Mechanism of Repression by the Sequence-Specific Mrna-Binding Protein Vts1p

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Mechanism of Repression by the Sequence-Specific mRNA-Binding Protein Vts1p by Melissa Alice Bieman A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto © Copyright by Melissa A. Bieman 2014 Mechanism of Repression by the Sequence-Specific mRNA Binding Protein Vts1p Melissa A. Bieman Doctor of Philosophy Department of Biochemistry University of Toronto 2014 Abstract Vts1p is a member of the Smaug family of sequence-specific RNA binding proteins that interact with stem-loop sequences to degrade and/or translationally repress target transcripts. To identify the molecular mechanism by which Vts1p represses target transcripts, I have investigated the role of one of Vts1p’s conserved domains, the SSR1 domain, in Vts1p-mediated repression. In vitro SSR1 functions as a dimerization domain and I provide evidence that SSR1 mediates dimerization in vivo. I have created Vts1p mutants which abolish dimerization and found that dimerization is required for full Vts1p-mediated repression and robust destabilization of a reporter containing two SREs. My data supports a model whereby dimerization of Vts1p functions to enhance binding of Vts1p to a target transcript carrying two or more SREs. Analysis of putative Vts1p mRNA targets suggests that dimerization may be important for proper repression of many target transcripts since a majority contain multiple SREs. I have also shown that Vts1p interacts with the Ccr4p/Pop2p/Not deadenylase in an RNA independent fashion. This is consistent with the model that Vts1p recruits the Ccr4p/Pop2p/Not deadenylase to target transcripts to induce deadenylation and subsequent degradation. ii Finally, by tethering Vts1p to a reporter construct, I have shown that two separate regions of Vts1p, the N-terminus and the C-terminus, are sufficient for repression, suggesting that Vts1p employs multiple mechanisms to regulate the expression of target mRNAs. I have also shown that the N-terminus contains a conserved motif that functions in Vts1p-mediated translational repression while playing no role in transcript decay. This is the first evidence that Vts1p mediates the translational repression of a target transcript. iii Acknowledgments “every day is a journey, and the journey itself is home.” -Matsuo Basho First, thank you to my supervisor, Craig Smibert, for allowing me to embark on this journey, and for his guidance and patience along the way. He has helped to shape the way I think about science. Thank you also to my committee members Grant Brown and Howard Lipshitz for their insight and support throughout my projects. Thank you to my lab mates Meryl Nelson, Heli Vari, Ben Pinder, Laura Rendl, Jason Dumelie, John Laver, Agata Orlowicz, Alex Marsolais, Matthew Cheng and Peter Sollazzo for their company, advice, ideas and entertainment. My thanks go to the members of the Segall, Brown, Andrews and Boone lab for their scientific expertise and their generosity with reagents and strains. Thank you to my family for their continual encouragement and interest along the way, even though they didn’t always understand the science. Finally, thank you to my traveling companion and husband, Albert Fuchigami, who has been unwavering in his encouragement and support during this leg of the journey and into the next one. iv Table of Contents Acknowledgments .......................................................................................................................... iv Table of Contents ........................................................................................................................... iv List of Figures .............................................................................................................................. viii List of Appendices ......................................................................................................................... ix List of Abbreviations ...................................................................................................................... x Chapter 1 Introduction .................................................................................................................... 1 1.1 Post-transcriptional Regulation ........................................................................................... 2 1.2 Translational Regulation ..................................................................................................... 3 1.2.1 Cap-Dependent Translation Initiation ..................................................................... 3 1.2.2 Regulation of Translation Factors ........................................................................... 5 1.3 Mechanisms of mRNA Degradation ................................................................................... 