SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD Mice Used in This Study Accumulate Polyglucosan Inclusions (Lafora Bodies) in the Brain

SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD mice used in this study accumulate polyglucosan inclusions (Lafora bodies) in the brain. Samples from the hippocampus of five months old control, Epm2a-/- (lacking laforin) and Epm2b-/- mice (lacking malin) were stained with periodic acid Schiff reagent (PAS staining), which colors polysaccharide granules in red. Bar: 50 m.

Supplementary Fig. S2. Principal component analysis (PCA) representing the first two components with the biggest level of phenotypic variability. Samples 1_S1 to 4_S4 corresponded to control, 5_S5, 6_S6 and 8_S8 to Epm2a-/- and 9_S9 to 12_S12 to Epm2b- /- samples, of animals of 16 months of age respectively.

Supplementary Table S1. Primers used in this work to validate the expression of the corresponding genes by RT-qPCR.

Supplementary Table S2: Genes downregulated more than 0.5 fold in Epm2a-/- and Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC.

Supplementary Table S3: Genes upregulated more than 1.5 fold in Epm2a-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC.

Supplementary Table S4: Genes upregulated more than 1.5 fold in Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC.

Supplementary Table S5: Genes upregulated in both Epm2a-/- and Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC.

Supplementary Table S6: Genes upregulated more than 2.0 fold only in Epm2a-/- or only in Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC.

Supplementary Table S7: Common genes upregulated in both Epm2a-/- and Epm2b-/- mice of 16 months of age classified by putative physiological function. The gene name, fold change (FC), description and MGI Id (mouse genome informatics) are indicated. In each group genes are arranged by FC.

Supplementary Table S8: Genes upregulated more than 1.2 fold (in grey) or downregulated less than 0.8 fold in Epm2a-/- or in Epm2b-/- mice of 3 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC.

Supplementary Table S1. Primers used in this work to validate the expression of the corresponding genes by RT-qPCR.

Gene Forward primer 5’-3’ Reserve primer 5’-3’ Lcn2 CAGAAGGCAGCTTTACGATG CCTGGAGCTTGGAACAAATG Mmp3 TTGTCCCGTTTCCATCTCTC AGAGCTGCACATTGGTGATG Cxcl10 CCGTCATTTTCTGCCTCATC CTCGCAGGGATGATTTCAAG C3 TCCTGAACTGGTCAACATGG AAACTGGGCAGCACGTATTC Ccl2 AGGTGTCCCAAAGAAGCTGTAG TCTGGACCCATTCCTTCTTG Ccl5 AGCAAGTGCTCCAATCTTGC CTTGAACCCACTTCTTCTCTGG Ccl12 ACCATCAGTCCTCAGGTATTGG TTCCGGACGTGAATCTTCTG H2-M2 TAAAGGATCCCACTCCTTGC TCAAACCTCGGATTCTCAGC Wisp2 ATACAGGTGCCAGGAAGGTG ACAAGGGCAGAAAGTTGGTG Actb ACTGAGCTGCGTTTTACACC AGCCATGCCAATGTTGTCTC

