 32 Diabetes

Genetic Disruption of Adenosine Kinase in Mouse Pancreatic βCells Protects Against High Fat

DietInduced Glucose Intolerance

Running Title: ADK negatively regulates βcell expansion

Guadalupe Navarro1, Yassan Abdolazami1, Zhengshan Zhao1, Haixia Xu1,2, Sooyeon Lee1, Neali A.

Armstrong1, Justin P. Annes1*

1Department of Medicine and Division of Endocrinology, Stanford University, Stanford, CA, USA.

2 Department of Endocrinology and Metabolism, Third Affiliated Hospital of Sun YatSen University,

Guangzhou, People's Republic of China.

*Corresponding Author:

Justin P. Annes Stanford University School of Medicine Division of Endocrinology and Metabolism CCSR 2255A 1291 Welsh Road Stanford CA, 94305

Phone: 6507361572 Fax: 6507213161 Email: [email protected]

Abstract Word count: 200

Main Text Word Count: 3980

Diabetes Publish Ahead of Print, published online May 3, 2017 Diabetes Page 2 of 32

ABSTRACT

Islet βcells adapt to insulin resistance through increased insulin secretion and expansion. Type 2 diabetes

(T2D) typically occurs when prolonged insulin resistance exceeds the adaptive capacity of βcells. Our prior screening efforts led to the discovery that Adenosine kinase (ADK) inhibitors stimulate βcell replication. Here evaluated whether ADK disruption in mouse βcells impacts βcell mass and/or protects against high fat diet (HFD)induced glucose dysregulation. Mice targeted at the Adk locus were bred to

RipCre and Ins1Cre/ERT1Lphi mice to enable constitutive (βADKO) and conditional (iβADKO) disruption of ADK expression in βcells, respectively. Weight gain, glucose tolerance, insulin sensitivity and glucose stimulated insulin secretion (GSIS) were longitudinally monitored in normal chow (NC)fed and HFDfed mice. Additionally, βcell mass and replication were measured by immunofluorescence based islet morphometry. NCfed adult βADKO and iβADKO mice displayed glucose tolerance, insulin tolerance and βcell mass comparable to control animals. By contrast, HFDfed βADKO and iβADKO animals had improved glucose tolerance and increased in vivo glucosestimulated insulin secretion.

Improved glucose handling was associated with increased βcell replication and mass. We conclude that

ADK expression negatively regulates the adaptive βcell response to HFD challenge. Therefore, modulation of ADK activity is a potential strategy for enhancing the adaptive βcell response.

Page 3 of 32 Diabetes

Diabetes is a pathologic state of disrupted glucose homeostasis characterized by an absolute or relative

insulin deficiency and a loss of insulinproducing βcells. In type 2 diabetes (T2D), βcell failure results

from a multifactorial process initiated by insulin resistance, often in the setting of obesity (13). In T2D,

a variety of insults contribute to progressive βcell failure including endoplasmic reticulum stress,

inflammatory cytokines, excess reactive oxygen species and glycolipid toxicity (2). βcell loss occurs

through a combination of increased apoptosis and dedifferentiation, though the relative contribution of

these outcomes remains unclear (36). Presently, a major research goal is to understand the molecular

mechanisms of βcell failure and devise strategies to reverse this process.

Although T2D is accompanied by reduced insulin secretion in late disease, increased insulin secretion is

an early adaptation to insulin resistance (7; 8). Interestingly, nondiabetic individuals with high genetic

risk for diabetes have a reduced glucosestimulated insulin response (9). It is unclear whether this is a

consequence of defective βcell function or deficient βcell mass; T2Dassociated risk alleles implicate

genes participating in both processes, e.g. CDKN2A and KCNQ1 (1012). Murine studies demonstrate a

central role for βcell mass plasticity in the accommodation of obesityassociated insulin resistance (13).

Although adaptive βcell expansion is less evident in humans, nondiabetic obese humans have a 1.5fold

increase in βcell mass and increased βcell number (14). Hence, it is possible that human βcell mass

exhibits modest plasticity that influences an individual’s susceptibility to developing T2D (15).

In mature animals, numerous potential sources of new βcells have been identified (16); however, the

usual source of new βcells is previously existing βcells (17; 18). Consequently, understanding the

signals that control selfduplication are critical to understanding how βcell mass is controlled. To identify

molecular mechanisms that regulate βcell growth we developed a primaryisletcellbased small

Diabetes Page 4 of 32

molecule screening platform (19; 20). Using this platform, we uncovered the βcell replicationpromoting activity of Adenosine Kinase inhibitors (ADKI’s). ADK is a broadly expressed metabolic enzyme that controls extracellular and intracellular adenosine pools via its enzymatic activity: conversion of adenosine to 5’adenosinemonophosphate (AMP) (21). Several lines of evidence indicate that ADKI’s promote β cell replication, in part, via ADK inhibition: multiple structurally dissimilar ADKI’s promote βcell replication, ADKdirected RNAi triggered cellautonomous βcell replication and an independent screen for βcell regenerationpromoting compounds identified distinct ADKI’s (19; 22). Notably, additional activities of some ADKI’s contribute to their βcell replication promoting activity. For example, 5IT was shown to promote human βcell replication through inhibition of the dualspecificity tyrosine phosphorylationregulated kinase 1A (DYRK1A) (2325). To investigate the function of ADK in βcells we generated mice conditionally targeted at the ADK locus. Using these mice we tested the hypothesis that ADK acts as a negative regulator of βcell replication and limits the adaptive response of βcells to diabetogenic challenge.

Page 5 of 32 Diabetes

RESEARCH DESIGN AND METHODS

Generation, Genotyping and Feeding of ADKTargeted Mice

All animal work was approved and carried out in accordance with our institutional animal care and use

committee and the Guide for the care and use of laboratory animals (2011). Adk targeted mice were

generated from IKMC clone EUCE0154a03 (26). Genotyping of ADKtargeted mice was performed by

PCR: wildtype allele (ADK_F (5'AGCCTAGACTACACAACAAG3') and ADK_R (5'

GCTCAATCACCTAGATGGCC3')); Adktargeted allele (ADK1) (ADK_F and B32 (5'

CAAGGCGATTAAGTTGGGTAACG3’)); nonmutagenic orientation (ADK2; Fig. 1a) (B32 and

ADK_6898 (5’TCAAGCCCTTTGTACACCCTAAG3’)). The FLP deleter strain (FLPo10, Jax

011065) was used to convert Adk1 to ADK2. Two Cre–expressing strains were used for constitutive

(Tg(Ins2Cre)25Mgn; JAX 0035731) and conditional (Ins1cre/ERT1Lphi; JAX 024709) recombination. For

Cre/ERT activation, tamoxifen (Cayman Chemical, #13258,100mg/kg) was dissolved in 100% ethanol,

solubilized in sterile warm corn oil ([10 mg/mL], Sigma C8267) and administered by i.p. injection on four

consecutive days. βgalactosidase activity was used to confirm efficient tamoxifeninduced

recombination. One week after tamoxifen injection, pancreata were excised and fixed (4% PFA/PBS at 4

°C for 30 minutes), washed with PBS and placed in 30% sucrose/PBS for 48h at 4 °C before freezing in

O.C.T (Tissue Tek). Animals were fed normal chow (NC; Harlan Teklad 2018) or high fat diet (HFD;

Research Diets D12492) as indicated. Experiments were conducted with female mice unless stated

otherwise. Mice are mixed background (129P2/OlaHsd and C57BL/6J).