6 1.3.1 Deadenylation-Dependent Decay ........................................................................... 7 1.3.1.1 Deadenylation Enzymes ........................................................................... 7 1.3.1.2 Decapping ................................................................................................. 9 1.3.1.3 5’-3’ Exonucleolytic Decay .................................................................... 10 1.3.1.4 3’-5’ Exonucleolytic Decay .................................................................... 11 1.3.1.5 P Bodies .................................................................................................. 11 1.3.2 Regulated mRNA Degradation ............................................................................. 13 1.3.2.1 Nonsense Mediated Decay (NMD) ........................................................ 13 1.3.2.2 No-Go Decay .......................................................................................... 14 1.3.2.3 Non-stop Decay ...................................................................................... 15 1.4 mRNA Regulation by Sequence-Specific RNA Binding Proteins ................................... 15 1.4.1 AU-Rich Binding Proteins .................................................................................... 15 1.4.2 Puf Family of Proteins .......................................................................................... 16 v 1.4.3 Iron Homeostasis by Iron Regulatory Proteins ..................................................... 17 1.4.4 Translational regulation by modulation of polyadenylation ................................. 18 1.4.5 miRNA-Mediated Post-transcriptional Regulation ............................................... 19 1.5 The Smaug (Smg) Family of Proteins .............................................................................. 20 1.5.1 Drosophila Smg .................................................................................................... 21 1.5.1.1 Smg-mediated post-transcriptional regulation of nos mRNA ................ 23 1.5.1.2 Smg-mediated mRNA degradation ........................................................ 25 1.5.1.3 Smg is a major regulator of mRNA stability .......................................... 26 1.5.2 Mammalian Smg ................................................................................................... 26 1.5.3 The S. cerevisiae homolog Vts1p ........................................................................ 27 1.6 Thesis Rationale ................................................................................................................ 28 Chapter 2 Materials and Mesthods ............................................................................................... 29 2.1 Yeast Strains ..................................................................................................................... 30 2.2 Plasmids ............................................................................................................................ 30 2.3 Immunoprecipitations ....................................................................................................... 30 2.4 Flow Cytometry ................................................................................................................ 31 2.5 Transcriptional Pulse Chase .............................................................................................. 31 2.6 SRE searching ................................................................................................................... 32 Chapter 3 The SSR1 domain is a dimerization domain involved in Vts1p-mediated repression . 33 3.1 Introduction ....................................................................................................................... 34 3.2 Results ............................................................................................................................... 36 3.2.1 Vts1 dimerizes in vivo though it’s SSR1 domain ................................................. 36 3.2.2 Dimerization mutants show defects in Vts1p-mediated repression and transcript decay ..................................................................................................... 38 3.2.3 Dimerization affects Vts1p function through a combination of mechanisms ....... 41 3.2.4 A large fraction of Vts1p target mRNAs possess two or more SREs. .................. 44 vi 3.3 Discussion ......................................................................................................................... 46 Chapter 4 The N-terminus of Vts1p mediates translational repression ........................................ 49 4.1
Recommended publications
  • Download Validation Data