A) Epm2a-/-

Gene FDR FC Description [MGI Id] Gm48677 0.0259 0.49 predicted gene. 48677 [Id:6098297] AU022754 0.0207 0.49 expressed sequence AU022754 [Id:2146143] Gm16386 0.0164 0.49 predicted gene 16386 [Id:3646848] D930015M05Rik 0.0281 0.49 RIKEN cDNA D930015M05 gene [Id:3612068] Krt20 0.0006 0.48 keratin 20 [Id:1914059] Zfp951 9.55E-05 0.48 zinc finger protein 951 [Id:2441896] aryl-hydrocarbon receptor repressor Ahrr 0.0272 0.47 [Id:1333776] Arhgap28 0.0151 0.47 Rho GTPase activating protein 28 [Id:2147003] Gm45533 0.0335 0.47 predicted gene 45533 [Id:5791369] A830036E02Rik 6.47E-12 0.47 RIKEN cDNA A830036E02 gene [Id:3686876] Gm28307 0.0222 0.47 predicted gene 28307 [Id:5579013] 5930430L01Rik 0.0007 0.46 RIKEN cDNA 5930430L01 gene [Id:2443110] Gm5066 0.0053 0.46 predicted gene 5066 [Id:3645897] cytochrome P450. family 2. subfamily e. Cyp2e1 0.0165 0.46 polypeptide 1 [Id:88607] Car3 0.0118 0.46 carbonic anhydrase 3 [Id:88270] Gm9752 0.0130 0.45 predicted gene 9752 [Id:3641896] Zfp474 0.0175 0.45 zinc finger protein 474 [Id:1914008] 2010001K21Rik 0.0399 0.44 RIKEN cDNA 2010001K21 gene [Id:1917079] Gm38101 0.0012 0.44 predicted gene. 38101 [Id:5611329] B230303O12Rik 0.0020 0.43 RIKEN cDNA B230303O12 gene [Id:2442644] Sostdc1 0.0024 0.43 sclerostin domain containing 1 [Id:1913292] family with sequence similarity 166. member B Fam166b 0.0210 0.42 [Id:2445194] Gm45104 0.0392 0.42 predicted gene 45104 [Id:5753680] Gm28455 0.0070 0.38 predicted gene 28455 [Id:5579161] 3110070M22Rik 0.0024 0.28 RIKEN cDNA 3110070M22 gene [Id:1914554] Gm15834 0.0001 0.26 predicted gene 15834 [Id:3802168] Gm28438 8.27E-10 0.24 predicted gene 28438 [Id:5579144] epilepsy. progressive myoclonic epilepsy. type 2 Epm2a 1.75E-08 0.04 gene alpha [Id:1341085]

B) Epm2b-/-

Gene FDR FC Description [MGI Id] Gm11249 0.0234 0.49 predicted gene 11249 [Id:3650834] Gm44249 0.0276 0.49 predicted gene. 44249 [Id:5690641] maestro heat-like repeat family member 5 Mroh5 0.0049 0.48 [Id:2685474] Gm26981 0.0095 0.48 predicted gene. 26981 [Id:5504096] ribosomal protein L17. pseudogene 10 Rpl17-ps10 0.0005 0.48 [Id:3642871] Rnf138rt1 0.0274 0.48 ring finger protein 138. retrogene 1 [Id:1921514] Gm16618 0.0154 0.48 predicted gene. 16618 [Id:4439542] Gm15834 0.0040 0.48 predicted gene 15834 [Id:3802168] Aldoa-ps4 0.0073 0.46 aldolase A. pseudogene 4 [Id:3643617] Gm9570 0.0022 0.46 predicted gene 9570 [Id:3779980] solute carrier family 6 (neurotransmitter Slc6a5 3.48E-05 0.44 transporter. glycine). member 5 [Id:105090] S100 calcium binding protein A9 (calgranulin B) S100a9 0.0294 0.42 [Id:1338947] G530011O06Rik 0.0154 0.39 RIKEN cDNA G530011O06 gene [Id:3603513] Gm5083 3.28E-05 0.39 predicted gene 5083 [Id:3779454] Gm5822 0.0052 0.38 predicted gene 5822 [Id:3648836] Hoxb5 0.0275 0.28 homeobox B5 [Id:96186] Hoxa5 0.0343 0.21 homeobox A5 [Id:96177] A330076C08Rik 7.84E-09 0.16 RIKEN cDNA A330076C08 gene [Id:2443693] Nhlrc1 4.49E-21 0.00 NHL repeat containing 1 [Id:2145264]

