DOCSLIB.ORG

Biological Functions of Sphingomyelin Synthase Related Protein and Ceramide Synthase 4 Investigated with Transgenic Mouse Mutants

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biological Functions of Sphingomyelin Synthase Related Protein and Ceramide Synthase 4 Investigated with Transgenic Mouse Mutants Biological functions of Sphingomyelin synthase related protein and Ceramide synthase 4 investigated with transgenic mouse mutants Dissertation Zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Andreas Bickert aus Neuwied Bonn, 2016 Angefertigt mit Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn Erstgutachter: Prof. Dr. Klaus Willecke Zweitgutachter: Prof. Dr. Michael Hoch Tag der Promotion: 25.10.2016 Erscheinungsjahr: 2017 Table of Contents Table of Contents 1 Introduction.................................................................................................. 1 1.1 Biological lipids ............................................................................................ 1 1.2 Eucaryotic membranes ................................................................................ 3 1.3 Sphingolipids ............................................................................................... 5 1.3.1 Sphingolipid metabolic pathway ................................................................. 6 1.3.1.1 De novo sphingolipid biosynthesis .......................................................... 8 1.3.1.2 The ceramide transfer protein ................................................................. 8 1.3.1.3 Biosynthesis of complex sphingolipids .................................................... 9 1.3.1.4 Sphingolipid degradation and the salvage pathway .............................. 10 1.3.2 Ceramide synthases ................................................................................ 12 1.3.2.1 Ceramide synthase expression pattern and substrate specificity .......... 14 1.3.2.2 Chain length-specific functions of ceramides ........................................ 15 1.3.2.3 Ceramide synthase deficient mice ........................................................ 17 1.3.2.4 Ceramide synthase 4 ............................................................................ 17 1.3.2.5 Regulation of ceramide synthase activity .............................................. 19 1.3.3 Ceramides in metabolic disease .............................................................. 20 1.3.3.1 Ceramides in the development of obesity and insulin resistance .......... 20 1.3.3.2 Obesity-associated ceramide function in peripheral tissues ................. 21 1.3.3.3 Adipose tissue ....................................................................................... 22 1.3.3.4 Ceramide in the development of diet-induced obesity in mice .............. 24 1.3.3.5 Diet-induced obesity in ceramide synthase deficient mice .................... 25 1.3.4 Sphingomyelin synthase family ................................................................ 27 1.3.4.1 Sphingomyelin synthase 1 and 2 .......................................................... 28 1.3.4.2 Sphingomyelin synthase related protein ............................................... 29 1.4 The mouse as model organism ................................................................. 30 1.4.1 Transgenic mice ....................................................................................... 31 1.4.2 Conditional and non-conditional systems to manipulate gene function .... 31 1.5 Aim of the study......................................................................................... 33 2 Material ....................................................................................................... 34 2.1 Antibodies ................................................................................................. 34 2.2 Primer ........................................................................................................ 34 2.2.1 Primer Real Time-PCR ............................................................................. 36 I Table of Contents 2.3 Southern blot probes ................................................................................. 36 2.4 Bacterial artificial chromosomes ................................................................ 36 2.5 Plasmids .................................................................................................... 37 2.6 Adeno- and lentiviruses ............................................................................. 37 2.7 Primary and immortalized cells ................................................................. 37 2.8 Transgenic mouse lines ............................................................................ 38 2.9 Lipid standards .......................................................................................... 39 2.10 Buffers ....................................................................................................... 40 2.11 Cell culture media ...................................................................................... 40 3 Methods ...................................................................................................... 43 3.1 Nucleic acid analysis ................................................................................. 43 3.1.1 Mouse genotyping .................................................................................... 43 3.1.2 Southern blot analysis .............................................................................. 45 3.1.3 Real Time-PCR analysis .......................................................................... 45 3.2 Protein analysis ......................................................................................... 