DOCSLIB.ORG

Minor Histocompatibility Ags: Identification Strategies, Clinical Results and Translational Perspectives

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Minor Histocompatibility Ags: Identification Strategies, Clinical Results and Translational Perspectives Bone Marrow Transplantation (2016) 51, 163–171 © 2016 Macmillan Publishers Limited All rights reserved 0268-3369/16 www.nature.com/bmt REVIEW Minor histocompatibility Ags: identification strategies, clinical results and translational perspectives R Oostvogels1,2,3, HM Lokhorst3 and T Mutis1,3 Allogeneic stem cell transplantation (allo-SCT) and donor lymphocyte infusion are effective treatment modalities for various hematological malignancies. Their therapeutic effect, the graft-versus-tumor (GvT) effect, is based mainly on an alloimmune response of donor T cells directed at tumor cells, in which differences in the expression of minor histocompatibility Ags (mHags) on the cells of the patient and donor have a crucial role. However, these differences are also responsible for induction of sometimes detrimental GvHD. As relapse and development of GvHD pose major threats for a large proportion of allotransplanted patients, additional therapeutic strategies are required. To augment the GvT response without increasing the risk of GvHD, specific mHag- directed immunotherapeutic strategies have been developed. Over the past years, much effort has been put into the identification of therapeutically relevant mHags to enable these strategies for a substantial proportion of patients. Currently, the concept of mHag-directed immunotherapy is tested in clinical trials on feasibility, safety and efficacy. In this review, we will summarize the recent developments in mHag identification and the clinical data on mHag-specific immune responses and mHag-directed therapies in patients with hematological malignancies. Finally, we will outline the current challenges and future prospectives in the field. Bone Marrow Transplantation (2016) 51, 163–171; doi:10.1038/bmt.2015.256; published online 26 October 2015 THE ROLE OF MINOR HISTOCOMPATIBILITY AGS IN GVT whereas the mHags exclusively expressed on hematopoietic cells AND GVHD can give rise to a specific GvT effect (Figure 1b).2,3 Based on this Allogeneic stem cell transplantation (allo-SCT), either alone or principle, mHags with a strict hematopoietic tissue restriction are followed by donor lymphocyte infusion (DLI), is a potentially considered ideal targets for immunotherapy in patients with curative treatment for various hematological malignancies. residual or relapsing disease after allo-SCT, because they create 4,5 Essential for the antitumor effect is an immune response of donor the opportunity to separate GvT from GvHD. T cells, and, to a lesser extent, of NK and B cells, already present in the graft, against persistent tumor cells. In the allogeneic transplantation setting, donor T cells attacking the tumor cells CLINICAL APPLICABILITY OF mHAGS are frequently directed at host (allo-)specific Ags rather than As the polymorphic mHags are always presented by a certain HLA tumor-specific Ags.1 Therefore, the therapeutic graft-versus-tumor allele, there are several restrictions for the application of mHag- effect (GvT) is often accompanied by sometimes deleterious specific therapy: first, a genetic mHag mismatch between recipient GvHD. In an HLA-matched transplant setting, the T-cell and donor is required; second, the mismatched mHag gene needs alloreactivity leading to both GvT and GvHD is caused by the to be expressed only on hematopoietic cells and finally donor and recognition of minor histocompatibility Ags (mHags) presented by recipient need to express the appropriate HLA molecule for the cells of the recipient to donor T cells. These mHags are presentation of the specific mHag epitope. Thus, only a small polymorphic HLA-bound peptides that differ between donor and group of patients can be treated with each mHag, and because of recipient as they are degradation products of cellular proteins this individual applicability, the characterization of many mHags is encoded by polymorphic genes. These polymorphisms between necessary to enable broad implementation of mHag-based the host and the donor occur at the level of single or multiple base immunotherapy. Therefore, since 1998, the identification of pairs, due to either single-nucleotide polymorphisms (SNPs), hematopoietic-specific