Gene FDR FC Description [MGI Id] Chil3 0.0080 201.73 chitinase-like 3 [Id:1330860] Lcn2 1.57E-08 138.06 lipocalin 2 [Id:96757] Retnla 0.0498 50.80 resistin like alpha [Id:1888504] Mmp3 4.46E-07 44.19 matrix metallopeptidase 3 [Id:97010] H2-M2 6.16E-06 42.23 histocompatibility 2. M region locus 2 [Id:95914] Mmp12 0.0062 36.94 matrix metallopeptidase 12 [Id:97005] Ccl8 0.0023 26.36 chemokine (C-C motif) ligand 8 [Id:101878] ATPase. H+ transporting. lysosomal V0 subunit D2 Atp6v0d2 0.0068 22.77 [Id:1924415] Cxcl10 1.65E-12 21.84 chemokine (C-X-C motif) ligand 10 [Id:1352450] Arg1 0.0489 15.92 arginase. liver [Id:88070] C3 1.74E-05 15.51 complement component 3 [Id:88227] Ccl2 9.12E-08 13.40 chemokine (C-C motif) ligand 2 [Id:98259] Ccl5 7.37E-12 13.10 chemokine (C-C motif) ligand 5 [Id:98262] Steap4 5.84E-16 12.91 STEAP family member 4 [Id:1923560] Hcar2 9.3E-07 12.91 hydroxycarboxylic acid receptor 2 [Id:1933383] Tgm1 1.32E-10 12.80 transglutaminase 1. K polypeptide [Id:98730] Cxcl5 0.0001 12.73 chemokine (C-X-C motif) ligand 5 [Id:1096868] Gm47283 3.49E-06 12.14 predicted gene. 47283 [Id:6096131] Wisp2 4.03E-06 11.47 WNT1 inducible signaling pathway protein 2 [Id:1328326] serine (or cysteine) peptidase inhibitor. clade A. member Serpina3i 0.0005 11.30 3I [Id:2182841] T cell-interacting. activating receptor on myeloid cells 1 Tarm1 0.0084 10.82 [Id:2442280] Il1rl1 0.0047 9.42 interleukin 1 receptor-like 1 [Id:98427] Timp1 6.48E-12 9.19 tissue inhibitor of metalloproteinase 1 [Id:98752] Fcgr4 2.38E-06 9.15 Fc receptor. IgG. low affinity IV [Id:2179523] CD74 antigen (invariant polypeptide of major histocompatibility complex. class II antigen-associated) Cd74 0.0138 7.96 [Id:96534] Clec7a 0.0020 7.87 C-type lectin domain family 7. member a [Id:1861431] Ccl12 3.82E-09 6.99 chemokine (C-C motif) ligand 12 [Id:108224] Cst7 0.0064 6.50 cystatin F (leukocystatin) [Id:1298217] Itgax 0.0046 6.47 integrin alpha X [Id:96609] Ccl11 0.0274 6.47 chemokine (C-C motif) ligand 11 [Id:103576] AI838599 1.55E-05 6.40 expressed sequence AI838599 [Id:3510989] Acp5 0.0002 6.17 acid phosphatase 5. tartrate resistant [Id:87883] H2-Ab1 0.0136 6.03 histocompatibility 2. class II antigen A. beta 1 [Id:103070] H2-Aa 0.0136 5.81 histocompatibility 2. class II antigen A. alpha [Id:95895] 9