45 3.2.1 Affinity chromatography of antisera .......................................................... 45 3.2.2 Immunoblot analysis ................................................................................ 46 3.2.3 CPE/SM synthase activity assay .............................................................. 46 3.3 Analysis of PEMT-mediated conversion of CPE in mouse liver ................ 47 3.4 Lipid analysis ............................................................................................. 48 3.4.1 Mass spectrometric analyses (Somerharju group) ................................... 48 3.4.2 Mass spectrometric analyses (Dörmann group) ....................................... 49 3.4.3 Thin layer chromatographic analysis of mouse feces ............................... 50 3.5 Histological analysis .................................................................................. 50 3.5.1 β-galactosidase staining ........................................................................... 50 3.5.2 H&E staining ............................................................................................ 50 3.5.3 Electron microscopy ................................................................................. 51 3.6 Isolation and culture of primary cells ......................................................... 51 3.6.1 Isolation and differentiation of brown preadipocytes ................................ 51 3.6.2 Isolation and differentiation of white preadipocytes .................................. 52 3.7 Physiological activation of energy expenditure in mice ............................. 52 3.8 Feeding experiments ................................................................................. 53 3.8.1 Glucose tolerance test (GTT) ................................................................... 53 3.8.2 Insulin tolerance test (ITT) ........................................................................ 53 3.9 Mouse handling ......................................................................................... 54 3.10 Statistical analyses and image processing ................................................ 54 II Table of Contents 4 Results ....................................................................................................... 55 4.1 Characterization of transgenic mice lacking SMSr catalytic activity .......... 55 4.1.1 SMSrD348E mice ..................................................................................... 55 4.1.2 SMSrdelEx6 mice ..................................................................................... 56 4.1.3 SMSr expression in mice .......................................................................... 58 4.1.3.1 ß-galactosidase staining in SMSrD348E mice ...................................... 58 4.1.3.2 Affinity purification of polyclonal antibodies targeting SMSr .................. 62 4.1.3.3 SMSr tissue-specific expression ........................................................... 62 4.1.3.4 SMSr expression in primary cells .......................................................... 64 4.1.4 Activity and protein expression in SMSrD348E and SMSrdelEx6 mice .... 65 4.1.4.1 CPE synthase activity of mouse SMSr .................................................. 65 4.1.4.2 CPE/SM synthase activity in SMSr and SMS2 mutant mice ................. 67 4.1.4.3 SMSrD348E and SMSrNT-eGFP protein expression ............................. 69 4.1.5 Analysis of sphingolipid content in SMSr and SMS2 mutant mice ........... 69 4.1.5.1 Distribution of CPE and SM in mouse tissues ....................................... 70 4.1.5.2 Impact of SMSr and SMS2 inactivation on tissue CPE and SM levels .. 71 4.1.5.3 Determination of ceramide levels in SMSr and SMS2 mutant mice ...... 76 4.1.6 Ultra-structural analysis of cellular integrity in SMSrD348E mice ............. 81 4.2 Diet-induced obesity in ceramide synthase 4 deficient mice ..................... 84
Load more

Recommended publications
  • P53 and Ceramide As Collaborators in the Stress Response
    Int. J. Mol. Sci. 2013, 14, 4982-5012; doi:10.3390/ijms14034982 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Review p53 and Ceramide as Collaborators in the Stress Response Rouba Hage-Sleiman 1,2,*, Maria O. Esmerian 1,2, Hadile Kobeissy 2 and Ghassan Dbaibo 1,2 1 Department of Pediatrics and Adolescent Medicine, Division of Pediatric Infectious Diseases, Faculty of Medicine, American University of Beirut, P.O. Box 11-0236 Riad El Solh, 1107 2020 Beirut, Lebanon; E-Mails: [email protected] (M.O.E.); [email protected] (G.D.) 2 Department of Biochemistry and Molecular Genetics, Faculty of Medicine, American University of Beirut, P.O. Box 11-0236 Riad El Solh, 1107 2020 Beirut, Lebanon; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +961-1-350-000 (ext. 4883). Received: 26 December 2012; in revised form: 22 January 2013 / Accepted: 1 February 2013 / Published: 1 March 2013 Abstract: The sphingolipid ceramide mediates various cellular processes in response to several extracellular stimuli. Some genotoxic stresses are able to induce p53-dependent ceramide accumulation leading to cell death. However, in other cases, in the absence of the tumor suppressor protein p53, apoptosis proceeds partly due to the activity of this “tumor suppressor lipid”, ceramide. In the current review, we describe ceramide and its roles in signaling pathways such as cell cycle arrest, hypoxia, hyperoxia, cell death, and cancer. In a specific manner, we are elaborating on the role of ceramide in mitochondrial apoptotic cell death signaling.
    [Show full text]
  • Combination of Photodynamic Therapy with Fenretinide and C6
    Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project.