    Download Validation Data

    PrimePCR™Assay Validation Report Gene Information Gene Name signal sequence receptor, beta (translocon-associated protein beta) Gene Symbol SSR2 Organism Human Gene Summary The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. Gene Aliases DKFZp686F19123, TLAP, TRAP-BETA, TRAPB RefSeq Accession No. NC_000001.10, NT_004487.19 UniGene ID Hs.74564 Ensembl Gene ID ENSG00000163479 Entrez Gene ID 6746 Assay Information Unique Assay ID qHsaCID0014663 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000295702, ENST00000529008, ENST00000480567, ENST00000531917, ENST00000526212 Amplicon Context Sequence GGGGCAATCCGGTCCCATTTGACATTGAGCATTCCAGACACAATGCCAAAGTCT TCTGGAGGGAAGGAATCATCAGATAGTTCCACGTCTAATGCAGCACTTGAGCCA ACATTGTAGATGTTGTACTGCAAGGTCAGGTCTCGTCCC Amplicon Length (bp) 117 Chromosome Location 1:155988061-155989851 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9998 cDNA Cq 17.45 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SSR2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?

    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
  • A Crosstalk Between the RNA Binding Protein Smaug and the Hedgehog Pathway Links Cell Signaling to Mrna Regulation in Drosophila Lucía Bruzzone

    A Crosstalk Between the RNA Binding Protein Smaug and the Hedgehog Pathway Links Cell Signaling to Mrna Regulation in Drosophila Lucía Bruzzone

    A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila Lucía Bruzzone To cite this version: Lucía Bruzzone. A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila. Cellular Biology. Université Sorbonne Paris Cité, 2018. English. NNT : 2018USPCC234. tel-02899776 HAL Id: tel-02899776 https://tel.archives-ouvertes.fr/tel-02899776 Submitted on 15 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Thèse de doctorat de l’Université Sorbonne Paris Cité Préparée à l’Université Paris Diderot Ecole doctorale HOB n° 561 Institut Jacques Monod / Equipe Développement, Signalisation et Trafic A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in Drosophila Lucía Bruzzone Thèse de doctorat de Biologie Dirigée par Anne Plessis Présentée et soutenue publiquement à Paris le 19 mars 2018 Président du jury: Alain Zider / Professeur Université Paris Diderot
  • Disease-Related Cellular Protein Networks Differentially Affected

    Disease-Related Cellular Protein Networks Differentially Affected

    www.nature.com/scientificreports OPEN Disease‑related cellular protein networks diferentially afected under diferent EGFR mutations in lung adenocarcinoma Toshihide Nishimura1,8*, Haruhiko Nakamura1,2,8, Ayako Yachie3,8, Takeshi Hase3,8, Kiyonaga Fujii1,8, Hirotaka Koizumi4, Saeko Naruki4, Masayuki Takagi4, Yukiko Matsuoka3, Naoki Furuya5, Harubumi Kato6,7 & Hisashi Saji2 It is unclear how epidermal growth factor receptor EGFR major driver mutations (L858R or Ex19del) afect downstream molecular networks and pathways. This study aimed to provide information on the infuences of these mutations. The study assessed 36 protein expression profles of lung adenocarcinoma (Ex19del, nine; L858R, nine; no Ex19del/L858R, 18). Weighted gene co-expression network analysis together with analysis of variance-based screening identifed 13 co-expressed modules and their eigen proteins. Pathway enrichment analysis for the Ex19del mutation demonstrated involvement of SUMOylation, epithelial and mesenchymal transition, ERK/mitogen- activated protein kinase signalling via phosphorylation and Hippo signalling. Additionally, analysis for the L858R mutation identifed various pathways related to cancer cell survival and death. With regard to the Ex19del mutation, ROCK, RPS6KA1, ARF1, IL2RA and several ErbB pathways were upregulated, whereas AURK and GSKIP were downregulated. With regard to the L858R mutation, RB1, TSC22D3 and DOCK1 were downregulated, whereas various networks, including VEGFA, were moderately upregulated. In all mutation types, CD80/CD86 (B7), MHC, CIITA and IFGN were activated, whereas CD37 and SAFB were inhibited. Costimulatory immune-checkpoint pathways by B7/CD28 were mainly activated, whereas those by PD-1/PD-L1 were inhibited. Our fndings may help identify potential therapeutic targets and develop therapeutic strategies to improve patient outcomes.
  • Newly Identified Gon4l/Udu-Interacting Proteins

    Newly Identified Gon4l/Udu-Interacting Proteins

    www.nature.com/scientificreports OPEN Newly identifed Gon4l/ Udu‑interacting proteins implicate novel functions Su‑Mei Tsai1, Kuo‑Chang Chu1 & Yun‑Jin Jiang1,2,3,4,5* Mutations of the Gon4l/udu gene in diferent organisms give rise to diverse phenotypes. Although the efects of Gon4l/Udu in transcriptional regulation have been demonstrated, they cannot solely explain the observed characteristics among species. To further understand the function of Gon4l/Udu, we used yeast two‑hybrid (Y2H) screening to identify interacting proteins in zebrafsh and mouse systems, confrmed the interactions by co‑immunoprecipitation assay, and found four novel Gon4l‑interacting proteins: BRCA1 associated protein‑1 (Bap1), DNA methyltransferase 1 (Dnmt1), Tho complex 1 (Thoc1, also known as Tho1 or HPR1), and Cryptochrome circadian regulator 3a (Cry3a). Furthermore, all known Gon4l/Udu‑interacting proteins—as found in this study, in previous reports, and in online resources—were investigated by Phenotype Enrichment Analysis. The most enriched phenotypes identifed include increased embryonic tissue cell apoptosis, embryonic lethality, increased T cell derived lymphoma incidence, decreased cell proliferation, chromosome instability, and abnormal dopamine level, characteristics that largely resemble those observed in reported Gon4l/udu mutant animals. Similar to the expression pattern of udu, those of bap1, dnmt1, thoc1, and cry3a are also found in the brain region and other tissues. Thus, these fndings indicate novel mechanisms of Gon4l/ Udu in regulating CpG methylation, histone expression/modifcation, DNA repair/genomic stability, and RNA binding/processing/export. Gon4l is a nuclear protein conserved among species. Animal models from invertebrates to vertebrates have shown that the protein Gon4-like (Gon4l) is essential for regulating cell proliferation and diferentiation.
  • Case Report an Adolescent with a Rare De Novo Distal Trisomy 6P and Distal Monosomy 6Q Chromosomal Combination