mHags has become a major goal of several base pair insertions or deletions (indels) or copy number investigators, devoted to enabling this difficult but ideal therapy variations (CNVs). In contrast to several tumor-associated Ags, for a large group of patients. Tables 1 and 2 represents a summary no self-recognition for mHags occurs and therefore no tolerance is of all identified mHags with their molecular characteristics and induced, leading to potent donor T-cell responses (Figure 1a). additional clinical information on the selection of hematopoietic- Depending on the tissue distribution of the polymorphic genes, specific mHags, respectively. Now, after the identification of mHags are either broadly expressed or are expressed in a around 50 mHags, over 35% of allotransplanted patients are hematopoietic-specific manner. According to current thinking, potential candidates for this targeted therapy. This empirical broadly expressed mHags can give rise to both GvHD and GvT, percentage matches our previous calculations (with calculated 1Department of Clinical Chemistry and Hematology, University Medical Center Utrecht, Utrecht, The Netherlands; 2Department of Hematology, University Medical Center Utrecht, Utrecht, The Netherlands and 3Department of Hematology, VU University Medical Center, Amsterdam, The Netherlands. Correspondence: Dr T Mutis, Department of Hematology, VU University Medical Center, Room CCA 4.45, De Boelelaan 1118, Amsterdam HV 1081, The Netherlands. E-mail: [email protected] Received 25 May 2015; revised 11 August 2015; accepted 15 August 2015; published online 26 October 2015 Minor histocompatibility Ags R Oostvogels et al 164 a toward identification of new mHags that are able to induce Ab responses after allo-SCT. Recipient cell Donor cell T T C C A A PROGRESS IN mHAG IDENTIFICATION METHODS C C G A The molecular characterization of epitopes recognized by mHag- G G specific T-cell clones isolated from an allo-SCT recipient has been A A A A the traditional and the most successful strategy for identification T T G G of mHags. As the genetic origin of mHags was initially unknown, laborious and technically demanding methods were used for this OR purpose, such as peptide elution from HLA molecules or screening of cDNA libraries derived from mHag-positive target cells.9–13 When it was understood that the polymorphic mHag peptides were, in fact, encoded by naturally inherited genetic variations, more efficient genetic identification techniques were introduced. In general, all these techniques aim at the identification of the Donor genetic polymorphism encoding for the mHags via correlation T cell Donor analyses, in which a significant association is sought between the T cell mHag phenotypes of a large number of individuals and known genetic markers in the genome of these individuals. For this purpose, many investigators made use of large pedigrees from the 14 b CEPH reference family collections, and also self-assembled panels of individuals were used.15 The mHag phenotypes of these Donor individuals were usually determined by measuring the response T cell of mHag-specific T-cell clones to Epstein–Barr virus-transformed B cells derived from those individuals. In the very first approach, the genomic locus of the mHag was identified by pairwise Benign blood cell correlation of the mHag phenotypes with about 32 000 SNPs GvT and microsatellite markers throughout the whole genome.16 Donor Nonetheless, this strategy was abandoned after the identification T cell of mHags LRH-1, ACC1 and ACC2,17,18 because for several other Tumor cell mHags the identified genetic locus was too large to precisely identify the mHag.6,19,20 The association of mHag phenotypes with Donor individual SNPs spread throughout the genome appeared a more T cell feasible strategy. The genetic polymorphism information required for these analyses was frequently derived from the HapMap project including 44×106 SNP genotypes for different ethnical populations.21 Making use of the fact that several of the CEPH family members were included as trios (father–mother–child) in GvHD Other tissue the databases of the HapMap Project, we developed a powerful and convenient genome-wide association study (GWAS). Based on the Mendelian inheritance pattern of mHags, we could determine Figure 1. mHags: recognition by T cells and role in GvHD and GvT. the mHag zygosities for many individuals from their mHag (a) Genetic