    [Show full text]
  • Targeting Cancer Metabolism to Resensitize Chemotherapy: Potential Development of Cancer Chemosensitizers from Traditional Chinese Medicines
    cancers Review Targeting Cancer Metabolism to Resensitize Chemotherapy: Potential Development of Cancer Chemosensitizers from Traditional Chinese Medicines Wei Guo, Hor-Yue Tan, Feiyu Chen, Ning Wang and Yibin Feng * School of Chinese Medicine, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong SAR 00000, China; [email protected] (W.G.); [email protected] (H.-Y.T.); [email protected] (F.C.); [email protected] (N.W.) * Correspondence: [email protected] Received: 22 December 2019; Accepted: 3 February 2020; Published: 10 February 2020 Abstract: Cancer is a common and complex disease with high incidence and mortality rates, which causes a severe public health problem worldwide. As one of the standard therapeutic approaches for cancer therapy, the prognosis and outcome of chemotherapy are still far from satisfactory due to the severe side effects and increasingly acquired resistance. The development of novel and effective treatment strategies to overcome chemoresistance is urgent for cancer therapy. Metabolic reprogramming is one of the hallmarks of cancer. Cancer cells could rewire metabolic pathways to facilitate tumorigenesis, tumor progression, and metastasis, as well as chemoresistance. The metabolic reprogramming may serve as a promising therapeutic strategy and rekindle the research enthusiasm for overcoming chemoresistance. This review focuses on emerging mechanisms underlying rewired metabolic pathways for cancer chemoresistance in terms of glucose and energy, lipid, amino acid, and nucleotide metabolisms, as well as other related metabolisms. In particular, we highlight the potential of traditional Chinese medicine as a chemosensitizer for cancer chemotherapy from the metabolic perspective. The perspectives of metabolic targeting to chemoresistance are also discussed.
    [Show full text]
  • Inherited Monogenic Defects of Ceramide Metabolism Molecular
    Clinica Chimica Acta 495 (2019) 457–466 Contents lists available at ScienceDirect Clinica Chimica Acta journal homepage: www.elsevier.com/locate/cca Review Inherited monogenic defects of ceramide metabolism: Molecular bases and diagnoses T ⁎⁎ Patricia Dubota,b, Frédérique Sabourdya,b, Jitka Rybovac,Jeffrey A. Medinc,d, , ⁎ Thierry Levadea,b, a Laboratoire de Biochimie Métabolique, Centre de Référence en Maladies Héréditaires du Métabolisme, Institut Fédératif de Biologie, CHU de Toulouse, Toulouse, France b INSERM UMR1037, CRCT (Cancer Research Center of Toulouse), Université Paul Sabatier, Toulouse, France c Department of Pediatrics, Medical College of Wisconsin, Milwaukee, WI, USA d Department of Biochemistry, Medical College of Wisconsin, Milwaukee, WI, USA ABSTRACT Ceramides are membrane lipids implicated in the regulation of numerous biological functions. Recent evidence suggests that specific subsets of molecular species of ceramide may play distinct physiological roles. The importance of this family of molecules in vertebrates is witnessed by the deleterious consequences of genetic alterations in ceramide metabolism. This brief review summarizes the clinical presentation of human disorders due to the deficiency of enzymes involved either in the biosynthesis or the degradation of ceramides. Information on the possible underlying pathophysiological mechanisms is also provided, based on knowledge gathered from animal models of these inherited rare conditions. When appropriate, tools for chemical and molecular diagnosis of these disorders and therapeutic options are also presented. 1. Introduction/foreword relationships that are relevant for unraveling the biological role of these genes and gene products in humans. Studies on ceramides and sphingolipid metabolism have attracted a lot of attention recently. This is largely related to the multiplicity of 2.
    [Show full text]
  • Implications in Parkinson's Disease
    Journal of Clinical Medicine Review Lysosomal Ceramide Metabolism Disorders: Implications in Parkinson’s Disease Silvia Paciotti 1,2 , Elisabetta Albi 3 , Lucilla Parnetti 1 and Tommaso Beccari 3,* 1 Laboratory of Clinical Neurochemistry, Department of Medicine, University of Perugia, Sant’Andrea delle Fratte, 06132 Perugia, Italy; [email protected] (S.P.); [email protected] (L.P.) 2 Section of Physiology and Biochemistry, Department of Experimental Medicine, University of Perugia, Sant’Andrea delle Fratte, 06132 Perugia, Italy 3 Department of Pharmaceutical Sciences, University of Perugia, Via Fabretti, 06123 Perugia, Italy; [email protected] * Correspondence: [email protected] Received: 29 January 2020; Accepted: 20 February 2020; Published: 21 February 2020 Abstract: Ceramides are a family of bioactive lipids belonging to the class of sphingolipids. Sphingolipidoses are a group of inherited genetic diseases characterized by the unmetabolized sphingolipids and the consequent reduction of ceramide pool in lysosomes. Sphingolipidoses include several disorders as Sandhoff disease, Fabry disease, Gaucher disease, metachromatic leukodystrophy, Krabbe disease, Niemann Pick disease, Farber disease, and GM2 gangliosidosis. In sphingolipidosis, lysosomal lipid storage occurs in both the central nervous system and visceral tissues, and central nervous system pathology is a common hallmark for all of them. Parkinson’s disease, the most common neurodegenerative movement disorder, is characterized by the accumulation and aggregation of misfolded α-synuclein that seem associated to some lysosomal disorders, in particular Gaucher disease. This review provides evidence into the role of ceramide metabolism in the pathophysiology of lysosomes, highlighting the more recent findings on its involvement in Parkinson’s disease. Keywords: ceramide metabolism; Parkinson’s disease; α-synuclein; GBA; GLA; HEX A-B; GALC; ASAH1; SMPD1; ARSA * Correspondence [email protected] 1.
