Regulation of Sphingolipid Metabolism by Micrornas: a Potential Approach to Alleviate Atherosclerosis

Total Page:16

File Type:pdf, Size:1020Kb

Regulation of Sphingolipid Metabolism by Micrornas: a Potential Approach to Alleviate Atherosclerosis diseases Review Regulation of Sphingolipid Metabolism by MicroRNAs: A Potential Approach to Alleviate Atherosclerosis Zainab Jahangir 1, Ahmed Bakillah 2 and Jahangir Iqbal 2,* 1 John P. Stevens High School, North Edison, NJ 08820, USA; [email protected] 2 King Abdullah International Medical Research Center, Ministry of National Guard Health Affairs, Al Ahsa 31982, Saudi Arabia; [email protected] * Correspondence: [email protected]; Tel.: +966-56-433-6270; Fax: +966-13-533-9998 Received: 2 September 2018; Accepted: 17 September 2018; Published: 17 September 2018 Abstract: The rapidly expanding field of bioactive lipids is exemplified by the many sphingolipids, which are structurally and functionally diverse molecules with significant physiologic functions. These sphingolipids are main constituents of cellular membranes and have been found associated with plasma lipoproteins, and their concentrations are altered in several metabolic disorders such as atherosclerosis, obesity, and diabetes. Understanding the mechanisms that regulate their biosynthesis and secretion may provide novel information that might be amenable to therapeutic targeting in the treatment of these diseases. Several sphingolipid synthesis genes have been targeted as potential therapeutics for atherosclerosis. In recent years, significant progress has been made in studying the role of microRNAs (miRNAs) in lipid metabolism. However, little effort has been made to investigate their role in sphingolipid metabolism. Sphingolipid biosynthetic pathways involve various enzymes that lead to the formation of several key molecules implicated in atherosclerosis, and the identification of miRNAs that regulate these enzymes could help us to understand these complex pathways better and may prove beneficial in alleviating atherosclerosis. Keywords: atherosclerosis; ceramides; lipids; lipoproteins; miRNA; sphingolipids; sphingomyelin 1. Introduction High plasma lipid levels are major risk factors for several cardiovascular and metabolic disorders such as atherosclerosis, obesity, and diabetes. Some of the most important risk factors for atherosclerosis are the circulating levels of low-density lipoprotein (LDL) and high-density lipoprotein (HDL) cholesterol [1,2]. Besides traditional risk factors, changes in sphingolipids may contribute to the pathogenesis of cardiovascular disease (CVD) [3,4]. Sphingolipids are a class of lipids that contain a sphingoid base, an aliphatic amino alcohol including sphingosine. Sphingoid bases such as dihydrosphingosine and sphingosine are the fundamental building blocks of all sphingolipids. Sphingolipids are biologically active cell components that regulate cellular processes and play an important role in signal transduction and cellular stress responses. The synthesis and degradation of sphingolipids, which serve as both structural lipids as well as signaling molecules, are regulated to maintain homeostasis [3]. Sphingolipids are either derived from other sphingolipids through catabolism via the salvage pathway or synthesized de novo in the endoplasmic reticulum [5]. Ceramide is a simple sphingolipid composed of sphingosine and a fatty acid. Ceramide constitutes the hydrophobic backbone and serves as the key precursor for the de novo synthesis of other biologically active complex sphingolipids (Figure1)[ 6]. It represents a nodal point in the sphingolipid de novo pathway. It can be glycosylated or acquire a polar head group to form glycosphingolipids Diseases 2018, 6, 82; doi:10.3390/diseases6030082 www.mdpi.com/journal/diseases Diseases 2018, 6, 82 2 of 9 Diseases 2018, 6, x 2 of 8 glycosphingolipidsor sphingomyelin (SM), or sphingomyelin respectively [3 ].