polymorphisms leading to amino-acid differences can phenotypes. Using this extra information in the GWAS analyses, give rise to differential presentation of mHags by the HLA on cells of we could rapidly identify the mHags CD19L, SLC19A1R and the HLA-identical allo-SCT recipient (left), whereas the cells of the UTA2-1L.6,21–23 donor present no or a different Ag (right). Upon recognition of the mHag, the donor T cells become activated and can lyse the cells presenting the mHag. (b) Depending on the site and level of tissue IMPLEMENTING THE 1000 GENOMES PROJECT IN mHAG expression of the mHag, GvT and/or GvHD can develop in the IDENTIFICATION STRATEGIES presence of an mHag mismatch in the donor-versus-recipient (graft- fi versus-host) direction. Although ef cient and often successful, the above-described genetic correlation strategies were still unable to identify the target Ag of a number of mHag-specific T-cell clones, probably because of the limited number of genetic variations represented
Load more

Recommended publications
  • Novel Candidate Key Drivers in the Integrative Network of Genes, Micrornas, Methylations, and Copy Number Variations in Squamous Cell Lung Carcinoma
    Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 358125, 11 pages http://dx.doi.org/10.1155/2015/358125 Research Article Novel Candidate Key Drivers in the Integrative Network of Genes, MicroRNAs, Methylations, and Copy Number Variations in Squamous Cell Lung Carcinoma Tao Huang,1,2 Jing Yang,2 and Yu-dong Cai1 1 CollegeofLifeScience,ShanghaiUniversity,Shanghai200444,China 2Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200031, China Correspondence should be addressed to Tao Huang; [email protected] and Yu-dong Cai; cai [email protected] Received 17 September 2014; Revised 6 January 2015; Accepted 22 January 2015 Academic Editor: Aparup Das Copyright © 2015 Tao Huang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The mechanisms of lung cancer are highly complex. Not only mRNA gene expression but also microRNAs, DNA methylation, and copy number variation (CNV) play roles in tumorigenesis. It is difficult to incorporate so much information into a single model that can comprehensively reflect all these lung cancer mechanisms. In this study, we analyzed the 129 TCGA (The Cancer Genome Atlas) squamous cell lung carcinoma samples with gene expression, microRNA expression, DNA methylation, and CNV data. First, we used variance inflation factor (VIF) regression to build the whole genome integrative network. Then, we isolated the lung cancer subnetwork by identifying the known lung cancer genes and their direct regulators.
    [Show full text]
  • Autophagy Modulation in Bladder Cancer Development and Treatment (Review)
    ONCOLOGY REPORTS 42: 1647-1655, 2019 Autophagy modulation in bladder cancer development and treatment (Review) FAPING LI, HUI GUO, YUXUAN YANG, MINGLIANG FENG, BIN LIU, XIANG REN and HONGLAN ZHOU Department of Urology, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China Received April 24, 2019; Accepted August 1, 2019 DOI: 10.3892/or.2019.7286 Abstract. Bladder cancer (BC) is a potentially life-threatening 1. Introduction malignancy. Due to a high recurrence rate, frequent surveil- lance strategies and intravesical drug therapies, BC is Bladder cancer (BC) is a potentially life-threatening malig- considered one of the most expensive tumors to treat. As a nancy that is considered one of the most expensive tumors fundamental evolutionary catabolic process, autophagy plays in terms of treatment and medical care (1-3). After prostate an important role in the maintenance of cellular environ- cancer, it is the second most common type of urological cancer mental homeostasis by degrading and recycling damaged and ranks 10th among the most common types of cancer cytoplasmic components, including macromolecules and around the globe (4). It has been estimated that there were organelles. Scientific studies in the last two decades have 549,393 new cases of BC and 199,922 deaths resulting from shown that autophagy acts as a double‑edged sword with this disease worldwide in 2018, according to a report from regard to the treatment of cancer. On one hand, autophagy the International Agency for Research on Cancer (4). The inhibition is able to increase the sensitivity of cancer cells to primary histological subtype of human BC is transitional cell treatment, a process known as protective autophagy.
