DOCSLIB.ORG

Lipid Signalling Dynamics of Palmitate- Induced Endoplasmic Reticulum Stress in Skeletal Muscle

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Lipid Signalling Dynamics of Palmitate- Induced Endoplasmic Reticulum Stress in Skeletal Muscle Lipid signalling dynamics of palmitate- induced endoplasmic reticulum stress in skeletal muscle A dissertation submitted for the degree of Doctor of Philosophy at the University of Cambridge. Submitted September 2018. Ben Daniel McNally King’s College “Obviously my method of thought and reasoning is influenced by a scientific training – if that were not so my scientific training will have been a waste and a failure.” Rosalind Franklin – taken from a letter to her father, Ellis Franklin, undated (approximately 1940). “I was taught that the way of progress is neither swift nor easy.” Marie Curie - Taken from Pierre Curie (1936). “Machines will do the heavy work, Men will supervise the machines, You owe much to these machines, Horsepower, not manpower, Brains, not brawn.” Progress by Public Service Broadcasting, released in 2017. Declaration This dissertation is the result of my own work and includes nothing which is the outcome of work done in collaboration except as declared in the Preface and specified in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. It does not exceed the prescribed word limit for the relevant Degree Committee. For more information on the word limits for the respective Degree Committee. i Abstract Approximately 340 million people worldwide have Type 2 Diabetes Mellitus (T2DM), making identification of the aetiological processes underlying this disease imperative. Endoplasmic reticulum (ER) stress has emerged as a potential mechanism driving the pathogenesis of obesity and T2DM. Palmitate, the predominant saturated fatty acid elevated in the blood plasma of obese individuals, induces ER stress and insulin resistance in skeletal muscle. However, the interaction between ER stress, lipid metabolism and T2DM remains poorly understood. This thesis uses lipidomic tools to investigate skeletal muscle ER stress in cell culture and animal models. Chronic palmitate treatment of both mouse C2C12 and human primary myotubes induced ER stress, concurrent with the cytosolic phospholipase A2- dependent release of polyunsaturated fatty acids (PUFAs) from phosphatidylcholines (PCs). This phenotype was also observed in skeletal muscle from mouse models of diet-induced obesity and T2DM patients. Palmitate-stimulated catabolism of PUFA-containing PCs was concomitant with increases in bioactive eicosanoid secretion, which was shown to be important in the control of ER stress, inflammatory signalling and macrophage activation. This provides a novel link between palmitate and the control of ER stress and inflammation in metabolic disease. Previous work has suggested that the propagation of ER stress signalling between cells may result from the secretion of a, as yet undefined, cell non-autonomous signal. In this thesis, long-chain ceramides (40:1 and 42:1) were identified as signals transmitting the induction of ER stress between myotubes via exosome-mediated transport. Long-chain ceramide concentrations were increased in skeletal muscle and blood plasma from in vivo models of obesity and were elevated in the muscle of T2DM patients. Muscle synthesis of long chain ceramides in response to palmitate was found to occur via the de novo pathway and was linked to ER stress by Perk, an important unfolded protein response kinase. This work identifies ceramides as cell non-autonomous signals that propagate ER stress activation following exposure to palmitate, providing a novel mechanism for stress signalling in obesity and insulin resistance. ii Publications Roberts, L.D., Ashmore, T., McNally, B.D., et al. 2017 Inorganic nitrate mimics exercise- stimulated muscular fiber-type switching and myokine and γ-aminobutyric acid release. Diabetes 66 (3), 674-688. Sanders, F., McNally, B., Griffin, J.L., 2016 Blood triacylglycerols: a lipidomic window on diet and disease. Biochemical Society Transactions 44 (2), 638-644. McNally, B., Griffin, J.L., Roberts, L.D. 2016 Dietary inorganic nitrate: From villain to hero in metabolic disease? Mol Nutr Food Res. 60(1):67-78. iii Acknowledgements The past four years have been a challenging and rewarding period, in which I’ve learnt a lot. I would not have been able to complete this PhD, however, without a number of wonderful people who’ve helped and supported me throughout my time in Cambridge as a postgraduate student. I’d now like to take the opportunity to acknowledge a few of these. I owe a lot to not one, but two excellent supervisors. First, thank you to Dr Lee Roberts. You have been the perfect supervisor for me, providing the scientific guidance I’ve required, and a trust to pursue the questions I’ve been most