Western Blotting

Diabetes Page 6 of 32

Isolated islets and homogenized liver tissue lysates were used for SDSPAGE (RIPA Lysis System, sc

24948). Isletrestricted ADK disruption was assessed using liver and islet lysates from adult βADKO and control animals. Islets were isolated as previously described (20). AntiADK (1:200, sc32908) and anti enolase (1:500, sc15343) were used for protein detection.

Glucose Physiology Experiments

All glucose physiology experiments were performed on age and gendermatched cohorts. Glucose measurements were made at the indicated times with a TRUEresult glucometer and TRUEtest strips. For fasting glucose measurement and i.p. glucose tolerance testing (ipGTT), mice were weighed and fasted overnight (14 hours, 6pm8am). Glucose levels were obtained at 0 minutes, prior to i.p. glucose (1.5 to

2.0 grams/kg, 10 µl/gram) injection, and at the subsequent indicated time points. Random glucose levels were obtained on fed mice at 10 am. IpITT was performed using 0.51.5 U/kg Humulin (Eli Lilly, R100) as indicated after four hour fast starting at 8 am. In vivo GSIS was measured in blood collected from overnight fasted mice at time 0 and after i.p. injection of glucose (3 g/kg). Insulin was measured with

Alpco Mouse Ultrasensitive Insulin ELISA kits (80INSMSUE01). ADK2/+ RipCre animals displayed no detectable phenotype and were included with ADK+/+ RipCre as control animals

Histology

Tissue βgalactosidase staining was performed on fresh frozen 25 µm frozen sections that were fixed for 5 minutes with cold 4% paraformaldehyde in PBS and washed in cold PBS. Slides were incubated in Xgal staining solution (PBS with potassium ferricyanide [5mM] (Sigma, P8131), potassium ferricyanide trihydrate [5mM] (Sigma, P3289), magnesium chloride [2mM] and Xgal 20 mg/100 mL (Promega)) at

370 Celsius. Slides were counterstained as indicated. Antigen retrieval was performed by heating slides to

Page 7 of 32 Diabetes

900 Celsius for 10 minutes in 10mM sodium citrate (pH6.0) solution. Primary antibodies were incubated

overnight at 4 degrees Celsius. To measure islet size distribution, pancreatic sections were insulin (Dako

A0564, 1:300) or glucagon (Dako A0565,1:1000) stained along with DAPI. Affinity purified secondary

antibodies (donkey) were obtained from Jackson ImmunoResearch (1:300). Entire sections (8 per mouse)

were scanned using an Inverted Nikon Spinning Disk confocal microscope. Images were stitched together

and analyzed using Velocity 6 (PerkinElmer). Cellular clusters of >900 µm2 were counted. Total

pancreatic area was determined by the DAPI+ area. The βcell mass was calculated by multiplying

pancreatic mass by the percent of pancreatic area that is insulinpositive. βcell replication indices were

determined by 5Bromo2’deoxyuridine (BrdU) incorporation (Dako M0744018, 1:50) and/or ki67

expression (BD Bioscience 556003, 1:300); ki67 detection was performed using biotin amplification

(Jackson ImmunoResearch, 1:200). βcells were identified by the expression of insulin or PDX1 (R&D

AF2419; 1:200); use of insulin staining to confirm findings obtained with PDX1 is necessary given that

δcells also express PDX1 (27). A minimum of 2,000 βcells from nonconsecutive sections (>50 µM

apart) were used to determine the βcell replication rate for each animal. Replication events were

adjudicated in a blinded fashion. Mice were provided BrdUcontaining water (Acros 228590100,

0.8mg/mL) for one week in opaque bottles that were changed every two days.

In Vitro βcell replication

Islets were isolated from 36 week vehicle (n=4) and tamoxifeninjected (n=4) iβADK mice. Injections

were performed at age 18 weeks to avoid any developmental impact and islets were harvested after an 18

week delay to avoid potential shortterm tamoxifen and recombination effects. Islets were dispersed,

plated (allowed 60h to attach), treated (60 h duration), fixed and assayed (PDX1 and ki67 staining) as

previously described (19; 20).

Diabetes Page 8 of 32

Statistics

Experimental data are plotted as scatter plots with an adjacent representation of the statistical mean that includes an error bar representing the standard deviation. Statistically significant differences were determined using the student’s twotailed t test where p ≤ 0.5 was taken to be significant. Experimental results were confirmed in independent experimentation in all cases except for the in vivo βcell replication experiments.

Page 9 of 32 Diabetes

RESULTS

AdkTargeted Mouse Model.

To study the in vivo function of ADK in βcells, we generated mice conditionally targeted at the Adk locus

(Fig. 1A). The integrated mutagenic orientation (ADK1) placed a highly efficient spliceacceptor sequence

(SA) / βgeo expression cassette (βgalactosidaseneomycin resistance fusion gene) in frame with exons 1a

and 1b, the ADK transcriptional start sites, which encode ADKshort (cytoplasmic) and ADKlong

(nuclear) isoforms, respectively (28). βgalactosidase activity was used to assess ADKexpression in the

pancreas of Adk1/+ mice (Fig. 1B, left panels). ADK was highly expressed in the exocrine pancreas and

modestly expressed in the endocrine pancreas where the nuclearlocated isoform (ADKlong)

predominates. Newborn litters from heterozygous (Adk1/+ x Adk1/+) breeding pairs contained Adk1/+ pups at

Mendelian frequency. However, consistent with the published phenotype of ADKnull animals, no

ADK1/1 mice were identified at weaning (>150 mice screened) (29). Furthermore, ADK protein was

nearly undetectable in hepatocyte lysates from Adk1/1 newborn pups (Fig. 1C). These results indicated

efficient disruption of ADK expression by the targeting strategy.

We disrupted ADK expression in βcells (βADKO mice) using the RipCre driver strain (30). We

confirmed βcellrestricted disruption by measuring βgalactosidase activity in pancreatic tissue sections

from (1) mice harboring the genetrap vector in the nonmutagenic orientation (Adk2/+ mice), (2) RipCre

mice and (3) RipCre Adk2/+ mice (βADKOHet) (Fig. 1B). As anticipated, pancreatic sections from

Adk2/+ and RipCre animals lacked βgalactosidase activity whereas βADKOHet sections displayed βcell

restricted βgalactosidase activity. Notably, RipCre mice have recombination activity in the brain and

exhibit glucose intolerance (31; 32). Consequently, all studies included RipCre control animals. Next, we

assessed ADK disruption by Western blot of liver and islet lysates from RipCre, βADKOHet and

Diabetes Page 10 of 32

βADKO mice (Fig. 1D). Whereas hepatic ADK expression was similar among genotypes, islet ADK expression was reduced in βADKO animals. Residual ADK expression in islet samples might reflect exocrine and/or insulinnegative isletcell contamination. Taken together, these data indicate successful disruption of ADK expression in pancreatic βcells.

βADKO Mice Are Protected Against HFDInduced Glucose Intolerance.