    [Show full text]
  • Identification of C3 As a Therapeutic Target for Diabetic Nephropathy By
    www.nature.com/scientificreports OPEN Identifcation of C3 as a therapeutic target for diabetic nephropathy by bioinformatics analysis ShuMei Tang, XiuFen Wang, TianCi Deng, HuiPeng Ge & XiangCheng Xiao* The pathogenesis of diabetic nephropathy is not completely understood, and the efects of existing treatments are not satisfactory. Various public platforms already contain extensive data for deeper bioinformatics analysis. From the GSE30529 dataset based on diabetic nephropathy tubular samples, we identifed 345 genes through diferential expression analysis and weighted gene coexpression correlation network analysis. GO annotations mainly included neutrophil activation, regulation of immune efector process, positive regulation of cytokine production and neutrophil-mediated immunity. KEGG pathways mostly included phagosome, complement and coagulation cascades, cell adhesion molecules and the AGE-RAGE signalling pathway in diabetic complications. Additional datasets were analysed to understand the mechanisms of diferential gene expression from an epigenetic perspective. Diferentially expressed miRNAs were obtained to construct a miRNA-mRNA network from the miRNA profles in the GSE57674 dataset. The miR-1237-3p/SH2B3, miR-1238-5p/ ZNF652 and miR-766-3p/TGFBI axes may be involved in diabetic nephropathy. The methylation levels of the 345 genes were also tested based on the gene methylation profles of the GSE121820 dataset. The top 20 hub genes in the PPI network were discerned using the CytoHubba tool. Correlation analysis with GFR showed that SYK, CXCL1, LYN, VWF, ANXA1, C3, HLA-E, RHOA, SERPING1, EGF and KNG1 may be involved in diabetic nephropathy. Eight small molecule compounds were identifed as potential therapeutic drugs using Connectivity Map. It is estimated that a total of 451 million people sufered from diabetes by 2017, and the number is speculated to be 693 million by 2045 1.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name signal sequence receptor, beta (translocon-associated protein beta) Gene Symbol SSR2 Organism Human Gene Summary The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. Gene Aliases DKFZp686F19123, TLAP, TRAP-BETA, TRAPB RefSeq Accession No. NC_000001.10, NT_004487.19 UniGene ID Hs.74564 Ensembl Gene ID ENSG00000163479 Entrez Gene ID 6746 Assay Information Unique Assay ID qHsaCID0014663 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000295702, ENST00000529008, ENST00000480567, ENST00000531917, ENST00000526212 Amplicon Context Sequence GGGGCAATCCGGTCCCATTTGACATTGAGCATTCCAGACACAATGCCAAAGTCT TCTGGAGGGAAGGAATCATCAGATAGTTCCACGTCTAATGCAGCACTTGAGCCA ACATTGTAGATGTTGTACTGCAAGGTCAGGTCTCGTCCC Amplicon Length (bp) 117 Chromosome Location 1:155988061-155989851 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9998 cDNA Cq 17.45 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SSR2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • GVES: Machine Learning Model for Identification of Prognostic Genes
    www.nature.com/scientificreports OPEN GVES: machine learning model for identifcation of prognostic genes with a small dataset Soohyun Ko1, Jonghwan Choi2 & Jaegyoon Ahn1* Machine learning may be a powerful approach to more accurate identifcation of genes that may serve as prognosticators of cancer outcomes using various types of omics data. However, to date, machine learning approaches have shown limited prediction accuracy for cancer outcomes, primarily owing to small sample numbers and relatively large number of features. In this paper, we provide a description of GVES (Gene Vector for Each Sample), a proposed machine learning model that can be efciently leveraged even with a small sample size, to increase the accuracy of identifcation of genes with prognostic value. GVES, an adaptation of the continuous bag of words (CBOW) model, generates vector representations of all genes for all samples by leveraging gene expression and biological network data. GVES clusters samples using their gene vectors, and identifes genes that divide samples into good and poor outcome groups for the prediction of cancer outcomes. Because GVES generates gene vectors for each sample, the sample size efect is reduced. We applied GVES to six cancer types and demonstrated that GVES outperformed existing machine learning methods, particularly for cancer datasets with a small number of samples. Moreover, the genes identifed as prognosticators were shown to reside within a number of signifcant prognostic genetic pathways associated with pancreatic cancer. Te accurate identifcation of genes with prognostic value in the prediction of cancer outcomes is a challenging task for cancer researchers. Numerous statistical and computational methods have been developed to increase the accuracy of cancer prognosis1.