interested in. I feared I would struggle when you moved to Leeds, but even from the other end of the country you were still able to keep me on course with our monthly meetings and a speedy reply whenever I’ve needed you. Your progress in, and enthusiasm for, research has inspired my own interest, and I hope that remains the case as I pursue a career in academia. Secondly, thanks to Professor Jules Griffin for the opportunity to research in your lab and the support and guidance during my PhD, as well as the financial support to keep me going through an unplanned fourth year! Thank you as well for funding experiments beyond my MRC budget and a number of conferences, including two trips the US and one to Swansea! It’s been a privilege to work for someone so respected in the field. I would also like to thank the other people in the group, past and present, for making the past 4 years such a great experience. In particular, to Steve, my third supervisor in all but title. Thank you for putting up with nonsensical and incessant questions for such a long time, allowing my PhD to run as smoothly as possible. Thanks as well for the many pub trips, beer festivals, football games and board game nights. Similarly, it’s not going to be the same without our other board game partner in crime, Emma. I’ll miss having a Cambridge resident to drag along to gigs as well! I’d also like to thank Tom for his biochemistry guidance and the needless halves, and Zoe, James, Antonio and Christine for teaching me all there is to know about LC-MS. Thanks to Evelina, Dean and Marta, my fellow office residents for keeping the small office the most fun office, and also to Sonia, Mike, Mel and Cecilia, among others, for making tea time a fun and of course important part of the working day, and evening pub trips a necessity. iv Acknowledgements Outside of the lab, I’ve been lucky enough to count on the friendship and love of a number of other people. Of course, none have been more supportive and patient than Fiona. Thank you for your understanding with my Saturday morning alarms and the care packages that have seen me through my thesis! Most importantly, thank you for maintaining my life outside of science, even when research feels all encompassing. Thank you as well to Osh and Ellie, the other constants in my life, for the many hours spent listening to me rant about science, the many games of cards and far too many episodes of Rush Hour. Thanks also to Ben, Fliss, Fi and Jo for being fun and supportive housemates. When Cambridge has got too much, I know I’ve always been able to count on friends who’ve moved away to London. Beth, Holly, Ellie, Eva, Becca, Kesia and Aidan – you’ve always been a message or a train journey away when I’ve needed you. Thanks for the dinners, the gigs, the parties, the hangouts and more love and support than I deserve. Thanks also to Chris and Harry for the nights out in London and even the odd visit to Cambridge, even if you do insist on going to places PhD students can’t afford. Hopefully we’ll find an activity that I can actually compete at, because golf and darts certainly haven’t gone my way. My school friends have always been important at keeping me in line. In particular, Daisy, despite everything you’ve had to go through over the last couple of years, you’ve still managed to spend more time checking in on me. David, I haven’t seen you anywhere near as much as I should have but your messages and the Frank Turner gigs are always important to me, even if you did beat me to the Dr title! To everyone else from school, I always look forward to our Christmas pub trips and wish they were more frequent! Lastly, and most importantly, I’d like to thank my family. To my parents, Paul and Beverley, and my brother, Joe, thank you for all the support and guidance to get me through this PhD. You’ve been there whenever I’ve needed you, be that a message, a trip out or a dinner at home! Family Christmas is always one of the best times of the year as well! I’m blessed to have family such as the three of you, and there’s no way I’d be submitting this without you. v Table of Contents Declaration ........................................................................................................................................... i Abstract ............................................................................................................................................... ii Publications ........................................................................................................................................ iii Acknowledgements ............................................................................................................................ iv Table of Contents ..............................................................................................................................