Young βADKO animals were heavier than RipCre control littermates (Fig. 2A). At eight weeks of age, female βADKO mice weighed ~2g more than RipCre control animals (18.3±0.3 g vs.16.1±0.6 g, p<0.01). As mice aged the bodyweights of βADKO and RipCre mice converged; no statistical difference was present beyond 14 weeks (p>0.05). By 52 weeks, the body weights of RipCre (28.9+/1.4 g) and

βADKO (29.2+/1.5 g) were indistinguishable. HFDfed 13week βADKO and RipCre mice demonstrated increased weight gain compared to genotypematched NCfed mice beginning two weeks after HFD initiation (p<0.05 for weeks 1521; filled vs. open symbols). HFDinduced weight gain in Rip

Cre and βADKO mice was similar (Fig. 2B, p>0.05 at every time point). Thus, βADKO animals are transiently heavier than control animals but not predisposed to increased HFDinduced weight gain.

Next, we assessed the impact of βcelltargeted ADK disruption on glucose tolerance by performing ipGTTs every 48 weeks on NCfed RipCre and βADKO mice. No difference was observed until 52 weeks when subtle improvement in the ipGTT of βADKO mice emerged (Fig. 2C,D). To assess a potential protective role of ADK disruption against diabetogenic challenge, ipGTTs were performed on

RipCre and βADKO mice placed on a HFD. After only twoweeks of HFD, female βADKO mice displayed lower fasting glucose levels but similar glucose tolerance (Fig. 2E). Following sixweeks and

18weeks of HFD, female βADKO mice demonstrated substantial improvement in their ipGTT (Fig.

Page 11 of 32 Diabetes

2F,G). A similar improvement in ipGTT was also observed in HFDfed male βADKO mice (Fig. 2H).

Fasting and random fed glucose values were also significantly improved in HFDfed βADKO mice (Fig.

2,I,J). Thus, βADKO animals were resistant to HFDdependent impairment of glucose homeostasis.

HFDFed βADKO Mice Demonstrate Enhanced Insulin Sensitivity and Insulin Secretion.

To assess the physiologic basis of improved ipGTT in HFDfed βADKO mice we performed i.p. insulin

tolerance testing (ipITT; Fig. 3A,B). As anticipated, βADKO fasting glucose values were lower than

controls (154±19 vs. 214±34, p<0.01). Consequently, we compared glucose clearance by βADKO and

RipCre animals with (Fig. 3A) and without (Fig. 3B) normalizing to starting glucose values.

Interestingly, βADKO mice displayed more robust insulin responsiveness at 30 and 60 minutes after

insulin injection. However, the absolute drop in blood glucose levels in response to insulin was greater for

RipCre mice compared to βADKO mice (RipCre 156±29 vs. βADKO 124±18, p<0.05). These results

indicated that HFDfed βADKO mice had modestly enhanced insulin sensitivity but, given the subtlety of

this difference, other factors were likely contributing to the improved glucose tolerance of the βADKO

mice.

Next we evaluated whether enhanced insulin secretion contributed to the improved glucose tolerance of

βADKO mice by measuring glucosestimulated insulin secretion (GSIS) in NC and HFDfed RipCre

and βADKO mice (Fig. 3C). As anticipated HFDfed mice displayed increased insulin secretion relative

to NCfed mice. Interestingly, both NC and HFDfed βADKO mice displayed increased insulin secretion

compared to RipCre controls (Fig. 3C,D). The increased GSIS of NCfed mice was unexpected since no

difference in ipGTT was detected. However, this difference was subtle (NC AUC RipCre 8.1±2.1 vs.

Diabetes Page 12 of 32

βADKO 13.6±1.9, p<0.05) compared to HFDfed mice (HFD AUC RipCre 32.31±3.7. vs. βADKO

61.4±9.9, p<0.05).

βCell Expansion Protects βADKO Mice from HFDInduced Glucose Intolerance.

Islet isolations from HFDfed βADKO mice demonstrated increased yield (1.3±0.2fold; p<0.01) compared to RipCre mice (Fig. 4A). This observation led us to consider two potential explanations: (1)

HFDfed βADKO mice had more islets or (2) HFDfed βADKO mice had larger islets that were more efficiently isolated. To assess these possibilities, islet size and number were analyzed in pancreatic sections from HFDfed RipCre and βADKO animals. Visual inspection of insulinstained sections gave the impression that βADKO islets were enlarged (Fig. 4B). To quantitate this impression, we measured the insulinstained area. Consistent with visual observation, βADKO animals demonstrated a right shift in insulin cluster size (Fig. 4C). Additionally, the average insulinpositive cluster size was increased in

βADKO mice (average insulin area, βADKO 7,790±694µm2 vs. RipCre 3857±952µm2, p<0.01) (Fig.

4D). Furthermore, the insulinpositive area and βcell mass but not pancreatic area or pancreatic mass were increased in βADKO mice (Fig. 4EI). Notably, no increase in the number of insulinpositive clusters was detected (RipCre 6.34±1.9 vs. βADKO 7.6±0.4; p=0.4) (Fig. 4J). No change in alphacell area was detected (Fig. 4K) and βcell proliferation in HFDfed mice, as measured by BrdU incorporation, demonstrated a trend toward increase in the βADKO mice (Fig. 4L). Taken together, these results indicated that βcell expansion rather than increased islet number was present in HFDfed βADKO mice.

Page 13 of 32 Diabetes

Disruption of ADK Expression in Mature βCells Protects Against HFDInduced Hyperglycemia

and Promotes βCell Replication.

To mitigate deficiencies of the RipCre transgene, (Tg(Ins2Cre)25Mgn), we reevaluated our findings with

the inducible and βcell specific Creexpressing MipCre/ERT mouse line (Ins1cre/ERT1Lphi) (31; 32).

Because MipCre/ERT mice have tamoxifenindependent growth hormone expression, we used vehicle

treated iβADKO mice as control subjects (33).

We evaluated the impact of tamoxifeninduced βcell specific ADK disruption on glucose homeostasis

and βcell replication in mature animals (Fig. 5A). Tamoxifendependent disruption of ADKexpression

was confirmed by induction of βgalactosidase activity (Fig. 5B). Similar to NCfed βADKO mice, NC

fed vehicle and tamoxifentreated iβADKO mice demonstrated comparable ipGTTs (Fig 5C).

Consequently, tamoxifentreatment had no impact on the ipGTT. Also consistent with the βADKO

phenotype, HFDfed tamoxifentreated mice demonstrated significantly lower fed glucose values (Fig.

5D) and enhanced ipGTT following 3 weeks (Fig. 5E) and 11 weeks (Fig. 5F) of HFD. By contrast,

insulin sensitivity measured by ipITT was unchanged (Fig. 5G); perhaps indicating an impact of ectopic

recombinase activity in βADKO mice. Finally, we assessed whether disruption of ADK enhanced in vivo

GSIS. Indeed, tamoxifentreated mice demonstrated increased insulin secretion following glucose

challenge (15 minute vehicletreated 0.15±0.02 ng/mL vs. tamoxifentreated 0.24±0.04 ng/mL, p=0.01;

Fig. 5H). These data indicated that βcellspecific disruption of ADK in adult mice was protective against

HFDinduced glucose intolerance and enhanced GSIS in vivo.

