First Line of Title

Total Page:16

File Type:pdf, Size:1020Kb

Load more

THE ABDOMINAL FAT CONTRIBUTION TO ADIPOSITY IN CHICKENS DIVERGENTLY SELECTED FOR FATNESS OR GROWTH: CROSS-MODEL ELUCIDATION AND VALIDATION OF GENE EXPRESSION by Christopher William Resnyk A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Master of Science in Animal Science Summer 2013 © 2013 Christopher William Resnyk All Rights Reserved THE ABDOMINAL FAT CONTRIBUTION TO ADIPOSITY IN CHICKENS DIVERGENTLY SELECTED FOR FATNESS OR GROWTH: CROSS-MODEL ELUCIDATION AND VALIDATION OF GENE EXPRESSION by Christopher William Resnyk Approved: __________________________________________________________ Larry A. Cogburn III, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: __________________________________________________________ Jack Gelb, Jr., Ph.D. Chair of the Department of Animal and Food Sciences Approved: __________________________________________________________ Mark Rieger, Ph.D. Dean of the College of Agriculture and Natural Resources Approved: __________________________________________________________ James G. Richards, Ph.D. Vice Provost for Graduate and Professional Education ACKNOWLEDGMENTS This work was supported by a grant from the United States Department of Agriculture, Initiative for Future Agricultural and Food Systems, Animal Genome Program (USDA-IFAFS; Award # 00-52100-9614) and a grant from the USDA Cooperative State Research, Education, and Extension Service (CSREES; Award # 2009-34562-20008) to the Avian Biosciences Center, University of Delaware. I want to thank my collaborators on this work: Sam Aggrey, Wilfrid Carre, Chuming Chen, Larry Cogburn, Michel Duclos, Elisabeth Le Bihan-Duval, Hongzhan Huang, Tom Porter, Jean Simon, Xiaofei Wang, and Cathy Wu. Further, the longitudinal study and tissue sampling of the divergent lines required the contribution of a large number of scientists and technicians from the laboratories of INRA UR83 and from the breeding facilities in Nouzilly, France. Although not named, each individual’s essential contribution toward completion of this project is gratefully acknowledged. Thank you to Sandra Rodriguez-Zas for completing the statistical analysis on the HG and LG microarray data, and to Robert Settlage and Wyatt McMahon for analysis of the HG and LG RNA sequencing experiment. The contributions of each collaborator made this work possible. Thank you. iii I would like to thank my committee members for their support. First, I have to thank Larry Cogburn for seeing potential in me as an undergraduate and giving me a “home” for the last three years. You became not only my advisor, but also my mentor and friend. You are an inspiration and have provided me with the necessary tools to be an effective scientific investigator. Thank you to Behnam Abasht, Gary Laverty, and Cathy Wu for serving on my thesis committee. I would also like to thank Jack Gelb and Mark Parcells for their assistance throughout my degree. Your support has been greatly appreciated over the last few years. Thank you. Thank you to all Worrilow Hall graduate and undergraduate students who helped and/or interacted with me throughout my degree, especially Nick Siano for being a friend and providing the competition that I needed to succeed over the past 6 years. I want to give a special thank you to my parents and grandparents who struggled and persevered so that I could have this wonderful opportunity. Your contribution to my success will never be overlooked. Finally, thank you to my beautiful wife for all of her support and unconditional love during this process. I think all of the clicking has paid off! This thesis is dedicated to my loving wife Jessica and my sisters Amanda and Kayla. iv TABLE OF CONTENTS LIST OF TABLES ........................................................................................................ ix LIST OF FIGURES ........................................................................................................ x ABSTRACT ................................................................................................................ xiii Chapter 1 BACKGROUND ................................................................................................ 1 1.1 The Domestic Chicken as a Model of Obesity .......................................... 1 1.1.1 Lipid breakdown and synthesis are conserved in chickens ........... 1 1.1.2 Intriguing features of avian metabolism bolster the chicken as a model for metabolic disorders .................................................... 6 1.2 Our Models for Studying Fatness and Leanness ....................................... 8 1.2.1 The fat line and lean line chickens ................................................ 8 1.2.2 The high growth and low growth chickens ................................. 