Load more

Recommended publications
  • Combination of Photodynamic Therapy with Fenretinide and C6
    Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • Supplementary File 2A Revised
    Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • A Selective Inhibitor of Ceramide Synthase 1 Reveals a Novel Role in Fat Metabolism
    ARTICLE DOI: 10.1038/s41467-018-05613-7 OPEN A selective inhibitor of ceramide synthase 1 reveals a novel role in fat metabolism Nigel Turner1, Xin Ying Lim2,3, Hamish D. Toop 4, Brenna Osborne 1, Amanda E. Brandon5, Elysha N. Taylor4, Corrine E. Fiveash1, Hemna Govindaraju1, Jonathan D. Teo3, Holly P. McEwen3, Timothy A. Couttas3, Stephen M. Butler4, Abhirup Das1, Greg M. Kowalski 6, Clinton R. Bruce6, Kyle L. Hoehn 7, Thomas Fath1,10, Carsten Schmitz-Peiffer8, Gregory J. Cooney5, Magdalene K. Montgomery1, Jonathan C. Morris 4 & Anthony S. Don3,9 1234567890():,; Specific forms of the lipid ceramide, synthesized by the ceramide synthase enzyme family, are believed to regulate metabolic physiology. Genetic mouse models have established C16 ceramide as a driver of insulin resistance in liver and adipose tissue. C18 ceramide, syn- thesized by ceramide synthase 1 (CerS1), is abundant in skeletal muscle and suggested to promote insulin resistance in humans. We herein describe the first isoform-specific ceramide synthase inhibitor, P053, which inhibits CerS1 with nanomolar potency. Lipidomic profiling shows that P053 is highly selective for CerS1. Daily P053 administration to mice fed a high- fat diet (HFD) increases fatty acid oxidation in skeletal muscle and impedes increases in muscle triglycerides and adiposity, but does not protect against HFD-induced insulin resis- tance. Our inhibitor therefore allowed us to define a role for CerS1 as an endogenous inhibitor of mitochondrial fatty acid oxidation in muscle and regulator of whole-body adiposity. 1 School of Medical Sciences, UNSW Sydney, Sydney 2052 NSW, Australia. 2 Prince of Wales Clinical School, Faculty of Medicine, UNSW Sydney, Sydney 2052 NSW, Australia.
    [Show full text]
  • Supplementary Table 1A. Genes Significantly Altered in A4573 ESFT
    Supplementary Table 1A. Genes significantly altered in A4573 ESFT cells following BMI-1knockdown genesymbol genedescription siControl siBMI1 FC Direction P-value AASS aminoadipate-semialdehyde synthase | tetra-peptide repeat homeobox-like6.68 7.24 1.5 Up 0.007 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 | neural5.44 proliferation,6.3 differentiation1.8 and Upcontrol, 1 0.006 ABHD4 abhydrolase domain containing 4 7.51 6.69 1.8 Down 0.002 ACACA acetyl-Coenzyme A carboxylase alpha | peroxiredoxin 5 | similar6.2 to High mobility7.26 group2.1 protein UpB1 (High mobility0.009 group protein 1) (HMG-1) (Amphoterin) (Heparin-binding protein p30) | Coenzyme A synthase ACAD9 acyl-Coenzyme A dehydrogenase family, member 9 9.25 8.59 1.6 Down 0.008 ACBD3 acyl-Coenzyme A binding domain containing 3 7.89 8.53 1.6 Up 0.008 ACCN2 amiloride-sensitive cation channel 2, neuronal 5.47 6.28 1.8 Up 0.005 ACIN1 apoptotic chromatin condensation inducer 1 7.15 7.79 1.6 Up 0.008 ACPL2 acid phosphatase-like 2 6.04 7.6 2.9 Up 0.000 ACSL4 acyl-CoA synthetase long-chain family member 4 6.72 5.8 1.9 Down 0.001 ACTA2 actin, alpha 2, smooth muscle, aorta 9.18 8.44 1.7 Down 0.003 ACYP1 acylphosphatase 1, erythrocyte (common) type 7.09 7.66 1.5 Up 0.009 ADA adenosine deaminase 6.34 7.1 1.7 Up 0.009 ADAL adenosine deaminase-like 7.88 6.89 2.0 Down 0.006 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 6.57 7.65 2.1 Up 0.000 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 6.49 7.13 1.6 Up 0.008 ADCY9 adenylate cyclase 9 6.5 7.18
    [Show full text]
  • Sphingolipids