AA465934 1.64E-13 5.65 expressed sequence AA465934 [Id:2671018] Lyz2 0.0004 5.47 lysozyme 2 [Id:96897] Ly9 1.35E-06 5.44 lymphocyte antigen 9 [Id:96885] Zbp1 1.03E-05 5.14 Z-DNA binding protein 1 [Id:1927449] leukocyte immunoglobulin-like receptor. subfamily B. Lilrb4a 1.14E-05 5.07 member 4A [Id:102701] Lgals3 0.000247 5.03 lectin. galactose binding. soluble 3 [Id:96778] Gm26917 0.000236 5.00 predicted gene. 26917 [Id:5504032] H2-Eb1 0.0224 4.91 histocompatibility 2. class II antigen E beta [Id:95901] B cell leukemia/lymphoma 2 related protein A1b Bcl2a1b 0.0002 4.89 [Id:1278326] Siglec1 0.0029 4.87 sialic acid-binding Ig-like lectin 1. sialoadhesin [Id:99668] Igha 0.0124 4.85 immunoglobulin heavy constant alpha [Id:96444] Cxcr6 0.0029 4.82 chemokine (C-X-C motif) receptor 6 [Id:1934582] Slamf8 0.0004 4.60 SLAM family member 8 [Id:1921998] Gm1966 1.09E-06 4.41 predicted gene 1966 [Id:3584360] Fcgr2b 0.0080 4.37 Fc receptor. IgG. low affinity IIb [Id:95499] leukocyte immunoglobulin-like receptor. subfamily B. Lilr4b 0.0003 4.34 member 4B [Id:102702] Gimap3 0.0002 4.33 GTPase. IMAP family member 3 [Id:1932723] tumor necrosis factor (ligand) superfamily. member 8 Tnfsf8 0.0002 4.30 [Id:88328] Pirb 7.62E-06 4.27 paired Ig-like receptor B [Id:894311] Ifi213 4.07E-05 4.17 interferon activated gene 213 [Id:3695276] Gpnmb 0.0069 4.12 glycoprotein (transmembrane) nmb [Id:1934765] Cd52 0.0004 4.11 CD52 antigen [Id:1346088] B430306N0 3Rik 0.0005 4.07 RIKEN cDNA B430306N03 gene [Id:2443478] Ifi207 0.0007 3.98 interferon activated gene 207 [Id:2138302] Cd72 9.76E-05 3.91 CD72 antigen [Id:88345] Gimap4 0.0013 3.91 GTPase. IMAP family member 4 [Id:1349656] Mx1 4.31E-06 3.88 MX dynamin-like GTPase 1 [Id:97243] Ifi204 3.49E-06 3.78 interferon activated gene 204 [Id:96429] Cd300lf 3.51E-06 3.70 CD300 molecule like family member F [Id:2442359] membrane-spanning 4-domains. subfamily A. member 7 Ms4a7 0.0091 3.67 [Id:1918846] paired immunoglobin-like type 2 receptor alpha Pilra 0.0091 3.67 [Id:2450529] Oasl1 0.0007 3.52 2'-5' oligoadenylate synthetase-like 1 [Id:2180849] serine (or cysteine) peptidase inhibitor. clade A. member Serpina3n 0.0006 3.51 3N [Id:105045] membrane-spanning 4-domains. subfamily A. member 6C Ms4a6c 0.0003 3.47 [Id:2385644] Cnr2 0.0010 3.45 cannabinoid receptor 2 (macrophage) [Id:104650] Gpr65 0.0020 3.45 G-protein coupled receptor 65 [Id:108031] triggering receptor expressed on myeloid cells-like 2 Treml2 9.56E-05 3.44 [Id:2147038] 10