    [Show full text]
  • A Crosstalk Between the RNA Binding Protein Smaug and the Hedgehog Pathway Links Cell Signaling to Mrna Regulation in Drosophila Lucía Bruzzone
    A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila Lucía Bruzzone To cite this version: Lucía Bruzzone. A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila. Cellular Biology. Université Sorbonne Paris Cité, 2018. English. NNT : 2018USPCC234. tel-02899776 HAL Id: tel-02899776 https://tel.archives-ouvertes.fr/tel-02899776 Submitted on 15 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Thèse de doctorat de l’Université Sorbonne Paris Cité Préparée à l’Université Paris Diderot Ecole doctorale HOB n° 561 Institut Jacques Monod / Equipe Développement, Signalisation et Trafic A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in Drosophila Lucía Bruzzone Thèse de doctorat de Biologie Dirigée par Anne Plessis Présentée et soutenue publiquement à Paris le 19 mars 2018 Président du jury: Alain Zider / Professeur Université Paris Diderot
    [Show full text]
  • Disease-Related Cellular Protein Networks Differentially Affected
    www.nature.com/scientificreports OPEN Disease‑related cellular protein networks diferentially afected under diferent EGFR mutations in lung adenocarcinoma Toshihide Nishimura1,8*, Haruhiko Nakamura1,2,8, Ayako Yachie3,8, Takeshi Hase3,8, Kiyonaga Fujii1,8, Hirotaka Koizumi4, Saeko Naruki4, Masayuki Takagi4, Yukiko Matsuoka3, Naoki Furuya5, Harubumi Kato6,7 & Hisashi Saji2 It is unclear how epidermal growth factor receptor EGFR major driver mutations (L858R or Ex19del) afect downstream molecular networks and pathways. This study aimed to provide information on the infuences of these mutations. The study assessed 36 protein expression profles of lung adenocarcinoma (Ex19del, nine; L858R, nine; no Ex19del/L858R, 18). Weighted gene co-expression network analysis together with analysis of variance-based screening identifed 13 co-expressed modules and their eigen proteins. Pathway enrichment analysis for the Ex19del mutation demonstrated involvement of SUMOylation, epithelial and mesenchymal transition, ERK/mitogen- activated protein kinase signalling via phosphorylation and Hippo signalling. Additionally, analysis for the L858R mutation identifed various pathways related to cancer cell survival and death. With regard to the Ex19del mutation, ROCK, RPS6KA1, ARF1, IL2RA and several ErbB pathways were upregulated, whereas AURK and GSKIP were downregulated. With regard to the L858R mutation, RB1, TSC22D3 and DOCK1 were downregulated, whereas various networks, including VEGFA, were moderately upregulated. In all mutation types, CD80/CD86 (B7), MHC, CIITA and IFGN were activated, whereas CD37 and SAFB were inhibited. Costimulatory immune-checkpoint pathways by B7/CD28 were mainly activated, whereas those by PD-1/PD-L1 were inhibited. Our fndings may help identify potential therapeutic targets and develop therapeutic strategies to improve patient outcomes.
    [Show full text]
  • Overexpression of Autocrine Motility Factor in Metastatic Tumor Cells: Possible Association with Augmented Expression of KIF3A and GDI-B
    Laboratory Investigation (2004) 84, 513–522 & 2004 USCAP, Inc All rights reserved 0023-6837/04 $25.00 www.laboratoryinvestigation.org Overexpression of autocrine motility factor in metastatic tumor cells: possible association with augmented expression of KIF3A and GDI-b Takashi Yanagawa1, Hideomi Watanabe1, Toshiyuki Takeuchi2, Shuhei Fujimoto3, Hideyuki Kurihara2,4 and Kenji Takagishi1 1Department of Orthopaedic Surgery; 2Department of Molecular Medicine; 3Department of Microbiology and 4Department of Neurosurgery Gunma University Faculty of Medicine, Institute for Molecular and Cellular Regulation, Gunma University, Showa, Maebashi, Gunma 371-8511, Japan Autocrine motility factor (AMF), which is identical to phosphohexose isomerase (PHI)/glucose-6-phosphate isomerase (GPI) , a ubiquitous enzyme essential for glycolysis, neuroleukin (NLK), a neurotrophic growth factor, and maturation factor (MF) mediating the differentiation of human myeloid cells, enhances the motility and metastatic ability of tumor cells. AMF/PHI activity is elevated in the serum or urine in patients with malignant tumors. Here, we constructed an amf/phi/nlk/mf gene using adenovirus vector and transfected into two tumor cell lines. Overexpression of AMF/PHI/NLK/MF enhanced AMF secretion into the culture media in both tumor cell lines. However, upregulation of motility and metastatic ability was found only in metastatic fibrosarcoma cells expressing an AMF receptor, gp78, and was not found in gp78-undetectable osteosarcoma cells. Thus, not only serum AMF activity but also gp78-expression in tumor cells may be required for metastasis-related motility induction. With the use of microarray analyses, we detected two augmented genes, rho GDP dissociation inhibitor beta and kinesin motor 3A, as well as AMF itself.