    Ectopic expression of ceramide synthase 2 in neurons suppresses neurodegeneration induced by ceramide synthase 1 deficiency Stefka D. Spassievaa,1, Xiaojie Jib,c,1, Ye Liub, Kenneth Gabled, Jacek Bielawskie, Teresa M. Dunnd, Erhard Bieberichf, and Lihong Zhaob,2 aDepartment of Molecular and Cellular Medicine, Texas A&M Health Science Center, College Station, TX 77843; bThe Jackson Laboratory, Bar Harbor, ME 04609; cGraduate School of Biomedical Science and Engineering, University of Maine, Orono, ME 04469; dDepartment of Biochemistry and Molecular Biology, Uniformed Services University of the Health Sciences, Bethesda, MD 20814; eDepartment of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425; and fDepartment of Neuroscience and Regenerative Medicine, Medical College of Georgia/Augusta University, Augusta, GA 30912 Edited by David W. Russell, University of Texas Southwestern Medical Center, Dallas, TX, and approved April 13, 2016 (received for review December 7, 2015) Sphingolipids exhibit extreme functional and chemical diversity suggested to cause apoptosis in certain cancer cells, whereas that is in part determined by their hydrophobic moiety, ceramide. ceramide with a C16 fatty acyl chain (C16 ceramide) has been In mammals, the fatty acyl chain length variation of ceramides is considered prosurvival (10–12). The ceramide profile changes in determined by six (dihydro)ceramide synthase (CerS) isoforms. aging and neurodegenerative brains, but whether these alterations Previously, we and others
    [Show full text]
  • Biological Functions of Sphingomyelin Synthase Related Protein and Ceramide Synthase 4 Investigated with Transgenic Mouse Mutants
    Biological functions of Sphingomyelin synthase related protein and Ceramide synthase 4 investigated with transgenic mouse mutants Dissertation Zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Andreas Bickert aus Neuwied Bonn, 2016 Angefertigt mit Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn Erstgutachter: Prof. Dr. Klaus Willecke Zweitgutachter: Prof. Dr. Michael Hoch Tag der Promotion: 25.10.2016 Erscheinungsjahr: 2017 Table of Contents Table of Contents 1 Introduction.................................................................................................. 1 1.1 Biological lipids ............................................................................................ 1 1.2 Eucaryotic membranes ................................................................................ 3 1.3 Sphingolipids ............................................................................................... 5 1.3.1 Sphingolipid metabolic pathway ................................................................. 6 1.3.1.1 De novo sphingolipid biosynthesis .......................................................... 8 1.3.1.2 The ceramide transfer protein ................................................................. 8 1.3.1.3 Biosynthesis of complex sphingolipids .................................................... 9 1.3.1.4 Sphingolipid degradation and the salvage
    [Show full text]
  • Disorders of Sphingolipid Synthesis, Sphingolipidoses, Niemann-Pick Disease Type C and Neuronal Ceroid Lipofuscinoses
    551 38 Disorders of Sphingolipid Synthesis, Sphingolipidoses, Niemann-Pick Disease Type C and Neuronal Ceroid Lipofuscinoses Marie T. Vanier, Catherine Caillaud, Thierry Levade 38.1 Disorders of Sphingolipid Synthesis – 553 38.2 Sphingolipidoses – 556 38.3 Niemann-Pick Disease Type C – 566 38.4 Neuronal Ceroid Lipofuscinoses – 568 References – 571 J.-M. Saudubray et al. (Eds.), Inborn Metabolic Diseases, DOI 10.1007/978-3-662-49771-5_ 38 , © Springer-Verlag Berlin Heidelberg 2016 552 Chapter 38 · Disor ders of Sphingolipid Synthesis, Sphingolipidoses, Niemann-Pick Disease Type C and Neuronal Ceroid Lipofuscinoses O C 22:0 (Fatty acid) Ganglio- series a series b HN OH Sphingosine (Sphingoid base) OH βββ β βββ β Typical Ceramide (Cer) -Cer -Cer GD1a GT1b Glc ββββ βββ β Gal -Cer -Cer Globo-series GalNAc GM1a GD1b Neu5Ac βαββ -Cer Gb4 ββ β ββ β -Cer -Cer αβ β -Cer GM2 GD2 Sphingomyelin Pcholine-Cer Gb3 B4GALNT1 [SPG46] [SPG26] β β β ββ ββ CERS1-6 GBA2 -Cer -Cer ST3GAL5 -Cer -Cer So1P So Cer GM3 GD3 GlcCer - LacCer UDP-Glc UDP Gal CMP -Neu5Ac - UDP Gal PAPS Glycosphingolipids GalCer Sulfatide ββ Dihydro -Cer -Cer SO 4 Golgi Ceramide apparatus 2-OH- 2-OH-FA Acyl-CoA FA2H CERS1-6 [SPG35] CYP4F22 ω-OH- ω-OH- FA Acyl-CoA ULCFA ULCFA-CoA ULCFA GM1, GM2, GM3: monosialo- Sphinganine gangliosides Endoplasmic GD3, GD2, GD1a, GD1b: disialo-gangliosides reticulum KetoSphinganine GT1b: trisialoganglioside SPTLC1/2 [HSAN1] N-acetyl-neuraminic acid: sialic acid found in normal human cells Palmitoyl-CoA Deoxy-sphinganine + Serine +Ala or Gly Deoxymethylsphinganine 38 . Fig. 38.1 Schematic representation of the structure of the main sphingolipids , and their biosynthetic pathways.