Slc43a3 2.86E-06 3.44 solute carrier family 43. member 3 [Id:1931054] complement component 4B (Chido blood group) C4b 8.77E-05 3.44 [Id:88228] Slfn9 6.16E-06 3.36 schlafen 9 [Id:2445121] Oas1a 0.0001 3.36 2'-5' oligoadenylate synthetase 1A [Id:2180860] Rps24-ps2 0.0007 3.33 ribosomal protein S24. pseudogene 2 [Id:3649025] Tnfaip2 7.48E-09 3.31 tumor necrosis factor. alpha-induced protein 2 [Id:104960] Ptx3 0.0038 3.30 pentraxin related gene [Id:104641] tumor necrosis factor receptor superfamily. member 9 Tnfrsf9 0.0047 3.28 [Id:1101059] Adora3 0.0009 3.25 adenosine A3 receptor [Id:104847] Gbp5 7.37E-10 3.24 guanylate binding protein 5 [Id:2429943] Ifi209 0.0005 3.24 interferon activated gene 209 [Id:2138243] Il1rl2 0.0048 3.18 interleukin 1 receptor-like 2 [Id:1913107] colony stimulating factor 2 receptor. beta. low-affinity Csf2rb 5.91E-07 3.18 (granulocyte-macrophage) [Id:1339759] BC035044 5.6E-05 3.17 cDNA sequence BC035044 [Id:2448540] Cd22 0.0002 3.17 CD22 antigen [Id:88322] CCAAT/enhancer binding protein (C/EBP). delta Cebpd 8.7E-06 3.15 [Id:103573] caspase 4. apoptosis-related cysteine peptidase Casp4 0.0002 3.14 [Id:107700] Il2rg 0.0026 3.12 interleukin 2 receptor. gamma chain [Id:96551] Clec4a2 0.0006 3.12 C-type lectin domain family 4. member a2 [Id:1349412] Ccl6 0.0001 3.06 chemokine (C-C motif) ligand 6 [Id:98263] Ccl17 0.0001 3.05 chemokine (C-C motif) ligand 17 [Id:1329039] 1810011H1 1Rik 0.0004 3.04 RIKEN cDNA 1810011H11 gene [Id:1916319] Naip2 2.42E-06 3.02 NLR family. apoptosis inhibitory protein 2 [Id:1298226] C3ar1 9.14E-06 2.99 complement component 3a receptor 1 [Id:1097680] Hspa1b 0.0004 2.98 heat shock protein 1B [Id:99517] Gbp2 1.32E-10 2.97 guanylate binding protein 2 [Id:102772] Slamf6 0.0058 2.94 SLAM family member 6 [Id:1353620] Slfn2 3E-07 2.93 schlafen 2 [Id:1313258] radical S-adenosyl methionine domain containing 2 Rsad2 7.91E-08 2.92 [Id:1929628] pyrimidinergic receptor P2Y. G-protein coupled. 6 P2ry6 6.61E-07 2.91 [Id:2673874] Tlr1 5.46E-05 2.87 toll-like receptor 1 [Id:1341295] Top2a 0.0011 2.87 topoisomerase (DNA) II alpha [Id:98790] complement component 1. s subcomponent 1 C1s1 6.67E-05 2.85 [Id:1355312] Ctss 0.0014 2.83 cathepsin S [Id:107341] Lag3 0.0006 2.81 lymphocyte-activation gene 3 [Id:106588] Ifi47 2.3E-05 2.80 interferon gamma inducible protein 47 [Id:99448] Xaf1 0.0217 2.80 XIAP associated factor 1 [Id:3772572] Gna15 1.12E-05 2.79 guanine nucleotide binding protein. alpha 15 [Id:95770] 11