    Case Report an Adolescent with a Rare De Novo Distal Trisomy 6P and Distal Monosomy 6Q Chromosomal Combination

    Hindawi Case Reports in Genetics Volume 2020, Article ID 8857628, 8 pages https://doi.org/10.1155/2020/8857628 Case Report An Adolescent with a Rare De Novo Distal Trisomy 6p and Distal Monosomy 6q Chromosomal Combination Leia A. Peterman , Gail H. Vance, Erin E. Conboy, Katelynn Anderson, and David D. Weaver Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN, USA Correspondence should be addressed to David D. Weaver; [email protected] Received 15 April 2020; Revised 11 August 2020; Accepted 23 August 2020; Published 31 August 2020 Academic Editor: Silvia Paracchini Copyright © 2020 Leia A. Peterman et al. (is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. We report on a 12-year-old female with both a partial duplication and deletion involving chromosome 6. (e duplication involves 6p25.3p24.3 (7.585 Mb) while the deletion includes 6q27q27 (6.244 Mb). (is chromosomal abnormality is also described as distal trisomy 6p and distal monosomy 6q. (e patient has a Chiari II malformation, hydrocephalus, agenesis of the corpus callosum, microcephaly, bilateral renal duplicated collecting system, scoliosis, and myelomeningocele associated with a neurogenic bladder and bladder reflux. Additional features have included seizures, feeding dysfunction, failure to thrive, sleep apnea, global de- velopmental delay, intellectual disability, and absent speech. To our knowledge, our report is just the sixth case in the literature with concomitant distal 6p duplication and distal 6q deletion. Although a majority of chromosomal duplication-deletion cases have resulted from a parental pericentric inversion, the parents of our case have normal chromosomes.
  • A Regulator of Innate Immune Responses

    A Regulator of Innate Immune Responses

    (19) TZZ ¥_T (11) EP 2 942 357 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 11.11.2015 Bulletin 2015/46 C07K 14/47 (2006.01) A61K 38/00 (2006.01) C12N 15/113 (2010.01) (21) Application number: 15169327.2 (22) Date of filing: 04.08.2009 (84) Designated Contracting States: (72) Inventor: Barber, Glen N. AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Palmetto Bay, FL 33157 (US) HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR (74) Representative: Inspicos A/S Kogle Allé 2 (30) Priority: 04.08.2008 US 129975 P P.O. Box 45 2970 Hørsholm (DK) (62) Document number(s) of the earlier application(s) in accordance with Art. 76 EPC: Remarks: 09805473.7 / 2 324 044 This application was filed on 27-05-2015 as a divisional application to the application mentioned (71) Applicant: Barber, Glen N. under INID code 62. Palmetto Bay, FL 33157 (US) (54) STING (STIMULATOR OF INTEFERON GENES), A REGULATOR OF INNATE IMMUNE RESPONSES (57) Novel molecules termed STING which include STING compositions are useful for the treatment of an nucleic acids, polynucleotides, oligonucleotides, pep- immune-related disorder, including treating and prevent- tides, mutants, variants and active fragments thereof, ing infection by modulating immunity. modulate innate and adaptive immunity in a subject. EP 2 942 357 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 942 357 A1 Description RELATED APPLICATIONS 5 [0001] This application claims priority under 35 USC § 119 to U.S.
  • Quantitative Proteomics Links the LRRC59 Interactome to Mrna Translation on the ER Membrane