(SM), It can respectively also be reversibly [3]. It degradedcan also be to reversibly form sphingosine degraded which to formin turn sphingosine can be phosphorylated which in turn by can sphingosine be phosphorylated kinase (SPK) by to sphingosine form sphingosine-1-phospate kinase (SPK) to form (S1P). sphingosine-1-phospateOnce synthesized, sphingolipids (S1P). On cance besynthesized, transported sphingolipids to plasma lipoproteins can be transported [7] or remain to associated plasma lipoproteinswith cellular [7] membranes. or remain Anassociated imbalance with of cellular sphingolipid membranes. levels in An plasma imbalance and tissue of sphingolipid is associated levels with inseveral plasma metabolic and tissue diseases is associated including with atherosclerosis several metabolic [4]. diseases including atherosclerosis [4]. FigureFigure 1. 1. SchematicSchematic representation representation of of miRNAs miRNAs implicated implicated in in the the synthesis synthesis of of some some key key sphingolipid sphingolipid molecules.molecules. The The figure figure is isrepresentative representative of of some some key key enzymatic enzymatic steps steps involved involved in in sphingolipid sphingolipid biosyntheticbiosynthetic pathways pathways that that are are known known to to be be re regulatedgulated by by various various miRNAs miRNAs (dotted (dotted rectangles). rectangles). EnzymesEnzymes with with asterisks asterisks (dotted (dotted ovals) ovals) may may be be pote potentialntial targets targets for for other other miRNAs miRNAs that that need need to to be be identified.identified. Increased Increased levels levels of of ceramides, ceramides, sphi sphingomyelinngomyelin and and glucosylceramide glucosylceramide (red (red arrows) arrows) and and decreaseddecreased levels levels of of sphingosine-1- sphingosine-1-phosphatephosphate (green (green arrow) arrow) have have been been implicated implicated in in atherosclerosis. atherosclerosis. TheThe identification identification of of novel novel miRNAs miRNAs that that regulate regulate sphingolipid sphingolipid metabolism metabolism may may be be a a potential potential therapeutictherapeutic target target to to treat treat atherosclerosis. atherosclerosis. Abbrevia Abbreviations:tions: SPT, SPT, serine serine palmitoyl palmitoyl transferase; transferase; CDase, CDase, ceramidase;ceramidase; CS, CS, ceramide ceramide synthase; synthase; SPK, SPK, sphi sphingosinengosine kinase; kinase; S1PP, S1PP, sphingosine-1-phosphate sphingosine-1-phosphate phosphatase;phosphatase; SMS, SMS, sphingomyelin sphingomyelin synthase; synthase; SMas SMase,e, sphingomyelinase; sphingomyelinase; GCS, GCS, glucosylceramide glucosylceramide synthase;synthase; GCDase, GCDase, glucosylceramidase. glucosylceramidase. AnAn increased increased plasma plasma SM SM level level has has been been proposed proposed as as an an independent independent risk risk factor factor for for coronary coronary heartheart disease disease and and has has been been shown shown to tobe be associated associated with with increased increased atherosclerosis atherosclerosis in humans in humans [8]. [A8]. reductionA reduction in inSM SM levels levels in insphingomyelin sphingomyelin synthase synthase (SMS) (SMS) knockout knockout mice mice is is known known to to decrease decrease atherosclerosisatherosclerosis [9,10]. [9,10]. Like Like SM, SM, increased increased plasma plasma an andd aortic aortic ceramide ceramide levels levels are are also also associated associated with with anan increased increased risk risk of of CVD CVD [11]. [11]. Genetic Genetic deficiency deficiency or or the the inhibition inhibition of of type type 2-neutral 2-neutral sphingomyelinase sphingomyelinase (nSMase2),(nSMase2), a a key key enzyme enzyme in in sphingolipid sphingolipid metabolis metabolism,m, has has been been shown shown to to decrease decrease atherosclerosis atherosclerosis in in ApoEApoE knockout knockout mice mice by by reducing reducing inflammatory inflammatory responses responses due due to to aa dec decreaserease in in ceramide ceramide levels levels [12]. [12]. Furthermore,Furthermore, plasma plasma glycosphingolipid concentrationsconcentrationshave have been been reported reported to to be be elevated elevated in in patients patients at atincreased increased risk risk of of atherosclerosis atherosclerosis [13 [13].]