Sphingolipids
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Combination of Photodynamic Therapy with Fenretinide and C6
Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project. -
Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase -
HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal -
Supplementary File 2A Revised
Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06 -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
A Selective Inhibitor of Ceramide Synthase 1 Reveals a Novel Role in Fat Metabolism
ARTICLE DOI: 10.1038/s41467-018-05613-7 OPEN A selective inhibitor of ceramide synthase 1 reveals a novel role in fat metabolism Nigel Turner1, Xin Ying Lim2,3, Hamish D. Toop 4, Brenna Osborne 1, Amanda E. Brandon5, Elysha N. Taylor4, Corrine E. Fiveash1, Hemna Govindaraju1, Jonathan D. Teo3, Holly P. McEwen3, Timothy A. Couttas3, Stephen M. Butler4, Abhirup Das1, Greg M. Kowalski 6, Clinton R. Bruce6, Kyle L. Hoehn 7, Thomas Fath1,10, Carsten Schmitz-Peiffer8, Gregory J. Cooney5, Magdalene K. Montgomery1, Jonathan C. Morris 4 & Anthony S. Don3,9 1234567890():,; Specific forms of the lipid ceramide, synthesized by the ceramide synthase enzyme family, are believed to regulate metabolic physiology. Genetic mouse models have established C16 ceramide as a driver of insulin resistance in liver and adipose tissue. C18 ceramide, syn- thesized by ceramide synthase 1 (CerS1), is abundant in skeletal muscle and suggested to promote insulin resistance in humans. We herein describe the first isoform-specific ceramide synthase inhibitor, P053, which inhibits CerS1 with nanomolar potency. Lipidomic profiling shows that P053 is highly selective for CerS1. Daily P053 administration to mice fed a high- fat diet (HFD) increases fatty acid oxidation in skeletal muscle and impedes increases in muscle triglycerides and adiposity, but does not protect against HFD-induced insulin resis- tance. Our inhibitor therefore allowed us to define a role for CerS1 as an endogenous inhibitor of mitochondrial fatty acid oxidation in muscle and regulator of whole-body adiposity. 1 School of Medical Sciences, UNSW Sydney, Sydney 2052 NSW, Australia. 2 Prince of Wales Clinical School, Faculty of Medicine, UNSW Sydney, Sydney 2052 NSW, Australia. -
Lipid Signalling Dynamics of Palmitate- Induced Endoplasmic Reticulum Stress in Skeletal Muscle
Lipid signalling dynamics of palmitate- induced endoplasmic reticulum stress in skeletal muscle A dissertation submitted for the degree of Doctor of Philosophy at the University of Cambridge. Submitted September 2018. Ben Daniel McNally King’s College “Obviously my method of thought and reasoning is influenced by a scientific training – if that were not so my scientific training will have been a waste and a failure.” Rosalind Franklin – taken from a letter to her father, Ellis Franklin, undated (approximately 1940). “I was taught that the way of progress is neither swift nor easy.” Marie Curie - Taken from Pierre Curie (1936). “Machines will do the heavy work, Men will supervise the machines, You owe much to these machines, Horsepower, not manpower, Brains, not brawn.” Progress by Public Service Broadcasting, released in 2017. Declaration This dissertation is the result of my own work and includes nothing which is the outcome of work done in collaboration except as declared in the Preface and specified in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. -
Investigation of Adiposity Phenotypes in AA Associated with GALNT10 & Related Pathway Genes