Next, we assessed the impact of ADK disruption on mature βcell proliferation. To perform this analysis,

we determined the percentage of insulinpositive cells that coexpressed ki67 in vehicle and tamoxifen

Diabetes Page 14 of 32

treated mice fed either NC or HFD. Interestingly, loss of ADK expression had no effect on βcell replication in NCfed mice (% replication of vehicle 0.36±0.1vs. tamoxifen 0.50±0.10, p=0.38); however, ki67 expression was significantly increased in HFDfed tamoxifentreated mice (vehicle 1.59±0.10 vs. tamoxifen 2.70±0.32, p<0.05) (Fig. 5I). We confirmed this finding using distinct βcell (PDX1) and replication (BrdU incorporation) markers (vehicle 1.00±0.26 vs. tamoxifen 2.33±0.26, p<0.05)(Fig. 5J).

Representative images used to quantify βcell replication are shown (Fig. 5K). Finally, we compared the in vitro basal and compoundinduced replication index of βcells obtained from vehicle and tamoxifen injected iβADKO mice (Fig. 5L). Islet ADK deletion was confirmed by western blot (Fig. 5M). Notably,

ADKdeficient βcells (tamoxifeninjected) displayed increased basal replication compared to ADK expressing βcells (Fig. 5L). Additionally, ADKexpressing βcells displayed a ~twofold replication increase following treatment with 5IT (an ADK and DYRK1A/B inhibitor) (Fig.5L) (19; 20). Similarly,

5IT treatment of ADKdeficient βcells demonstrated a ~1.5fold increase in βcell replication.

Therefore, disruption of ADK expression in βcells increases the basal βcell replication index in vitro but does not eliminate 5ITdependet replication induction. These results indicate that ADK negatively regulates βcell replication in vitro and that the βcell replicationpromoting activity of 5IT is not mediated entirely via ADKinhibition.

Page 15 of 32 Diabetes

DISCUSSION

Identification of novel strategies to enhance in vivo βcell proliferation and mass while retaining optimum

function is an attractive therapeutic strategy for diabetes. Recently, we discovered that shortterm

treatment with ADKI’s stimulated rodent and porcine βcell replication (19). Herein, we used a novel

genetic mouse model to study the function of ADK in βcells and to contemplate the potential utility of

ADK inhibition. This study addressed two critical questions: (1) is longterm disruption of ADK

detrimental to βcell function? (2) Are mice lacking ADK expression in their βcells protected against

diabetogenic insults such as aging and HFD? Using two different mouse models, we found βcell

selective disruption of ADK expression to be well tolerated and protective against HFD challenge.

Is longterm disruption of ADK detrimental to βcell function? Currently available ADKI’s are not

amenable to longterm in vivo treatment because of associated toxicity (19; 34). Additionally, global

disruption of ADK expression results in perinatal lethality (29). These findings raise concern about

potential detrimental effects of ADK disruption on βcell viability and function. We found that ADK

expression in the islet was low relative to the exocrine pancreas and that disruption of ADK had limited

impact on βcell development, function and growth. NCfed mice lacking βcell expression of ADK,

either constitutively or acutely, displayed glucose homeostasis parameters similar to control mice with no

detectable difference in βcell replication or mass. Hence, disruption of ADK in βcells was well

tolerated.

Are βcells lacking ADK activity protected against diabetogenic insults such as aging and HFD?

Although NCfed ADKdeficient mice were essentially indistinguishable from control animals, a subtle

but consistent improvement in ipGTT emerged as animals aged beyond one year. To better gauge the

Diabetes Page 16 of 32

potential benefit of ADK disruption on glucose homeostasis, βADKO mice were challenged with a HFD.

Indeed, HFDfed mice harboring ADKdeficient βcells displayed significantly enhanced ipGTT, enhanced in vivo GSIS and increased βcell mass. No change in αcell mass was observed, indicating that the impact was cellautonomous and/or lineage specific. Additionally, we found no evidence for islet neogenesis as islet density (insulin clusters per section) was unchanged in HFDfed βADKO mice.

Although βADKO mice maintained on HFD for several months displayed increased βcell mass, active β cell replication was not significantly increased in these animals. By contrast, βcell replication was increased one week after conditional disruption of ADK expression. These observations are consistent with prior work demonstrating that βcell replication rates initially increase in response to HFD but decline with prolonged exposure (35). Interestingly, ADKdeficient βcells demonstrated an increased in vitro replication index compared to control βcells. Notably, the ADKI 5IT that promotes human βcell replication, in part through DYRK1A/B inhibition (25), further enhanced the replication of ADKdeficient

βcells; suggesting that inhibition of both ADK and DYRK1A/B contribute to rodent βcell replication control. In summary, disruption of ADK expression in βcells was protective against HFDinduced glucose intolerance in mice, in part as a result of an increased βcell replication response, βcell mass expansion and enhanced insulin secretion.

Numerous mouse models of βcell specific gene disruption yield altered βcell mass and/or glucose homeostasis (36). However, the vast majority of these models demonstrate an impact under basal conditions. Disruption of ADK expression in βcells is distinct in that essentially no phenotype was identified in unchallenged animals. These finding suggest that ADK plays a role in dampening the adaptive βcell response to metabolic challenge. Defining factors that specifically modulate the adaptive

βcell response is an important avenue for uncovering therapeutic strategies for T2D. Similar to ADK,

Page 17 of 32 Diabetes

Connective Tissue Growth Factor (CTGF) contributes to the adaptive response of βcells: overexpression

of CTGF in mature βcells has no impact on βcell proliferation but does enhance βcell expansion under

diabetogenic conditions (37). Similarly, βcellspecific deletion of the prolactin receptor has no impact on

βcell mass or function under basal conditions but predisposes female mice to gestational diabetes by

dampening the βcell replication response during pregnancy (38). Although the molecular links between

CTGF, prolactin signaling and ADK are not immediately obvious, these models highlight the potential to

therapeutically manipulate the adaptive response of βcells. Perhaps more relevant, βcellspecific

deletion of the adenosine receptor 2a (Adora2a) in mice was recently shown to impair glucose regulation

and βcell proliferation in pregnancy while having no impact on these parameters under basal conditions

(39); indicating a role for adenosine signaling in promoting the adaptive βcell response to an insulin

resistant state. Notably, a primary function of ADK is to reduce extracellular adenosine levels via

adenosine phosphorylation. Hence, disruption of ADK in βcells might promote an adaptive βcell

response in vivo by increasing extracellular adenosine levels and augmenting Adora2dependent

signaling.

There are notable limitations to our study. First, caution must be taken with use of the Ripcre and MIP

Cre/ERT transgenic lines (32; 33). Prior studies have shown detrimental effects of the RipCre cassette on

glucose tolerance and insulin secretion; findings opposite to what we observed in the βADKO mice.

Consequently, impacts of the RipCre line are anticipated to bias results away from the observed

protective effect of ADKdeletion on HFDinduced glucose intolerance. Additionally, complimentary

findings obtained with the constitutive and inducible Cre driver strains exclude developmental impacts

and ectopic gene deletion as the probable basis of the enhanced βcell replication, mass and function we

observed. Second, the applicability of our findings to human βcells is unknown as adult human βcells

Diabetes Page 18 of 32

have limited regenerative capacity (14; 40). Third, the potential applications of in vivo ADK inhibition may be limited by the function of ADK in other tissues such as the liver. Indeed, identifying methods for lineagerestricted drug delivery is likely to be a critical hurdle for developing regenerative therapies for diabetes. Future efforts will focus on better understanding the mechanism by which ADK disruption enhances the adaptive response of βcells to HFD challenge.