    [Show full text]
  • Správa O Činnosti Organizácie SAV Za Rok 2013
    Ústav normálnej a patologickej fyziológie SAV Správa o činnosti organizácie SAV za rok 2013 Bratislava január 2014 Obsah osnovy Správy o činnosti organizácie SAV za rok 2013 1. Základné údaje o organizácii 2. Vedecká činnosť 3. Doktorandské štúdium, iná pedagogická činnosť a budovanie ľudských zdrojov pre vedu a techniku 4. Medzinárodná vedecká spolupráca 5. Vedná politika 6. Spolupráca s VŠ a inými subjektmi v oblasti vedy a techniky 7. Spolupráca s aplikačnou a hospodárskou sférou 8. Aktivity pre Národnú radu SR, vládu SR, ústredné orgány štátnej správy SR a iné organizácie 9. Vedecko-organizačné a popularizačné aktivity 10. Činnosť knižnično-informačného pracoviska 11. Aktivity v orgánoch SAV 12. Hospodárenie organizácie 13. Nadácie a fondy pri organizácii SAV 14. Iné významné činnosti organizácie SAV 15. Vyznamenania, ocenenia a ceny udelené pracovníkom organizácie SAV 16. Poskytovanie informácií v súlade so zákonom o slobodnom prístupe k informáciám 17. Problémy a podnety pre činnosť SAV PRÍLOHY A Zoznam zamestnancov a doktorandov organizácie k 31.12.2013 B Projekty riešené v organizácii C Publikačná činnosť organizácie D Údaje o pedagogickej činnosti organizácie E Medzinárodná mobilita organizácie Správa o činnosti organizácie SAV 1. Základné údaje o organizácii 1.1. Kontaktné údaje Názov: Ústav normálnej a patologickej fyziológie SAV Riaditeľ: RNDr. Oľga Pecháňová, DrSc. Zástupca riaditeľa: MUDr. Fedor Jagla, CSc. Vedecký tajomník: RNDr. Iveta Bernátová, DrSc. Predseda vedeckej rady: RNDr. Iveta Bernátová, DrSc. Členovia snemu SAV: MUDr. Fedor Jagla, CSc., MUDr. Igor Riečanský, PhD. Adresa: Sienkiewiczova 1, 813 71 Bratislava http://www.unpf.sav.sk Tel.: 02/32296063 Fax: E-mail: [email protected] Názvy a adresy detašovaných pracovísk: nie sú Vedúci detašovaných pracovísk: nie sú Typ organizácie: Rozpočtová od roku 1953 1.2.
    [Show full text]
  • Enhancing Skin Health: by Oral Administration of Natural Compounds and Minerals with Implications to the Dermal Microbiome
    Review Enhancing Skin Health: By Oral Administration of Natural Compounds and Minerals with Implications to the Dermal Microbiome David L. Vollmer 1, Virginia A. West 1 and Edwin D. Lephart 2,* 1 4Life Research, Scientific Research Division, Sandy, Utah 84070, USA; [email protected] (D.L.V.); [email protected] (V.A.W) 2 Department of Physiology, Developmental Biology and The Neuroscience Center, Brigham Young University, Provo, Utah 84602, USA * Correspondence: [email protected]; Tel.: +1-801-422-2006 Received: 23 August 2018; Accepted: 1 October 2018; Published: 7 October 2018 Abstract: The history of cosmetics goes back to early Egyptian times for hygiene and health benefits while the history of topical applications that provide a medicinal treatment to combat dermal aging is relatively new. For example, the term cosmeceutical was first coined by Albert Kligman in 1984 to describe topical products that afford both cosmetic and therapeutic benefits. However, beauty comes from the inside. Therefore, for some time scientists have considered how nutrition reflects healthy skin and the aging process. The more recent link between nutrition and skin aging began in earnest around the year 2000 with the demonstrated increase in peer-reviewed scientific journal reports on this topic that included biochemical and molecular mechanisms of action. Thus, the application of: (a) topical administration from outside into the skin and (b) inside by oral consumption of nutritionals to the outer skin layers is now common place and many journal reports exhibit significant improvement for both on a variety of dermal parameters. Therefore, this review covers, where applicable, the history, chemical structure, and sources such as biological and biomedical properties in the skin along with animal and clinical data on the oral applications of: (a) collagen, (b) ceramide, (c) β-carotene, (d) astaxanthin, (e) coenzyme Q10, (f) colostrum, (g) zinc, and (h) selenium in their mode of action or function in improving dermal health by various quantified endpoints.