    [Show full text]
  • Identifizierung Und Charakterisierung Von T-Zell-Definierten Antigenen
    Identifizierung und Charakterisierung von Zielantigenen alloreaktiver zytotoxischer T-Zellen mittels cDNA-Bank-Expressionsklonierung in akuten myeloischen Leukämien Dissertation zur Erlangung des Grades Doktor der Naturwissenschaften am Fachbereich Biologie der Johannes Gutenberg-Universität Mainz Sabine Domning Mainz, 2012 Fachbereich Biologie der Johannes Gutenberg-Universität Mainz Dekan: 1.Berichterstatter: 2.Berichterstatter: Tag der mündlichen Prüfung: ZUSAMMENFASSUNG Zusammenfassung Allogene hämatopoetische Stammzelltransplantationen (HSZTs) werden insbesondere zur Behandlung von Patienten mit Hochrisiko-Leukämien durchgeführt. Dabei bewirken T- Zellreaktionen gegen Minorhistokompatibilitätsantigene (mHAgs) sowohl den therapeutisch erwünschten graft-versus-leukemia (GvL)-Effekt als auch die schädigende graft-versus-host (GvH)- Erkrankung. Für die Identifizierung neuer mHAgs mittels des T-Zell-basierten cDNA- Expressionsscreenings waren leukämiereaktive T-Zellpopulationen durch Stimulation naïver CD8+- T-Lymphozyten gesunder HLA-Klasse I-identischer Buffy Coat-Spender mit Leukämiezellen von Patienten mit akuter myeloischer Leukämie (AML) generiert worden (Albrecht et al., Cancer Immunol. Immunother. 60:235, 2011). Im Rahmen der vorliegenden Arbeit wurde mit diesen im AML-Modell des Patienten MZ529 das mHAg CYBA-72Y identifiziert. Es resultiert aus einem bekannten Einzelnukleotidpolymorphismus (rs4673: CYBA-242T/C) des Gens CYBA (kodierend für Cytochrom b-245 α-Polypeptid; syn.: p22phox), der zu einem Austausch von Tyrosin (Y) zu Histidin (H) an Aminosäureposition 72 führt. Das mHAg wurde von T-Lymphozyten sowohl in Assoziation mit HLA-B*15:01 als auch mit HLA-B*15:07 erkannt. Eine allogene T-Zellantwort gegen CYBA-72Y wurde in einem weiteren AML-Modell (MZ987) beobachtet, die ebenso wie in dem AML-Modell MZ529 polyklonal war. Insgesamt konnte bei drei von fünf getesteten HLA-B*15:01-positiven Buffy Coat-Spendern, die homozygot für CYBA-72H (H/H) waren, eine CYBA-72Y-spezifische T- Zellantwort generiert werden.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • Newly Identified Gon4l/Udu-Interacting Proteins
    www.nature.com/scientificreports OPEN Newly identifed Gon4l/ Udu‑interacting proteins implicate novel functions Su‑Mei Tsai1, Kuo‑Chang Chu1 & Yun‑Jin Jiang1,2,3,4,5* Mutations of the Gon4l/udu gene in diferent organisms give rise to diverse phenotypes. Although the efects of Gon4l/Udu in transcriptional regulation have been demonstrated, they cannot solely explain the observed characteristics among species. To further understand the function of Gon4l/Udu, we used yeast two‑hybrid (Y2H) screening to identify interacting proteins in zebrafsh and mouse systems, confrmed the interactions by co‑immunoprecipitation assay, and found four novel Gon4l‑interacting proteins: BRCA1 associated protein‑1 (Bap1), DNA methyltransferase 1 (Dnmt1), Tho complex 1 (Thoc1, also known as Tho1 or HPR1), and Cryptochrome circadian regulator 3a (Cry3a). Furthermore, all known Gon4l/Udu‑interacting proteins—as found in this study, in previous reports, and in online resources—were investigated by Phenotype Enrichment Analysis. The most enriched phenotypes identifed include increased embryonic tissue cell apoptosis, embryonic lethality, increased T cell derived lymphoma incidence, decreased cell proliferation, chromosome instability, and abnormal dopamine level, characteristics that largely resemble those observed in reported Gon4l/udu mutant animals. Similar to the expression pattern of udu, those of bap1, dnmt1, thoc1, and cry3a are also found in the brain region and other tissues. Thus, these fndings indicate novel mechanisms of Gon4l/ Udu in regulating CpG methylation, histone expression/modifcation, DNA repair/genomic stability, and RNA binding/processing/export. Gon4l is a nuclear protein conserved among species. Animal models from invertebrates to vertebrates have shown that the protein Gon4-like (Gon4l) is essential for regulating cell proliferation and diferentiation.
    [Show full text]