Page 19 of 32 Diabetes

Contribution statement GN conceived and designed experiments, performed experiments, analyzed data

and approved the final version of the manuscript, YA conceived and performed experiments, analyzed

data and assisted in writing of the manuscript, ZZ, HH and SL performed experiments, analyzed data and

approved the final version of the manuscript, NAA analyzed data and and assisted in writing of the

manuscript, JPA conceived and designed experiments, analyzed data and wrote the manuscript. JPA is the

guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for

the integrity of the data and the accuracy of the data analysis.

Acknowledgements We thank Fredric Kraemer, Chief of Endocrinology at Stanford University School of

Medicine, for his generous support of this work. We also thank Ms. Sara Sun (Stanford University) for

her technical contributions to this work. Funding This research was supported by the Friedenrich BII

Diabetes Fund, the SPARK Translational Research Program and by the Child Health Research Institute at

Stanford University (NIHNCATSCTSA grant UL1TR001085;NIH NIDDK R01DK101530.

Duality of interest The authors declare no duality of interest associated with their contributions to this

work.

Diabetes Page 20 of 32

References

1. Weir GC, Bonner-Weir S: Five stages of evolving beta-cell dysfunction during progression to diabetes. Diabetes 2004;53 Suppl 3:S16-21 2. Alejandro EU, Gregg B, Blandino-Rosano M, Cras-Meneur C, Bernal-Mizrachi E: Natural history of beta-cell adaptation and failure in type 2 diabetes. Molecular aspects of medicine 2015;42:19-41 3. Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC: Beta-cell deficit and increased beta- cell apoptosis in humans with type 2 diabetes. Diabetes 2003;52:102-110 4. Butler AE, Dhawan S, Hoang J, Cory M, Zeng K, Fritsch H, Meier JJ, Rizza RA, Butler PC: Beta-cell deficit in Obese Type 2 Diabetes, a Minor Role of Beta-cell Dedifferentiation and Degranulation. The Journal of clinical endocrinology and metabolism 2015:jc20153566 5. Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes. The Journal of biological chemistry 1999;274:14112-14121 6. Talchai C, Xuan S, Lin HV, Sussel L, Accili D: Pancreatic beta cell dedifferentiation as a mechanism of diabetic beta cell failure. Cell 2012;150:1223-1234 7. Polonsky KS, Given BD, Hirsch L, Shapiro ET, Tillil H, Beebe C, Galloway JA, Frank BH, Karrison T, Van Cauter E: Quantitative study of insulin secretion and clearance in normal and obese subjects. The Journal of clinical investigation 1988;81:435-441 8. Kulkarni RN, Jhala US, Winnay JN, Krajewski S, Montminy M, Kahn CR: PDX-1 haploinsufficiency limits the compensatory islet hyperplasia that occurs in response to insulin resistance. The Journal of clinical investigation 2004;114:828-836 9. Pimenta W, Korytkowski M, Mitrakou A, Jenssen T, Yki-Jarvinen H, Evron W, Dailey G, Gerich J: Pancreatic beta-cell dysfunction as the primary genetic lesion in NIDDM. Evidence from studies in normal glucose-tolerant individuals with a first-degree NIDDM relative. JAMA 1995;273:1855-1861 10. Gaulton KJ, Ferreira T, Lee Y, Raimondo A, Magi R, Reschen ME, Mahajan A, Locke A, Rayner NW, Robertson N, Scott RA, Prokopenko I, Scott LJ, Green T, Sparso T, Thuillier D, Yengo L, Grallert H, Wahl S, Franberg M, Strawbridge RJ, Kestler H, Chheda H, Eisele L, Gustafsson S, Steinthorsdottir V, Thorleifsson G, Qi L, Karssen LC, van Leeuwen EM, Willems SM, Li M, Chen H, Fuchsberger C, Kwan P, Ma C, Linderman M, Lu Y, Thomsen SK, Rundle JK, Beer NL, van de Bunt M, Chalisey A, Kang HM, Voight BF, Abecasis GR, Almgren P, Baldassarre D, Balkau B, Benediktsson R, Bluher M, Boeing H, Bonnycastle LL, Bottinger EP, Burtt NP, Carey J, Charpentier G, Chines PS, Cornelis MC, Couper DJ, Crenshaw AT, van Dam RM, Doney AS, Dorkhan M, Edkins S, Eriksson JG, Esko T, Eury E, Fadista J, Flannick J, Fontanillas P, Fox C, Franks PW, Gertow K, Gieger C, Gigante B, Gottesman O, Grant GB, Grarup N, Groves CJ, Hassinen M, Have CT, Herder C, Holmen OL, Hreidarsson AB, Humphries SE, Hunter DJ, Jackson AU, Jonsson A, Jorgensen ME, Jorgensen T, Kao WH, Kerrison ND, Kinnunen L, Klopp N, Kong A, Kovacs P, Kraft P, Kravic J, Langford C, Leander K, Liang L, Lichtner P, Lindgren CM, Lindholm E, Linneberg A, Liu CT, Lobbens S, Luan J, Lyssenko V, Mannisto S, McLeod O, Meyer J, Mihailov E, Mirza G, Muhleisen TW, Muller-Nurasyid M, Navarro C, Nothen MM, Oskolkov NN, Owen KR, Palli D, Pechlivanis S, Peltonen L, Perry JR, Platou CG, Roden M, Ruderfer D, Rybin D, van der Schouw YT, Sennblad B, Sigurethsson G, Stancakova A, Steinbach G, Storm P, Strauch K, Stringham HM, Sun Q, Thorand B, Tikkanen E, Tonjes A, Trakalo J, Tremoli E, Tuomi T, Wennauer R, Wiltshire S, Wood AR, Zeggini E, Dunham I, Birney E, Pasquali L, Ferrer J, Loos RJ, Dupuis J, Florez JC, Boerwinkle E, Pankow JS, van Duijn C, Sijbrands E, Meigs JB, Hu FB, Thorsteinsdottir U, Stefansson K, Lakka TA,