Investigation of Adiposity Phenotypes in AA Associated With GALNT10 & Related Pathway Genes By Mary E. Stromberg A Dissertation Submitted to the Graduate Faculty of WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY In Molecular Genetics and Genomics December 2018 Winston-Salem, North Carolina Approved by: Donald W. Bowden, Ph.D., Advisor Maggie C.Y. Ng, Ph.D., Advisor Timothy D. Howard, Ph.D., Chair Swapan Das, Ph.D. John P. Parks, Ph.D. Acknowledgements I would first like to thank my mentors, Dr. Bowden and Dr. Ng, for guiding my learning and growth during my years at Wake Forest University School of Medicine. Thank you Dr. Ng for spending so much time ensuring that I learn every detail of every protocol, and supporting me through personal difficulties over the years. Thank you Dr. Bowden for your guidance in making me a better scientist and person. I would like to thank my committee for their patience and the countless meetings we have had in discussing this project. I would like to say thank you to the members of our lab as well as the Parks lab for their support and friendship as well as their contributions to my project. Special thanks to Dean Godwin for his support and understanding. The umbrella program here at WFU has given me the chance to meet some of the best friends I could have wished for. I would like to also thank those who have taught me along the way and helped me to get to this point of my life, with special thanks to the late Dr. -
Effects of Ceramide Synthase 2 Deletion on the Infectivity of HIV-1
Effects of ceramide synthase 2 deletion on the infectivity of HIV-1 Eric Barklis1*, Ayna Alfadhli1, Jennifer E. Kyle2, Lisa M. Bramer3, Kent J. Bloodsworth2, Robin Lid Barklis1, Hans C. Leier1, R. Max Petty1, Iris D. Zelnik4, Thomas O. Metz2, Anthony H. Futerman4, Fikadu G. Tafesse1* 1Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, Oregon, USA 2Biological Sciences Division, Earth and Biological Sciences Directorate, Pacific Northwest National Laboratory (PNNL), Richland, WA, USA 3Computing and Analytics Division, National Security Directorate PNNL, Richland, WA, USA 4Department of Biomolecular Sciences, Weizmann Institute of Science, Rehovot, Israel * Corresponding authors: Eric Barklis and Fikadu G. Tafesse Email: [email protected], [email protected] Running title: Ceramide synthase 2 effects on HIV-1 Env Keywords: ceramide, ceramide synthase, sphingolipid, human immunodeficiency virus (HIV), fusion protein 1 ABSTRACT The lipid composition of human immunodefiency virus 1 (HIV-1) virions is enriched in sphingomyelin, but the roles that sphingomyelin or other sphingolipids might play in the HIV-1 replication pathway have not been elucidated. In human cells, sphingolipid levels are regulated by ceramide synthase (CerS) enzymes that lead to the production of ceramides, which can be converted to sphingomyelins, hexosylceramides, and other sphingolipids. In many cell types, CerS2, which catalyzes the synthesis of very long chain ceramides, is the major CerS. We have examined how CerS2 deficiency affects the assembly and infectivity of HIV-1. As expected, we observed that very long chain ceramide, hexosylceramide, and sphingomyelin levels were reduced in CerS2 knockout cells. CerS2 deficiency did not affect HIV-1 assembly or the incorporation of the HIV-1 envelope (Env) protein into virus particles, but it reduced the infectivites of viruses produced in the CerS2-deficient cells. -
Supplementary Table 1A. Genes Significantly Altered in A4573 ESFT
Supplementary Table 1A. Genes significantly altered in A4573 ESFT cells following BMI-1knockdown genesymbol genedescription siControl siBMI1 FC Direction P-value AASS aminoadipate-semialdehyde synthase | tetra-peptide repeat homeobox-like6.68 7.24 1.5 Up 0.007 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 | neural5.44 proliferation,6.3 differentiation1.8 and Upcontrol, 1 0.006 ABHD4 abhydrolase domain containing 4 7.51 6.69 1.8 Down 0.002 ACACA acetyl-Coenzyme A carboxylase alpha | peroxiredoxin 5 | similar6.2 to High mobility7.26 group2.1 protein UpB1 (High mobility0.009 group protein 1) (HMG-1) (Amphoterin) (Heparin-binding protein p30) | Coenzyme A synthase ACAD9 acyl-Coenzyme A dehydrogenase family, member 9 9.25 8.59 1.6 Down 0.008 ACBD3 acyl-Coenzyme A binding domain containing 3 7.89 8.53 1.6 Up 0.008 ACCN2 amiloride-sensitive