. The The pharmacological pharmacological inhibition inhibition of glucosylceramideof glucosylceramide synthase synthase that thatis responsible is responsible for the for synthesis the synthesis of glucosylceramides of glucosylceramides has been reported has been to ameliorate reported atherosclerosis to ameliorate in atherosclerosisApoE knockout in mice ApoE and knockout rabbits mice [14]. and In contrast rabbits to[14]. ceramide, In contrast glycosphingolipid, to ceramide, glycosphingolipid, and SM, plasma andS1P isSM, believed plasma to beS1P cardioprotective is believed to [3be]. Regulationcardioprotective of the interconvertible[3]. Regulation sphingolipidof the interconvertible metabolites, sphingolipidceramide and metabolites, S1P, and their ceramide opposing and signalingS1P, and th pathwayseir opposing may signaling determine pathways the net biologicalmay determine effect, thea concept net biological referred effect, to as thea concept “sphingolipid referred rheostat”. to as the Plasma“sphingolipid S1P levels rheostat”. significantly Plasma decrease S1P levels after significantlymyocardial infarctiondecrease [after15] and myocardial increase ininfarction patients after[15] and percutaneous increase in coronary patients intervention after percutaneous [16]. It is coronarybelieved thatintervention S1P bound [16]. to It HDL is believed may predict that S1P the severitybound to of HDL coronary may heartpredict disease the severity [17]. Recently, of
Recommended publications
  • Combination of Photodynamic Therapy with Fenretinide and C6
    Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • Supplementary File 2A Revised
    Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • A Selective Inhibitor of Ceramide Synthase 1 Reveals a Novel Role in Fat Metabolism
    ARTICLE DOI: 10.1038/s41467-018-05613-7 OPEN A selective inhibitor of ceramide synthase 1 reveals a novel role in fat metabolism Nigel Turner1, Xin Ying Lim2,3, Hamish D. Toop 4, Brenna Osborne 1, Amanda E. Brandon5, Elysha N. Taylor4, Corrine E. Fiveash1, Hemna Govindaraju1, Jonathan D. Teo3, Holly P. McEwen3, Timothy A. Couttas3, Stephen M. Butler4, Abhirup Das1, Greg M. Kowalski 6, Clinton R. Bruce6, Kyle L. Hoehn 7, Thomas Fath1,10, Carsten Schmitz-Peiffer8, Gregory J. Cooney5, Magdalene K. Montgomery1, Jonathan C. Morris 4 & Anthony S. Don3,9 1234567890():,; Specific forms of the lipid ceramide, synthesized by the ceramide synthase enzyme family, are believed to regulate metabolic physiology. Genetic mouse models have established C16 ceramide as a driver of insulin resistance in liver and adipose tissue. C18 ceramide, syn- thesized by ceramide synthase 1 (CerS1), is abundant in skeletal muscle and suggested to promote insulin resistance in humans. We herein describe the first isoform-specific ceramide synthase inhibitor, P053, which inhibits CerS1 with nanomolar potency. Lipidomic profiling shows that P053 is highly selective for CerS1. Daily P053 administration to mice fed a high- fat diet (HFD) increases fatty acid oxidation in skeletal muscle and impedes increases in muscle triglycerides and adiposity, but does not protect against HFD-induced insulin resis- tance. Our inhibitor therefore allowed us to define a role for CerS1 as an endogenous inhibitor of mitochondrial fatty acid oxidation in muscle and regulator of whole-body adiposity. 1 School of Medical Sciences, UNSW Sydney, Sydney 2052 NSW, Australia. 2 Prince of Wales Clinical School, Faculty of Medicine, UNSW Sydney, Sydney 2052 NSW, Australia.
    [Show full text]
  • Lipid Signalling Dynamics of Palmitate- Induced Endoplasmic Reticulum Stress in Skeletal Muscle
    Lipid signalling dynamics of palmitate- induced endoplasmic reticulum stress in skeletal muscle A dissertation submitted for the degree of Doctor of Philosophy at the University of Cambridge. Submitted September 2018. Ben Daniel McNally King’s College “Obviously my method of thought and reasoning is influenced by a scientific training – if that were not so my scientific training will have been a waste and a failure.” Rosalind Franklin – taken from a letter to her father, Ellis Franklin, undated (approximately 1940). “I was taught that the way of progress is neither swift nor easy.” Marie Curie - Taken from Pierre Curie (1936). “Machines will do the heavy work, Men will supervise the machines, You owe much to these machines, Horsepower, not manpower, Brains, not brawn.” Progress by Public Service Broadcasting, released in 2017. Declaration This dissertation is the result of my own work and includes nothing which is the outcome of work done in collaboration except as declared in the Preface and specified in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text.