10 1.3 The Abdominal Fat Contribution to Adiposity ....................................... 12 1.4 Important Processes Regulating Fatness and Leanness in Abdominal Fat ............................................................................................................ 13 1.4.1 Ligand activated transcription factor signaling ........................... 13 1.4.1.1 Retinoid metabolism, signaling and transcription factor activation ............................................................ 14 1.4.2 Hemostasis ................................................................................... 16 1.5 References ............................................................................................... 20 2 LONGITUDINAL MICROARRAY ANALYSIS OF ABDOMINAL FAT IN GENETICALLY FAT AND LEAN CHICKENS ...................................... 28 2.1 Introduction ............................................................................................. 28 2.2 Methods ................................................................................................... 29 v 2.2.1 Animals and tissue collection ...................................................... 29 2.2.2 Microarray analysis ..................................................................... 30 2.2.3 Quantitative RT-PCR analysis .................................................... 33 2.3 Results ..................................................................................................... 35 2.3.1 Phenotypic measurements ........................................................... 35 2.3.2 Abdominal fat gene expression ................................................... 36 2.3.3 Ingenuity Pathway Analysis (IPA) of differentially expressed gene sets ....................................................................................... 37 2.3.4 Higher expression of lipogenic genes in adipose tissue of FL chickens ....................................................................................... 45 2.3.5 Ligand activated nuclear receptors and other transcription factors .......................................................................................... 52 2.3.6 Correlation of gene expression between microarray and qRT- PCR analyses ............................................................................... 62 2.4 Discussion ................................................................................................ 63 2.4.1 Higher expression of hemostatic factors in adipose tissue of LL chickens ................................................................................. 64 2.4.2 Adipokines in abdominal fat of FL and LL chickens .................. 67 2.4.3 Retinol metabolism and retinoic acid signaling in adipose tissue ............................................................................................ 70 2.4.4 Visceral adipose tissue as a major site of lipogenesis in chickens ....................................................................................... 72 2.4.5 Increased lipolysis in abdominal fat of LL chickens ................... 77 2.5 Chapter Summary .................................................................................... 78 2.6 References ............................................................................................... 80 3 DEEP RNA SEQUENCE ANALYSIS OF ABDOMINAL FAT IN GENETICALLY FAT AND LEAN CHICKENS AT 7 WEEKS OF AGE .... 91 3.1 Introduction ............................................................................................. 91 3.2 Methods ................................................................................................... 93 3.2.1 Animals and tissue preparation ................................................... 93 3.2.2 RNA extraction, library preparation and RNA sequencing ......... 94 3.2.3 RNA sequence analysis ............................................................... 95 3.2.3.1 Sequence data filtering ................................................. 95 3.2.3.2 Read mapping and transcript/gene identification ......... 95 3.2.3.3 Differential expression analysis ................................... 96 vi 3.2.4 Quantitative RT-PCR verification analysis ................................. 97 3.3 Results ..................................................................................................... 98 3.3.1 Mapped reads: genes and transcripts detected ............................. 98 3.3.2 Abdominal fat transcriptome of FL and LL chickens at 7 wk .. 100 3.3.3 Ingenuity Pathway Analysis (IPA) of gene interactions and functional pathways ................................................................... 101 3.3.3.1 Analysis of the highest expressed processes in abdominal
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Combination of Photodynamic Therapy with Fenretinide and C6