cation channel 2, neuronal 5.47 6.28 1.8 Up 0.005 ACIN1 apoptotic chromatin condensation inducer 1 7.15 7.79 1.6 Up 0.008 ACPL2 acid phosphatase-like 2 6.04 7.6 2.9 Up 0.000 ACSL4 acyl-CoA synthetase long-chain family member 4 6.72 5.8 1.9 Down 0.001 ACTA2 actin, alpha 2, smooth muscle, aorta 9.18 8.44 1.7 Down 0.003 ACYP1 acylphosphatase 1, erythrocyte (common) type 7.09 7.66 1.5 Up 0.009 ADA adenosine deaminase 6.34 7.1 1.7 Up 0.009 ADAL adenosine deaminase-like 7.88 6.89 2.0 Down 0.006 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 6.57 7.65 2.1 Up 0.000 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 6.49 7.13 1.6 Up 0.008 ADCY9 adenylate cyclase 9 6.5 7.18 -
Ceramide Synthase TLCD3B Is a Novel Gene Associated with Human Recessive Retinal Dystrophy
Ceramide synthase TLCD3B is a novel gene associated with human recessive retinal dystrophy Renae Elaine Bertrand B.S.,1,2 Jun Wang Ph.D.,2,3 Kaitlyn H. Xiong B.S.,2,4 Chinthana Thangavel,2,4 Xinye Qian B.A.,1,2 Rola Ba-Abbad FRCS Ph.D.,5 Qingnan Liang M.S.,1,2 Renata T. Simões,6 Shirley A. M. Sampaio,7 Keren J. Carss Ph.D.,8,9 F. Lucy Raymond M.D. Ph.D.,8,10 Anthony G. Robson M.Sc. Ph.D.,11 Andrew R. Webster FRCOphth,5,11 Gavin Arno Ph.D.,5,11,12 Fernanda Belga Ottoni Porto M.D. Ph.D.,7 Rui Chen Ph.D.2,3,* 1 Verna and Marrs McLean Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX 77030, USA 2 Human Genome Sequencing Center, Baylor College of Medicine, Houston, TX 77030, USA 3 Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA 4 Department of BioSciences, Rice University, Houston, TX 77005, USA 5 Moorfields Eye Hospital, London, EC1V 2PD, UK 6 Instituto de Ensino e Pesquisa da Santa Casa de Belo Horizonte (IEP/SCBH), Minas Gerais, Brazil 7 INRET Clínica e Centro de Pesquisa, Belo Horizonte, Minas Gerais, Brazil 8 Department of Haematology, University of Cambridge, Cambridge, UK 9 NIHR BioResource-Rare Diseases, Cambridge University Hospitals, Cambridge Biomedical Campus, Cambridge, UK 10 Department of Medical Genetics, Cambridge Institute for Medical Research, University of Cambridge, Cambridge, UK 11 UCL Institute of Ophthalmology, London, EC1V 9EL, UK 12 Great Ormond Street Hospital for Children, London, UK * Rui Chen, 713-798-5194, [email protected] 1 ABSTRACT Purpose Previous studies suggest that ceramide is a proapoptotic lipid as high levels of ceramides can lead to apoptosis of neuronal cells, including photoreceptors. -
Biological Functions of Sphingomyelin Synthase Related Protein and Ceramide Synthase 4 Investigated with Transgenic Mouse Mutants
Biological functions of Sphingomyelin synthase related protein and Ceramide synthase 4 investigated with transgenic mouse mutants Dissertation Zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Andreas Bickert aus Neuwied Bonn, 2016 Angefertigt mit Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn Erstgutachter: Prof. Dr. Klaus Willecke Zweitgutachter: Prof. Dr. Michael Hoch Tag der Promotion: 25.10.2016 Erscheinungsjahr: 2017 Table of Contents Table of Contents 1 Introduction.................................................................................................. 1 1.1 Biological lipids ............................................................................................ 1 1.2 Eucaryotic membranes ................................................................................ 3 1.3 Sphingolipids ............................................................................................... 5 1.3.1 Sphingolipid metabolic pathway ................................................................. 6 1.3.1.1 De novo sphingolipid biosynthesis .......................................................... 8 1.3.1.2 The ceramide transfer protein ................................................................. 8 1.3.1.3 Biosynthesis of complex sphingolipids .................................................... 9 1.3.1.4 Sphingolipid degradation and the salvage