    [Show full text]
  • Supplementary Table 1A. Genes Significantly Altered in A4573 ESFT
    Supplementary Table 1A. Genes significantly altered in A4573 ESFT cells following BMI-1knockdown genesymbol genedescription siControl siBMI1 FC Direction P-value AASS aminoadipate-semialdehyde synthase | tetra-peptide repeat homeobox-like6.68 7.24 1.5 Up 0.007 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 | neural5.44 proliferation,6.3 differentiation1.8 and Upcontrol, 1 0.006 ABHD4 abhydrolase domain containing 4 7.51 6.69 1.8 Down 0.002 ACACA acetyl-Coenzyme A carboxylase alpha | peroxiredoxin 5 | similar6.2 to High mobility7.26 group2.1 protein UpB1 (High mobility0.009 group protein 1) (HMG-1) (Amphoterin) (Heparin-binding protein p30) | Coenzyme A synthase ACAD9 acyl-Coenzyme A dehydrogenase family, member 9 9.25 8.59 1.6 Down 0.008 ACBD3 acyl-Coenzyme A binding domain containing 3 7.89 8.53 1.6 Up 0.008 ACCN2 amiloride-sensitive cation channel 2, neuronal 5.47 6.28 1.8 Up 0.005 ACIN1 apoptotic chromatin condensation inducer 1 7.15 7.79 1.6 Up 0.008 ACPL2 acid phosphatase-like 2 6.04 7.6 2.9 Up 0.000 ACSL4 acyl-CoA synthetase long-chain family member 4 6.72 5.8 1.9 Down 0.001 ACTA2 actin, alpha 2, smooth muscle, aorta 9.18 8.44 1.7 Down 0.003 ACYP1 acylphosphatase 1, erythrocyte (common) type 7.09 7.66 1.5 Up 0.009 ADA adenosine deaminase 6.34 7.1 1.7 Up 0.009 ADAL adenosine deaminase-like 7.88 6.89 2.0 Down 0.006 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 6.57 7.65 2.1 Up 0.000 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 6.49 7.13 1.6 Up 0.008 ADCY9 adenylate cyclase 9 6.5 7.18
    [Show full text]
  • Sphingolipids
    Ectopic expression of ceramide synthase 2 in neurons suppresses neurodegeneration induced by ceramide synthase 1 deficiency Stefka D. Spassievaa,1, Xiaojie Jib,c,1, Ye Liub, Kenneth Gabled, Jacek Bielawskie, Teresa M. Dunnd, Erhard Bieberichf, and Lihong Zhaob,2 aDepartment of Molecular and Cellular Medicine, Texas A&M Health Science Center, College Station, TX 77843; bThe Jackson Laboratory, Bar Harbor, ME 04609; cGraduate School of Biomedical Science and Engineering, University of Maine, Orono, ME 04469; dDepartment of Biochemistry and Molecular Biology, Uniformed Services University of the Health Sciences, Bethesda, MD 20814; eDepartment of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425; and fDepartment of Neuroscience and Regenerative Medicine, Medical College of Georgia/Augusta University, Augusta, GA 30912 Edited by David W. Russell, University of Texas Southwestern Medical Center, Dallas, TX, and approved April 13, 2016 (received for review December 7, 2015) Sphingolipids exhibit extreme functional and chemical diversity suggested to cause apoptosis in certain cancer cells, whereas that is in part determined by their hydrophobic moiety, ceramide. ceramide with a C16 fatty acyl chain (C16 ceramide) has been In mammals, the fatty acyl chain length variation of ceramides is considered prosurvival (10–12). The ceramide profile changes in determined by six (dihydro)ceramide synthase (CerS) isoforms. aging and neurodegenerative brains, but whether these alterations Previously, we and others
    [Show full text]
  • Biological Functions of Sphingomyelin Synthase Related Protein and Ceramide Synthase 4 Investigated with Transgenic Mouse Mutants
    Biological functions of Sphingomyelin synthase related protein and Ceramide synthase 4 investigated with transgenic mouse mutants Dissertation Zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Andreas Bickert aus Neuwied Bonn, 2016 Angefertigt mit Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn Erstgutachter: Prof. Dr. Klaus Willecke Zweitgutachter: Prof. Dr. Michael Hoch Tag der Promotion: 25.10.2016 Erscheinungsjahr: 2017 Table of Contents Table of Contents 1 Introduction.................................................................................................. 1 1.1 Biological lipids ............................................................................................ 1 1.2 Eucaryotic membranes ................................................................................ 3 1.3 Sphingolipids ............................................................................................... 5 1.3.1 Sphingolipid metabolic pathway ................................................................. 6 1.3.1.1 De novo sphingolipid biosynthesis .......................................................... 8 1.3.1.2 The ceramide transfer protein ................................................................. 8 1.3.1.3 Biosynthesis of complex sphingolipids .................................................... 9 1.3.1.4 Sphingolipid degradation and the salvage