    Combination of Photodynamic Therapy with Fenretinide and C6

    Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project.
  • T-Cell Protein Tyrosine Phosphatase Attenuates STAT3 and Insulin

    T-Cell Protein Tyrosine Phosphatase Attenuates STAT3 and Insulin

    ORIGINAL ARTICLE T-Cell Protein Tyrosine Phosphatase Attenuates STAT3 and Insulin Signaling in the Liver to Regulate Gluconeogenesis Atsushi Fukushima,1 Kim Loh,1 Sandra Galic,1 Barbara Fam,2 Ben Shields,1 Florian Wiede,1 Michel L. Tremblay,3 Matthew J. Watt,4 Sofianos Andrikopoulos,2 and Tony Tiganis1 OBJECTIVE—Insulin-induced phosphatidylinositol 3-kinase (PI3K)/Akt signaling and interleukin-6 (IL-6)-instigated JAK/ STAT3-signaling pathways in the liver inhibit the expression of ype 2 diabetes has reached epidemic propor- gluconeogenic genes to decrease hepatic glucose output. The tions, afflicting roughly 170 million people world- insulin receptor (IR) and JAK1 tyrosine kinases and STAT3 can wide. Although the underlying genetic causes serve as direct substrates for the T-cell protein tyrosine phos- Tand the associated pathologic symptoms are phatase (TCPTP). Homozygous TCPTP-deficiency results in peri- heterogenous, a common feature is high blood glucose due natal lethality prohibiting any informative assessment of to peripheral insulin resistance. Circulating insulin re- TCPTP’s role in glucose homeostasis. Here we have used leased from ␤-cells in the pancreas serves to lower blood Ptpn2ϩ/Ϫ mice to investigate TCPTP’s function in glucose glucose by triggering the translocation of the facilitative homeostasis. GLUT4 to the plasma membrane in muscle and adipose RESEARCH DESIGN AND METHODS—We analyzed insulin tissue (1). Insulin also acts in the liver to promote glycogen sensitivity and gluconeogenesis in chow versus high-fat–fed synthesis and lipogenesis and to suppress hepatic glucose (HFF) Ptpn2ϩ/Ϫ and Ptpn2ϩ/ϩ mice and insulin and IL-6 production (HGP) by inhibiting gluconeogenesis and gly- signaling and gluconeogenic gene expression in Ptpn2ϩ/Ϫ and cogenolysis (1).
  • Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy

    Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy

    Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy by Ian Lawrence Belle Department of Immunology Duke University Date:_______________________ Approved: ___________________________ Yuan Zhuang, Supervisor ___________________________ Michael Krangel, Chair ___________________________ Qi-jing Li ___________________________ Richard Lee Reinhardt ___________________________ Arno Greenleaf Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Immunology in the Graduate School of Duke University 2015 ABSTRACT Roles of Id3 and IL-13 in a Mouse Model of Autoimmune Exocrinopathy by Ian Lawrence Belle Department of Immunology Duke University Date:_______________________ Approved: ___________________________ Yuan Zhuang, Supervisor ___________________________ Michael Krangel, Chair ___________________________ Qi-jing Li ___________________________ Richard Lee Reinhardt ___________________________ Arno Greenleaf An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Immunology in the Graduate School of Duke University 2015 Copyright by Ian Lawrence Belle 2015 Abstract Within the field of immunology, the existence of autoimmune diseases presents a unique set of challenges. The immune system typically protects the host by identifying foreign pathogens and mounting an appropriate response to eliminate them. Great strides have been made in understanding how foreign pathogens are identified and responded to, leading to the development of powerful immunological tools, such as vaccines and a myriad of models used to study infectious diseases and processes. However, it is occasionally possible for host tissues themselves to be inappropriately identified as foreign, prompting an immune response that attempts to eliminate the host tissue. The immune system has processes in place, referred to as selection, designed to prevent the development of cells capable of recognizing the self as foreign.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Sirt7 Promotes Adipogenesis in the Mouse by Inhibiting Autocatalytic