Page 21 of 32 Diabetes

Rauramaa R, Stumvoll M, Pedersen NL, Lind L, Keinanen-Kiukaanniemi SM, Korpi-Hyovalti E, Saaristo TE, Saltevo J, Kuusisto J, Laakso M, Metspalu A, Erbel R, Jocke KH, Moebus S, Ripatti S, Salomaa V, Ingelsson E, Boehm BO, Bergman RN, Collins FS, Mohlke KL, Koistinen H, Tuomilehto J, Hveem K, Njolstad I, Deloukas P, Donnelly PJ, Frayling TM, Hattersley AT, de Faire U, Hamsten A, Illig T, Peters A, Cauchi S, Sladek R, Froguel P, Hansen T, Pedersen O, Morris AD, Palmer CN, Kathiresan S, Melander O, Nilsson PM, Groop LC, Barroso I, Langenberg C, Wareham NJ, O'Callaghan CA, Gloyn AL, Altshuler D, Boehnke M, Teslovich TM, McCarthy MI, Morris AP: Genetic fine mapping and genomic annotation defines causal mechanisms at type 2 diabetes susceptibility loci. Nature genetics 2015;47:1415-1425 11. Porat S, Weinberg-Corem N, Tornovsky-Babaey S, Schyr-Ben-Haroush R, Hija A, Stolovich-Rain M, Dadon D, Granot Z, Ben-Hur V, White P, Girard CA, Karni R, Kaestner KH, Ashcroft FM, Magnuson MA, Saada A, Grimsby J, Glaser B, Dor Y: Control of pancreatic beta cell regeneration by glucose metabolism. Cell metabolism 2011;13:440-449 12. Helman A, Klochendler A, Azazmeh N, Gabai Y, Horwitz E, Anzi S, Swisa A, Condiotti R, Granit RZ, Nevo Y, Fixler Y, Shreibman D, Zamir A, Tornovsky-Babeay S, Dai C, Glaser B, Powers AC, Shapiro AM, Magnuson MA, Dor Y, Ben-Porath I: p16(Ink4a)-induced senescence of pancreatic beta cells enhances insulin secretion. Nature medicine 2016;22:412-420 13. Cox AR, Lam CJ, Rankin MM, King KA, Chen P, Martinez R, Li C, Kushner JA: Extreme obesity induces massive beta cell expansion in mice through self-renewal and does not alter the beta cell lineage. Diabetologia 2016; 14. Saisho Y, Butler AE, Manesso E, Elashoff D, Rizza RA, Butler PC: beta-cell mass and turnover in humans: effects of obesity and aging. Diabetes care 2013;36:111-117 15. Tyrberg B, Eizirik DL, Hellerstrom C, Pipeleers DG, Andersson A: Human pancreatic beta-cell deoxyribonucleic acid-synthesis in islet grafts decreases with increasing organ donor age but increases in response to glucose stimulation in vitro. Endocrinology 1996;137:5694-5699 16. Nichols RJ, New C, Annes JP: Adult tissue sources for new beta cells. Translational research : the journal of laboratory and clinical medicine 2014;163:418-431 17. Dor Y, Brown J, Martinez OI, Melton DA: Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation. Nature 2004;429:41-46 18. Meier JJ, Butler AE, Saisho Y, Monchamp T, Galasso R, Bhushan A, Rizza RA, Butler PC: Beta-cell replication is the primary mechanism subserving the postnatal expansion of beta-cell mass in humans. Diabetes 2008;57:1584-1594 19. Annes JP, Ryu JH, Lam K, Carolan PJ, Utz K, Hollister-Lock J, Arvanites AC, Rubin LL, Weir G, Melton DA: Adenosine kinase inhibition selectively promotes rodent and porcine islet beta-cell replication. Proceedings of the National Academy of Sciences of the United States of America 2012;109:3915-3920 20. Zhao Z, Low YS, Armstrong NA, Ryu JH, Sun SA, Arvanites AC, Hollister-Lock J, Shah NH, Weir GC, Annes JP: Repurposing cAMP-modulating medications to promote beta-cell replication. Molecular endocrinology (Baltimore, Md 2014;28:1682-1697 21. Park J, Gupta RS: Adenosine kinase and ribokinase--the RK family of proteins. Cell Mol Life Sci 2008;65:2875-2896 22. Andersson O, Adams BA, Yoo D, Ellis GC, Gut P, Anderson RM, German MS, Stainier DY: Adenosine signaling promotes regeneration of pancreatic beta cells in vivo. Cell metabolism 2012;15:885-894 23. Wang P, Alvarez-Perez JC, Felsenfeld DP, Liu H, Sivendran S, Bender A, Kumar A, Sanchez R, Scott DK, Garcia-Ocana A, Stewart AF: A high-throughput chemical screen reveals that harmine-mediated

Diabetes Page 22 of 32

inhibition of DYRK1A increases human pancreatic beta cell replication. Nature medicine 2015;21:383- 388 24. Litovchick L, Florens LA, Swanson SK, Washburn MP, DeCaprio JA: DYRK1A protein kinase promotes quiescence and senescence through DREAM complex assembly. Genes & development 2011;25:801-813 25. Dirice E, Walpita D, Vetere A, Meier BC, Kahraman S, Hu J, Dancik V, Burns SM, Gilbert TJ, Olson DE, Clemons PA, Kulkarni RN, Wagner BK: Inhibition of DYRK1A stimulates human beta-cell proliferation. Diabetes 2016; 26. Schnutgen F, De-Zolt S, Van Sloun P, Hollatz M, Floss T, Hansen J, Altschmied J, Seisenberger C, Ghyselinck NB, Ruiz P, Chambon P, Wurst W, von Melchner H: Genomewide production of multipurpose alleles for the functional analysis of the mouse genome. Proceedings of the National Academy of Sciences of the United States of America 2005;102:7221-7226 27. Serup P, Petersen HV, Pedersen EE, Edlund H, Leonard J, Petersen JS, Larsson LI, Madsen OD: The homeodomain protein IPF-1/STF-1 is expressed in a subset of islet cells and promotes rat insulin 1 gene expression dependent on an intact E1 helix-loop-helix factor binding site. The Biochemical journal 1995;310 ( Pt 3):997-1003 28. Cui XA, Singh B, Park J, Gupta RS: Subcellular localization of adenosine kinase in mammalian cells: The long isoform of AdK is localized in the nucleus. Biochemical and biophysical research communications 2009;388:46-50 29. Boison D, Scheurer L, Zumsteg V, Rulicke T, Litynski P, Fowler B, Brandner S, Mohler H: Neonatal hepatic steatosis by disruption of the adenosine kinase gene. Proceedings of the National Academy of Sciences of the United States of America 2002;99:6985-6990 30. Postic C, Shiota M, Niswender KD, Jetton TL, Chen Y, Moates JM, Shelton KD, Lindner J, Cherrington AD, Magnuson MA: Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. The Journal of biological chemistry 1999;274:305-315 31. Lee JY, Ristow M, Lin X, White MF, Magnuson MA, Hennighausen L: RIP-Cre revisited, evidence for impairments of pancreatic beta-cell function. The Journal of biological chemistry 2006;281:2649-2653 32. Wicksteed B, Brissova M, Yan W, Opland DM, Plank JL, Reinert RB, Dickson LM, Tamarina NA, Philipson LH, Shostak A, Bernal-Mizrachi E, Elghazi L, Roe MW, Labosky PA, Myers MG, Jr., Gannon M, Powers AC, Dempsey PJ: Conditional gene targeting in mouse pancreatic ss-Cells: analysis of ectopic Cre transgene expression in the brain. Diabetes 2010;59:3090-3098 33. Oropeza D, Jouvet N, Budry L, Campbell JE, Bouyakdan K, Lacombe J, Perron G, Bergeron V, Neuman JC, Brar HK, Fenske RJ, Meunier C, Sczelecki S, Kimple ME, Drucker DJ, Screaton RA, Poitout V, Ferron M, Alquier T, Estall JL: Phenotypic Characterization of MIP-CreERT1Lphi Mice With Transgene- Driven Islet Expression of Human Growth Hormone. Diabetes 2015;64:3798-3807 34. Boison D: Adenosine kinase: exploitation for therapeutic gain. Pharmacological reviews 2013;65:906-943 35. Mosser RE, Maulis MF, Moulle VS, Dunn JC, Carboneau BA, Arasi K, Pappan K, Poitout V, Gannon M: High-fat diet-induced beta-cell proliferation occurs prior to insulin resistance in C57Bl/6J male mice. American journal of physiology 2015;308:E573-582 36. Ackermann AM, Gannon M: Molecular regulation of pancreatic beta-cell mass development, maintenance, and expansion. Journal of molecular endocrinology 2007;38:193-206