    [Show full text]
  • 0.5) in Stat3∆/∆ Compared with Stat3flox/Flox
    Supplemental Table 2 Genes down-regulated (<0.5) in Stat3∆/∆ compared with Stat3flox/flox Probe ID Gene Symbol Gene Description Entrez gene ID 1460599_at Ermp1 endoplasmic reticulum metallopeptidase 1 226090 1460463_at H60c histocompatibility 60c 670558 1460431_at Gcnt1 glucosaminyl (N-acetyl) transferase 1, core 2 14537 1459979_x_at Zfp68 zinc finger protein 68 24135 1459747_at --- --- --- 1459608_at --- --- --- 1459168_at --- --- --- 1458718_at --- --- --- 1458618_at --- --- --- 1458466_at Ctsa cathepsin A 19025 1458345_s_at Colec11 collectin sub-family member 11 71693 1458046_at --- --- --- 1457769_at H60a histocompatibility 60a 15101 1457680_a_at Tmem69 transmembrane protein 69 230657 1457644_s_at Cxcl1 chemokine (C-X-C motif) ligand 1 14825 1457639_at Atp6v1h ATPase, H+ transporting, lysosomal V1 subunit H 108664 1457260_at 5730409E04Rik RIKEN cDNA 5730409E04Rik gene 230757 1457070_at --- --- --- 1456893_at --- --- --- 1456823_at Gm70 predicted gene 70 210762 1456671_at Tbrg3 transforming growth factor beta regulated gene 3 21378 1456211_at Nlrp10 NLR family, pyrin domain containing 10 244202 1455881_at Ier5l immediate early response 5-like 72500 1455576_at Rinl Ras and Rab interactor-like 320435 1455304_at Unc13c unc-13 homolog C (C. elegans) 208898 1455241_at BC037703 cDNA sequence BC037703 242125 1454866_s_at Clic6 chloride intracellular channel 6 209195 1453906_at Med13l mediator complex subunit 13-like 76199 1453522_at 6530401N04Rik RIKEN cDNA 6530401N04 gene 328092 1453354_at Gm11602 predicted gene 11602 100380944 1453234_at
    [Show full text]
  • Understanding the Molecular Pathobiology of Acid Ceramidase Deficiency
    Understanding the Molecular Pathobiology of Acid Ceramidase Deficiency By Fabian Yu A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto © Copyright by Fabian PS Yu 2018 Understanding the Molecular Pathobiology of Acid Ceramidase Deficiency Fabian Yu Doctor of Philosophy Institute of Medical Science University of Toronto 2018 Abstract Farber disease (FD) is a devastating Lysosomal Storage Disorder (LSD) caused by mutations in ASAH1, resulting in acid ceramidase (ACDase) deficiency. ACDase deficiency manifests along a broad spectrum but in its classical form patients die during early childhood. Due to the scarcity of cases FD has largely been understudied. To circumvent this, our lab previously generated a mouse model that recapitulates FD. In some case reports, patients have shown signs of visceral involvement, retinopathy and respiratory distress that may lead to death. Beyond superficial descriptions in case reports, there have been no in-depth studies performed to address these conditions. To improve the understanding of FD and gain insights for evaluating future therapies, we performed comprehensive studies on the ACDase deficient mouse. In the visual system, we reported presence of progressive uveitis. Further tests revealed cellular infiltration, lipid buildup and extensive retinal pathology. Mice developed retinal dysplasia, impaired retinal response and decreased visual acuity. Within the pulmonary system, lung function tests revealed a decrease in lung compliance. Mice developed chronic lung injury that was contributed by cellular recruitment, and vascular leakage. Additionally, we report impairment to lipid homeostasis in the lungs. ii To understand the liver involvement in FD, we characterized the pathology and performed transcriptome analysis to identify gene and pathway changes.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]