    [Show full text]
  • Disorders of Sphingolipid Synthesis, Sphingolipidoses, Niemann-Pick Disease Type C and Neuronal Ceroid Lipofuscinoses
    551 38 Disorders of Sphingolipid Synthesis, Sphingolipidoses, Niemann-Pick Disease Type C and Neuronal Ceroid Lipofuscinoses Marie T. Vanier, Catherine Caillaud, Thierry Levade 38.1 Disorders of Sphingolipid Synthesis – 553 38.2 Sphingolipidoses – 556 38.3 Niemann-Pick Disease Type C – 566 38.4 Neuronal Ceroid Lipofuscinoses – 568 References – 571 J.-M. Saudubray et al. (Eds.), Inborn Metabolic Diseases, DOI 10.1007/978-3-662-49771-5_ 38 , © Springer-Verlag Berlin Heidelberg 2016 552 Chapter 38 · Disor ders of Sphingolipid Synthesis, Sphingolipidoses, Niemann-Pick Disease Type C and Neuronal Ceroid Lipofuscinoses O C 22:0 (Fatty acid) Ganglio- series a series b HN OH Sphingosine (Sphingoid base) OH βββ β βββ β Typical Ceramide (Cer) -Cer -Cer GD1a GT1b Glc ββββ βββ β Gal -Cer -Cer Globo-series GalNAc GM1a GD1b Neu5Ac βαββ -Cer Gb4 ββ β ββ β -Cer -Cer αβ β -Cer GM2 GD2 Sphingomyelin Pcholine-Cer Gb3 B4GALNT1 [SPG46] [SPG26] β β β ββ ββ CERS1-6 GBA2 -Cer -Cer ST3GAL5 -Cer -Cer So1P So Cer GM3 GD3 GlcCer - LacCer UDP-Glc UDP Gal CMP -Neu5Ac - UDP Gal PAPS Glycosphingolipids GalCer Sulfatide ββ Dihydro -Cer -Cer SO 4 Golgi Ceramide apparatus 2-OH- 2-OH-FA Acyl-CoA FA2H CERS1-6 [SPG35] CYP4F22 ω-OH- ω-OH- FA Acyl-CoA ULCFA ULCFA-CoA ULCFA GM1, GM2, GM3: monosialo- Sphinganine gangliosides Endoplasmic GD3, GD2, GD1a, GD1b: disialo-gangliosides reticulum KetoSphinganine GT1b: trisialoganglioside SPTLC1/2 [HSAN1] N-acetyl-neuraminic acid: sialic acid found in normal human cells Palmitoyl-CoA Deoxy-sphinganine + Serine +Ala or Gly Deoxymethylsphinganine 38 . Fig. 38.1 Schematic representation of the structure of the main sphingolipids , and their biosynthetic pathways.
    [Show full text]
  • Functional Analysis of Acyl-Coa Binding Protein in Skin and Sebaceous Glands
    FUNCTIONAL ANALYSIS OF ACYL-COA BINDING PROTEIN IN SKIN AND SEBACEOUS GLANDS Ph.D. Thesis Hanne Engelsby Supervisor Nils J. Færgeman Department of Biochemistry and Molecular Biology Faculty of Science, University of Southern Denmark March 2017 FUNCTIONAL ANALYSIS OF ACYL-COA BINDING PROTEIN IN SKIN AND SEBACEOUS GLANDS PREFACE The work presented in this PhD thesis was performed in Professor Nils J. Færgemans laboratory, Department of Biochemistry and Molecular Biology, University of Southern Denmark. Many people and research groups were involved in the successful obtainment of the results presented here and I would like to express my gratitude and thankfulness to them. First I would like to thank my supervisor Nils J. Færgeman for providing me with the opportunity to carry out this PhD. He has been an excellent guidance and I have enjoyed our fruitful discussions regarding this project. Professor Carien M. Niessen, Department of Dermatology and CECAD Cologne, University of Cologne provided me with an excellent opportunity to carry out my environmental exchange in her laboratory. I am highly grateful for that and for the many fruitful discussions we have had. The members of the Niessen lab always provided me with the help I needed and invited me to their gatherings, which made me feel very welcome in their group. I would especially like to thank Emmi Wachsmuth and Franziska Peters for their excellent guidance in the lab and for introducing me to the many aspects of skin science. I would like to thank present and former members of the Nils J. Færgeman laboratory, who have created a wonderful environment.
    [Show full text]