    Sirt7 Promotes Adipogenesis in the Mouse by Inhibiting Autocatalytic

    Sirt7 promotes adipogenesis in the mouse by inhibiting PNAS PLUS autocatalytic activation of Sirt1 Jian Fanga,1, Alessandro Iannia,1, Christian Smolkaa,b, Olesya Vakhrushevaa,c, Hendrik Noltea,d, Marcus Krügera,d, Astrid Wietelmanna, Nicolas G. Simonete, Juan M. Adrian-Segarraa, Alejandro Vaqueroe, Thomas Brauna,2, and Eva Bobera,2 aDepartment of Cardiac Development and Remodeling, Max Planck Institute for Heart and Lung Research, D-61231 Bad Nauheim, Germany; bMedizin III Kardiologie und Angiologie, Universitätsklinikum Freiburg, D-79106 Freiburg, Germany; cDepartment of Medicine, Hematology/Oncology, Goethe University, D-60595 Frankfurt am Main, Germany; dInstitute for Genetics, Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), D-50931 Köln, Germany; and eCancer Epigenetics and Biology Program, Bellvitge Biomedical Research Institute (IDIBELL), 08908 L’Hospitalet de Llobregat, Barcelona, Catalonia, Spain Edited by C. Ronald Kahn, Section of Integrative Physiology, Joslin Diabetes Center, Harvard Medical School, Boston, MA, and approved August 23, 2017 (received for review April 26, 2017) Sirtuins (Sirt1–Sirt7) are NAD+-dependent protein deacetylases/ adipogenesis and accumulation of lipids in 3T3-L1 adipocytes by ADP ribosyltransferases, which play decisive roles in chromatin deacetylation of FOXO1, which represses PPARγ (10). The role of silencing, cell cycle regulation, cellular differentiation, and metab- Sirt6 in the regulation of adipogenic differentiation is less clear olism. Different sirtuins control similar cellular processes, suggest- although it is known that Sirt6 knockout (KO) mice suffer from ing a coordinated mode of action but information about potential reduced adipose tissue stores, while Sirt6 overexpressing mice cross-regulatory interactions within the sirtuin family is still lim- are protected against high-fat diet-induced obesity (11, 12).
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation

    Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation

    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*

    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
  • Supplementary File 2A Revised

    Supplementary File 2A Revised

    Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • FKBP52 Regulates TRPC3-Dependent Ca<Sup>

    FKBP52 Regulates TRPC3-Dependent Ca<Sup>

    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs231506. doi:10.1242/jcs.231506 RESEARCH ARTICLE FKBP52 regulates TRPC3-dependent Ca2+ signals and the hypertrophic growth of cardiomyocyte cultures Sandra Bandleon1, Patrick P. Strunz1, Simone Pickel2, Oleksandra Tiapko3, Antonella Cellini1, Erick Miranda-Laferte2 and Petra Eder-Negrin1,* ABSTRACT A single TRPC subunit is composed of six transmembrane The transient receptor potential (TRP; C-classical, TRPC) channel domains with a pore-forming loop connecting the transmembrane ‘ ’ TRPC3 allows a cation (Na+/Ca2+) influx that is favored by the domains 5 and 6, a preserved 25 amino acid sequence called a TRP domain and two cytosolic domains, an N-terminal ankyrin repeat stimulation of Gq protein-coupled receptors (GPCRs). An enhanced TRPC3 activity is related to adverse effects, including pathological domain and a C-terminal coiled-coil domain (Eder et al., 2007; Fan hypertrophy in chronic cardiac disease states. In the present study, et al., 2018). The cytosolic domains mediate ion channel formation we identified FK506-binding protein 52 (FKBP52, also known as and are implicated in ion channel regulation and plasma membrane FKBP4) as a novel interaction partner of TRPC3 in the heart. FKBP52 targeting (Eder et al., 2007). Among several protein interaction sites, was recovered from a cardiac cDNA library by a C-terminal TRPC3 the C-terminus of all TRPC subunits harbors a highly conserved fragment (amino acids 742–848) in a yeast two-hybrid screen. proline-rich sequence that corresponds to the binding domain in the Drosophila Downregulation of FKBP52 promoted a TRPC3-dependent photoreceptor channel TRPL for the FK506-binding hypertrophic response in neonatal rat cardiomyocytes (NRCs).
  • A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer

    A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer

    Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.