    [Show full text]
  • Functional Analysis of Acyl-Coa Binding Protein in Skin and Sebaceous Glands
    FUNCTIONAL ANALYSIS OF ACYL-COA BINDING PROTEIN IN SKIN AND SEBACEOUS GLANDS Ph.D. Thesis Hanne Engelsby Supervisor Nils J. Færgeman Department of Biochemistry and Molecular Biology Faculty of Science, University of Southern Denmark March 2017 FUNCTIONAL ANALYSIS OF ACYL-COA BINDING PROTEIN IN SKIN AND SEBACEOUS GLANDS PREFACE The work presented in this PhD thesis was performed in Professor Nils J. Færgemans laboratory, Department of Biochemistry and Molecular Biology, University of Southern Denmark. Many people and research groups were involved in the successful obtainment of the results presented here and I would like to express my gratitude and thankfulness to them. First I would like to thank my supervisor Nils J. Færgeman for providing me with the opportunity to carry out this PhD. He has been an excellent guidance and I have enjoyed our fruitful discussions regarding this project. Professor Carien M. Niessen, Department of Dermatology and CECAD Cologne, University of Cologne provided me with an excellent opportunity to carry out my environmental exchange in her laboratory. I am highly grateful for that and for the many fruitful discussions we have had. The members of the Niessen lab always provided me with the help I needed and invited me to their gatherings, which made me feel very welcome in their group. I would especially like to thank Emmi Wachsmuth and Franziska Peters for their excellent guidance in the lab and for introducing me to the many aspects of skin science. I would like to thank present and former members of the Nils J. Færgeman laboratory, who have created a wonderful environment.
    [Show full text]
  • Download Article (PDF)
    Article in press - uncorrected proof BioMol Concepts, Vol. 1 (2010), pp. 411–422 • Copyright ᮊ by Walter de Gruyter • Berlin • New York. DOI 10.1515/BMC.2010.028 Review Ceramide synthases in mammalians, worms, and insects: emerging schemes Andre´ Voelzmann and Reinhard Bauer* plasmic reticulum (ER) by condensing activated palmitate LIMES Institute, Program Unit Development and Genetics, (palmitoyl-CoA) with L-serine through the activity of serine Laboratory for Molecular Developmental Biology, palmitoyl transferase (SPT); (3). The formed intermediate University of Bonn, Carl-Troll-Str. 31, D-53115 Bonn, 3-ketosphinganine is then turned to sphinganine by the 3- Germany ketosphinganine reductase (4). CerS now catalyze the CoA- dependent dihydroceramide synthesis. In this step, CoA * Corresponding author activated fatty acids are used for aminoacylation of sphin- e-mail: [email protected] ganine carbon-2 (Figure 1). The generated dihydroceramide is further converted to ceramide by dihydroceramide desa- turase. Initially, the molecular identity of enzymes and bio- Abstract chemical pathways of the de novo biosynthetic pathway have The ceramide synthase (CerS) gene family comprises a been identified and characterized, especially in mammalian group of highly conserved transmembrane proteins, which cells and the budding yeast Saccharomyces cerevisiae (5–7). are found in all studied eukaryotes. The key feature of the Thus, it became evident that these lipids and enzymes were CerS proteins is their role in ceramide synthase activity. conserved across species and phyla. Therefore, their original name ‘longevity assurance gene (Lass) homologs’, after the founding member, the yeast lon- gevity assurance gene lag1, was altered to ‘CerS’. All CerS Identification of ceramide synthases have high sequence similarity in a domain called LAG1 motif and a subset of CerS proteins is predicted to contain a Although CerS activity was detected previously in 1970 (8), Homeobox (Hox) domain.
    [Show full text]