Page 23 of 32 Diabetes

37. Riley KG, Pasek RC, Maulis MF, Peek J, Thorel F, Brigstock DR, Herrera PL, Gannon M: Connective tissue growth factor modulates adult beta-cell maturity and proliferation to promote beta-cell regeneration in mice. Diabetes 2015;64:1284-1298 38. Banerjee RR, Cyphert HA, Walker EM, Chakravarthy H, Peiris H, Gu X, Liu Y, Conrad E, Goodrich L, Stein RW, Kim SK: Gestational diabetes from inactivation of prolactin receptor and MafB in islet beta- cells. Diabetes 2016; 39. Schulz N, Liu KC, Charbord J, Mattsson CL, Tao L, Tworus D, Andersson O: Critical role for adenosine receptor A2a in beta-cell proliferation. Molecular metabolism 2016;5:1138-1146 40. Okada T, Liew CW, Hu J, Hinault C, Michael MD, Krtzfeldt J, Yin C, Holzenberger M, Stoffel M, Kulkarni RN: Insulin receptors in beta-cells are critical for islet compensatory growth response to insulin resistance. Proceedings of the National Academy of Sciences of the United States of America 2007;104:8977-8982

Diabetes Page 24 of 32

FIGURE LEGENDS

(Fwd), reverse primer (Rev), B32 primer, recombination sequences (Frt and LoxP), splice acceptor sequence (SA) and the βgalactosidase / neomycin resistance fusion gene (βgeo) are shown. (B)

Histochemical staining of pancreatic sections from Adktargeted mice for βgalactosidase activity (blue); counterstaining with eosin (pink, top row) or insulin (brown, bottom row) are shown. (C) ADKdirected western blot of hepatic tissue lysates from Adktargeted and control mice. A nonspecific upper band reflects sample loading (LC). (D) Liver (left) and islet (right) lysates probed for ADK (upper panels) and enolase (loading control, lower panels).

Figure 2 Constitutive deletion of ADK in βcells enhanced glucose tolerance. (A) Body weights of normal chow (NC) and high fat diet (HFD)fed RipCre and βADKO female mice (n=8 mice per group).

Statistical comparisons: RipCre (NC) vs. βADKO (NC), p<0.05 for weeks 8 and 13 only; RipCre (HFD) vs. βADKO (HFD) p>0.05 for all time points; RipCre (NC) vs. RipCre (HFD), p<0.05 weeks 1520;

βADKO (NC) vs. βADKO (HFD), p<0.05 weeks 1520). (B) Weight gain of RipCre and βADKO mice on HFD (no statistical differences detected). (C) ipGTT of 13 week NCfed RipCre and βADKO mice

(n=15 each group; p>0.05 for all time points). (D) ipGTT of 52 week NCfed RipCre and βADKO mice

(n=8 each group; p<0.05 at 120 minutes and p>0.05 for all other time points). (E) ipGTT of RipCre and

βADKO mice after two weeks of HFD (age 15 weeks; n=7 each group; p<0.05 at 0 minutes and p>0.05 for all other time points). (F) ipGTT of female RipCre and βADKO mice after six weeks of HFD (age 19 weeks; n=7 each group; p<0.05 at30, 60 and 90 minutes). (G) ipGTT of female RipCre and βADKO

Page 25 of 32 Diabetes

mice after 18 weeks of HFD (age 31 weeks; n=7 each group; p<0.05 at 30 and 60 minutes). (H) ipGTT of

male RipCre and βADKO mice after 6 weeks of HFD (age 19 weeks; n=7 each group; p<0.05 at 30, 60

and 120 minutes). (I) Fasting glucose values of female RipCre and βADKO mice after 23 weeks of HFD

(age 30 weeks, n=8 each group; *p<0.01) (J) Random glucose values of female RipCre and βADKO

mice after 12 weeks of HFD (age 25 weeks; n=8 each group; *p<0.01).

Figure 3 HFDfed βADKO mice have enhanced insulin tolerance and glucosestimulated insulin

secretion in vivo. (A) Normalized and (B) raw glucose values from 20 week HFDfed female RipCre and

βADKO mice subjected to an ITT (n=7 per group; *,p<0.05). (C) In vivo GSIS of 24 week NC or HFD

fed female RipCre and βADKO mice (n=58 mice per group). Significant differences are for

comparisons made between RipCre and βADKO mice on the same diet indicated (*p<0.05). Insulin

levels are significantly higher at all timepoints in HFDfed mice (p<0.05). (D) The total insulin secretion

(AUC) calculated from Fig. 3C (*, p<0.05).

Figure 4 HFDfed βADKO animals demonstrate increased βcell but not alphacell mass. (A) Relative

number of islets isolated from 28 week (21 weeks of HFD) female HFDfed RipCre and βADKO mice

(n=8; *,p<0.05). The average number of islets isolated per mouse was 107.5±10.1 and 141.7±17.0 from

the HFDfed RipCre and βADKO mice, respectively. (B) Representative images of 24 week female

HFDfed RipCre and βADKOderived pancreatic sections stained for DAPI (blue) and insulin (red). (C)

Size distribution of insulin+ area obtained from RipCre and βADKO pancreatic sections (minimum of 6

per mouse) stained as in Fig.4b (n=5 mice per group, *p<0.05). (D) Average and (E) total insulin+ cluster

area (n=5 mice per group, *p<0.05). (F) Total pancreas area measured based upon DAPI staining (data are

mean ±SEM). (G) Percentage of pancreatic area (DAPI) that is insulin+ (n=5, *p<0.05). (H) Average

Diabetes Page 26 of 32

pancreatic weight (n=5). (I) Calculated βcell mass using data obtained from Figs. 4G and 4H (n=5,

*p<0.05). (J) Number of insulinpositive clusters per pancreatic section (no statistical difference detected). (K) Percentage of total pancreatic area (DAPI) that costains for glucagon. (L) βcell replication in HFDfed RipCre and βADKO mice measured as BrdUpositive cells per µm2 of insulin staining (n=5 mice per group, 10 sections per mouse; p=0.06).

Fed glucose values obtained from 22 week NC and HFDfed (4 weeks) mice (n=8 per group; * p<0.05)

(E) ipGTT of 21 week (3 weeks of HFD) and (F) 29 week (11 weeks of HFD) female mice (n=8 per group; * p<0.05). (G) ipITT of HFDfed female mice treated with vehicle or tamoxifen (n=8 per group; no significant differences observed). (H) In vivo GSIS measurements of HFDfed female mice treated with vehicle or tamoxifen (n=8 per group; *p<0.05). (I) βcell replication index of male NC and HFDfed iβADKO mice that received vehicle or tamoxifen treatment (n=8 per group; *p<0.05). (J) βcell replication index of vehicle and tamoxifentreated HFDfed male iβADKO mice (n=8 per group;

*p<0.05). (K) Representative images of pancreatic sections used for βcell replication analysis. Images were obtained from vehicle (left) and tamoxifentreated (right) iβADKO mice stained for DAPI (blue), insulin (red) and ki67 (green, top panels) or DAPI (blue), PDX1 (red) and BrdU (green, lower panels). (L)

In vitro βcell replication index of DMSO and 5IT (2µM) treated islet cultures obtained from vehicle

Page 27 of 32 Diabetes

injected (ADKexpressing) and tamoxifeninjected (ADKdeficient) mice (n=34;*p<0.05). (M) Western

blot of islet lysates from vehicle and tamoxifeninjected mice for ADK and βactin.