    Quantitative Proteomics Links the LRRC59 Interactome to Mrna Translation on the ER Membrane

    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.04.975474; this version posted March 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Quantitative proteomics links the LRRC59 interactome to mRNA translation on the ER membrane Molly M. Hannigan1,†, Alyson M. Hoffman2,†, J. Will Thompson3,4, Tianli Zheng1, and Christopher V. Nicchitta1,2* Departments of Cell Biology1, Biochemistry2 and Pharmacology and Cancer Biology3 Duke Proteomics and Metabolomics Shared Resource4 Duke University School of Medicine Durham, North Carolina, 27710 USA * To whom correspondence should be addressed: ORCID: 0000-0001-7889-1155 E-mail: [email protected] Department of Cell Biology, Box 3709 Duke University School of Medicine Durham, NC 27705 USA †: Equal first authors Condensed title: Spatial organization of the endoplasmic reticulum 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.04.975474; this version posted March 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Summary 2 Hannigan et al. characterize the protein interactomes of four ER ribosome-binding 3 proteins, providing evidence that ER-bound ribosomes reside in distinct molecular 4 environments. Their data link SEC62 to ER redox regulation and chaperone trafficking, 5 and suggest a role for LRRC59 in SRP-coupled protein synthesis.
  • Datasheet A06993-1 Anti-TRAP Alpha/TRAPA/SSR1 Antibody

    Datasheet A06993-1 Anti-TRAP Alpha/TRAPA/SSR1 Antibody

    Product datasheet Anti-TRAP alpha/TRAPA/SSR1 Antibody Catalog Number: A06993-1 BOSTER BIOLOGICAL TECHNOLOGY Special NO.1, International Enterprise Center, 2nd Guanshan Road, Wuhan, China Web: www.boster.com.cn Phone: +86 27 67845390 Fax: +86 27 67845390 Email: [email protected] Basic Information Product Name Anti-TRAP alpha/TRAPA/SSR1 Antibody Gene Name SSR1 Source Rabbit IgG Species Reactivity human, mouse, rat, monkey Tested Application WB, IHC-P, ICC/IF, FCM, Direct ELISA Contents 500 ug/ml antibody with PBS ,0.02% NaN3 , 1mg BSA and 50% glycerol. Immunogen E.coli-derived human SSR1 recombinant protein (Position: E53-E286). Purification Immunogen affinity purified. Observed MW 32KD Dilution Ratios Western blot: 1:500-2000 Immunohistochemistry in paraffin section IHC-(P): 1:50-400 Immunocytochemistry/Immunofluorescence (ICC/IF): 1:50-400 Flow cytometry (FCM): 1-3μg/1x106 cells Direct ELISA: 1:100-1000 (Boiling the paraffin sections in 10mM citrate buffer,pH6.0,or PH8.0 EDTA repair liquid for 20 mins is required for the staining of formalin/paraffin sections.) Optimal working dilutions must be determined by end user. Storage 12 months from date of receipt,-20℃ as supplied.6 months 2 to 8℃ after reconstitution. Avoid repeated freezing and thawing Background Information Translocon-associated protein subunit alpha is a protein that in humans is encoded by the SSR1 gene. The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein.
  • Structure of the Mammalian Oligosaccharyl-Transferase Complex