Diabetes Page 28 of 32

Figure 1 Conditional disruption of ADK gene expression. (A) Schematic representation of the Adk locus and targeting construct: mutagenic orientation (ADK1), Flp recombinasedependent nonmutagenic orientation (ADK2) and Cre recombinasedependent mutagenic orientation (ADK3). Forward primer (Fwd), reverse primer (Rev), B32 primer, recombination sequences (Frt and LoxP), splice acceptor sequence (SA) and the βgalactosidase / neomycin resistance fusion gene (βgeo) are shown. (B) Histochemical staining of pancreatic sections from Adktargeted mice for βgalactosidase activity (blue); counterstaining with eosin (pink, top row) or insulin (brown, bottom row) are shown. (C) ADKdirected western blot of hepatic tissue lysates from Adktargeted and control mice. A nonspecific upper band reflects sample loading (LC). (D) Liver (left) and islet (right) lysates probed for ADK (upper panels) and enolase (loading control, lower panels).

279x361mm (300 x 300 DPI) Diabetes Page 30 of 32

Figure 2 Constitutive deletion of ADK in βcells enhanced glucose tolerance. (A) Body weights of normal chow (NC) and high fat diet (HFD)fed RipCre and βADKO female mice (n=8 mice per group). Statistical comparisons: RipCre (NC) vs. βADKO (NC), p<0.05 for weeks 8 and 13 only; RipCre (HFD) vs. βADKO (HFD) p>0.05 for all time points; RipCre (NC) vs. RipCre (HFD), p<0.05 weeks 1520; βADKO (NC) vs. βADKO (HFD), p<0.05 weeks 1520). (B) Weight gain of RipCre and βADKO mice on HFD (no statistical differences detected). (C) ipGTT of 13 week NCfed RipCre and βADKO mice (n=15 each group; p>0.05 for all time points). (D) ipGTT of 52 week NCfed RipCre and βADKO mice (n=8 each group; p<0.05 at 120 minutes and p>0.05 for all other time points). (E) ipGTT of RipCre and βADKO mice after two weeks of HFD (age 15 weeks; n=7 each group; p<0.05 at 0 minutes and p>0.05 for all other time points). (F) ipGTT of female RipCre and βADKO mice after six weeks of HFD (age 19 weeks; n=7 each group; p<0.05 at30, 60 and 90 minutes). (G) ipGTT of female RipCre and βADKO mice after 18 weeks of HFD (age 31 weeks; n=7 each group; p<0.05 at 30 and 60 minutes). (H) ipGTT of male RipCre and βADKO mice after 6 weeks of HFD (age 19 weeks; n=7 each group; p<0.05 at 30, 60 and 120 minutes). (I) Fasting glucose values of Page 31 of 32 Diabetes

female RipCre and βADKO mice after 23 weeks of HFD (age 30 weeks, n=8 each group; *p<0.01) (J) Random glucose values of female RipCre and βADKO mice after 12 weeks of HFD (age 25 weeks; n=8 each group; *p<0.01).

279x433mm (300 x 300 DPI)

Diabetes Page 32 of 32

Figure 3 HFDfed βADKO mice have enhanced insulin tolerance and glucosestimulated insulin secretion in vivo. (A) Normalized and (B) raw glucose values from 20 week HFDfed female RipCre and βADKO mice subjected to an ITT (n=7 per group; *,p<0.05). (C) In vivo GSIS of 24 week NC or HFDfed female RipCre and βADKO mice (n=58 mice per group). Significant differences are for comparisons made between RipCre and βADKO mice on the same diet indicated (*p<0.05). Insulin levels are significantly higher at all time points in HFDfed mice (p<0.05). (D) The total insulin secretion (AUC) calculated from Fig. 3C (*, p<0.05).

279x433mm (300 x 300 DPI)

Page 33 of 32 Diabetes

Figure 4 HFDfed βADKO animals demonstrate increased βcell but not alphacell mass. (A) Relative number of islets isolated from 28 week (21 weeks of HFD) female HFDfed RipCre and βADKO mice (n=8; *,p<0.05). The average number of islets isolated per mouse was 107.5±10.1 and 141.7±17.0 from the HFDfed RipCre and βADKO mice, respectively. (B) Representative images of 24 week female HFDfed Rip Cre and βADKOderived pancreatic sections stained for DAPI (blue) and insulin (red). (C) Size distribution of insulin+ area obtained from RipCre and βADKO pancreatic sections (minimum of 6 per mouse) stained as in Fig.4b (n=5 mice per group, *p<0.05). (D) Average and (E) total insulin+ cluster area (n=5 mice per group, *p<0.05). (F) Total pancreas area measured based upon DAPI staining (data are mean ±SEM). (G) Percentage of pancreatic area (DAPI) that is insulin+ (n=5, *p<0.05). (H) Average pancreatic weight (n=5). (I) Calculated βcell mass using data obtained from Figs. 4G and 4H (n=5, *p<0.05). (J) Number of insulin positive clusters per pancreatic section (no statistical difference detected). (K) Percentage of total pancreatic area (DAPI) that costains for glucagon. (L) βcell replication in HFDfed RipCre and βADKO mice measured as BrdUpositive cells per µm2 of insulin staining (n=5 mice per group, 10 sections per mouse; p=0.06). Diabetes Page 34 of 32

279x433mm (300 x 300 DPI)

Page 35 of 32 Diabetes

Figure 5 Conditional deletion of ADK in the βcells of HFDfed mice enhances glucose tolerance and βcell replication. (A) The temporal relationship of experiments performed on iβADKO mice (red text indicates male mice only).. (B) Representative βgalactosidase histochemistry in pancreatic sections obtained from vehicle and tamoxifeninjected animals one week post injection. (C) ipGTT of NCfed female mice treated with vehicle or tamoxifen (n=8 per group; no significant differences observed). (D) Fed glucose values obtained from 22 week NC and HFDfed (4 weeks) mice (n=8 per group; * p<0.05) (E) ipGTT of 21 week (3 weeks of HFD) and (F) 29 week (11 weeks of HFD) female mice (n=8 per group; * p<0.05). (G) ipITT of HFDfed female mice treated with vehicle or tamoxifen (n=8 per group; no significant differences observed). (H) In vivo GSIS measurements of HFDfed female mice treated with vehicle or tamoxifen (n=8 per group; *p<0.05). (I) βcell replication index of male NC and HFDfed iβADKO mice that received vehicle or tamoxifen treatment (n=8 per group; *p<0.05). (J) βcell replication index of vehicle and tamoxifen treated HFDfed male iβADKO mice (n=8 per group; *p<0.05). (K) Representative images of pancreatic sections used for βcell replication analysis. Images were obtained from vehicle (left) and tamoxifentreated Diabetes Page 36 of 32

(right) iβADKO mice stained for DAPI (blue), insulin (red) and ki67 (green, top panels) or DAPI (blue), PDX1 (red) and BrdU (green, lower panels). (L) In vitro βcell replication index of DMSO and 5IT (2µM) treated islet cultures obtained from vehicleinjected (ADKexpressing) and tamoxifeninjected (ADKdeficient) mice (n=34;*p<0.05). (M) Western blot of islet lysates from vehicle and tamoxifeninjected mice for ADK and βactin.

279x433mm (300 x 300 DPI)