    Structure of the Mammalian Oligosaccharyl-Transferase Complex

    ARTICLE Received 26 Sep 2013 | Accepted 6 Dec 2013 | Published 10 Jan 2014 DOI: 10.1038/ncomms4072 Structure of the mammalian oligosaccharyl- transferase complex in the native ER protein translocon Stefan Pfeffer1,*, Johanna Dudek2,*, Marko Gogala3, Stefan Schorr2, Johannes Linxweiler2, Sven Lang2, Thomas Becker3, Roland Beckmann3, Richard Zimmermann2 & Friedrich Fo¨rster1 In mammalian cells, proteins are typically translocated across the endoplasmic reticulum (ER) membrane in a co-translational mode by the ER protein translocon, comprising the protein- conducting channel Sec61 and additional complexes involved in nascent chain processing and translocation. As an integral component of the translocon, the oligosaccharyl-transferase complex (OST) catalyses co-translational N-glycosylation, one of the most common protein modifications in eukaryotic cells. Here we use cryoelectron tomography, cryoelectron microscopy single-particle analysis and small interfering RNA-mediated gene silencing to determine the overall structure, oligomeric state and position of OST in the native ER protein translocon of mammalian cells in unprecedented detail. The observed positioning of OST in close proximity to Sec61 provides a basis for understanding how protein translocation into the ER and glycosylation of nascent proteins are structurally coupled. The overall spatial orga- nization of the native translocon, as determined here, serves as a reliable framework for further hypothesis-driven studies. 1 Department of Molecular Structural Biology, Max-Planck Institute of Biochemistry, Am Klopferspitz 18, D-82152 Martinsried, Germany. 2 Department of Medical Biochemistry and Molecular Biology, Saarland University, D-66421 Homburg, Germany. 3 Gene Center and Center for integrated Protein Science Munich, Department of Biochemistry, University of Munich, D-81377 Munich, Germany.
  • Minor Histocompatibility Ags: Identification Strategies, Clinical Results and Translational Perspectives

    Minor Histocompatibility Ags: Identification Strategies, Clinical Results and Translational Perspectives

    Bone Marrow Transplantation (2016) 51, 163–171 © 2016 Macmillan Publishers Limited All rights reserved 0268-3369/16 www.nature.com/bmt REVIEW Minor histocompatibility Ags: identification strategies, clinical results and translational perspectives R Oostvogels1,2,3, HM Lokhorst3 and T Mutis1,3 Allogeneic stem cell transplantation (allo-SCT) and donor lymphocyte infusion are effective treatment modalities for various hematological malignancies. Their therapeutic effect, the graft-versus-tumor (GvT) effect, is based mainly on an alloimmune response of donor T cells directed at tumor cells, in which differences in the expression of minor histocompatibility Ags (mHags) on the cells of the patient and donor have a crucial role. However, these differences are also responsible for induction of sometimes detrimental GvHD. As relapse and development of GvHD pose major threats for a large proportion of allotransplanted patients, additional therapeutic strategies are required. To augment the GvT response without increasing the risk of GvHD, specific mHag- directed immunotherapeutic strategies have been developed. Over the past years, much effort has been put into the identification of therapeutically relevant mHags to enable these strategies for a substantial proportion of patients. Currently, the concept of mHag-directed immunotherapy is tested in clinical trials on feasibility, safety and efficacy. In this review, we will summarize the recent developments in mHag identification and the clinical data on mHag-specific immune responses and mHag-directed
  • Supplemental Materials 1 SUPPLEMENTAL METHODS CSC

    Supplemental Materials 1 SUPPLEMENTAL METHODS CSC

    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Identification of MM immunotherapy targets by MS – Supplemental materials 1 SUPPLEMENTAL METHODS 2 CSC-technology 3 Approximately 100 million cells from each biological replicate (n=3-6) were taken 4 through the CSC-Technology workflow as previously described in detail.(1-3) Cells were 5 washed with PBS and oxidized by treatment with 1 mM sodium meta-periodate (Pierce, 6 Rockford, IL) in PBS pH 7.6 for 15 min at 4°C followed by 2.5 mg/ml biocytin hydrazide 7 (Biotium, Hayward, CA) in PBS pH 6.5 for 1 hour at 4°C. Cells were then collected and 8 homogenized in 10mM Tris pH 7.5, 0.5 mM MgCl2 and the resulting cell lysate was centrifuged 9 at 800 x g for 10 min at 4°C. The supernatant was centrifuged at 210,000 x g for 16 hours at 4°C 10 to collect the membranes. The supernatant was removed and the membrane protein pellet was 11 washed with 25 mM Na2CO3 to disrupt peripheral protein interactions. To the resulting 12 membrane pellet, 300µl 100 mM NH4HCO3, 5 mM Tris(2-carboxyethyl) phosphine (Sigma, St. 13 Louis, MO), and 0.1% (v/v) Rapigest (Waters, Milford, MA) were added and placed on a 14 Thermomixer (750 rpm) to continuously vortex. Proteins were allowed to reduce for 10 min at 15 25°C followed by alklylation with 10 mM iodoacetamide for 30 min.