Nlrc5 6.16E-06 2.79 NLR family. CARD domain containing 5 [Id:3612191] Myo1g 0.0004 2.79 myosin IG [Id:1927091] Ifi30 0.0181 2.78 interferon gamma inducible protein 30 [Id:2137648] complement component 1. q subcomponent. alpha C1qa 0.0006 2.75 polypeptide [Id:88223] cytochrome P450. family 4. subfamily f. polypeptide 18 Cyp4f18 0.0092 2.74 [Id:1919304] Gbp8 0.0092 2.74 guanylate-binding protein 8 [Id:1923324] Cd84 3.26E-07 2.73 CD84 antigen [Id:1336885] membrane-spanning 4-domains. subfamily A. member 6D Ms4a6d 1.24E-05 2.73 [Id:1916024] AU020206 0.0063 2.72 expressed sequence AU020206 [Id:2142134] Bst2 0.0004 2.71 bone marrow stromal cell antigen 2 [Id:1916800] Myo1f 6.12E-09 2.68 myosin IF [Id:107711] H2-Q7 2.03E-05 2.68 histocompatibility 2. Q region locus 7 [Id:95936] Gfap 0.0007 2.67 glial fibrillary acidic protein [Id:95697] Gpr35 0.0008 2.67 G protein-coupled receptor 35 [Id:1929509] Rasal3 1.18E-07 2.67 RAS protein activator like 3 [Id:2444128] Hspb1 7.23E-07 2.66 heat shock protein 1 [Id:96240] AW112010 1.15E-06 2.66 expressed sequence AW112010 [Id:2147706] Tlr2 7.91E-08 2.65 toll-like receptor 2 [Id:1346060] Fcgr3 0.0048 2.65 Fc receptor. IgG. low affinity III [Id:95500] Arhgap9 0.0002 2.65 Rho GTPase activating protein 9 [Id:2143764] proteasome (prosome. macropain) subunit. beta type 8 Psmb8 6.47E-06 2.63 (large multifunctional peptidase 7) [Id:1346527] Epsti1 0.0001 2.62 epithelial stromal interaction 1 (breast) [Id:1915168] Chil1 1.86E-14 2.62 chitinase-like 1 [Id:1340899] complement component 1. q subcomponent. C chain C1qc 0.0018 2.62 [Id:88225] Osmr 5.08E-07 2.61 oncostatin M receptor [Id:1330819] Il1b 0.0197 2.60 interleukin 1 beta [Id:96543] Ang 0.0012 2.59 angiogenin. ribonuclease. RNase A family. 5 [Id:88022] Cxcl16 4.07E-05 2.54 chemokine (C-X-C motif) ligand 16 [Id:1932682] Gbp10 0.0095 2.54 guanylate-binding protein 10 [Id:4359647] H2-Oa 0.0267 2.54 histocompatibility 2. O region alpha locus [Id:95924] Oasl2 2.25E-10 2.54 2'-5' oligoadenylate synthetase-like 2 [Id:1344390] Gm45456 0.0041 2.53 predicted gene 45456 [Id:5791292] Mx2 4.62E-06 2.53 MX dynamin-like GTPase 2 [Id:97244] H2-Q4 0.0011 2.53 histocompatibility 2. Q region locus 4 [Id:95933] Ifi27l2a 3.18E-06 2.52 interferon. alpha-inducible protein 27 like 2A [Id:1924183] Gm42047 0.0022 2.51 predicted gene. 42047 [Id:5624932] complement component 1. q subcomponent. beta C1qb 0.0016 2.49 polypeptide [Id:88224] Cyba 0.0007 2.49 cytochrome b-245. alpha polypeptide [Id:1316658] Clec10a 0.0321 2.48 C-type lectin domain family 10. member A [Id:96975] Fcgr1 5.33E-08 2.47 Fc receptor. IgG. high affinity I [Id:95498] 12

H2-Q6 4.45E-06 2.46 histocompatibility 2. Q region locus 6 [Id:95935] Cd300c2 2.06E-05 2.46 CD300C molecule 2 [Id:2153249] Gbp6 6.61E-06 2.44 guanylate binding protein 6 [Id:2140937] C5ar1 0.0045 2.42 complement component 5a receptor 1 [Id:88232] H2-K1 0.0038 2.41 histocompatibility 2. K1. K region [Id:95904] H2-D1 0.0083 2.40 histocompatibility 2. D region locus 1 [Id:95896] Tmem106a 0.0005 2.40 transmembrane protein 106A [Id:1922056] S100a6 0.0062 2.39 S100 calcium binding protein A6 (calcyclin) [Id:1339467] tumor necrosis factor. alpha-induced protein 8-like 2 Tnfaip8l2 0.0109 2.39 [Id:1917019] Il1a 0.0028 2.38 interleukin 1 alpha [Id:96542] Oas2 0.0006 2.38 2'-5' oligoadenylate synthetase 2 [Id:2180852] Gm5086 0.0006 2.37 predicted gene 5086 [Id:3644417] Cysltr2 0.0127 2.37 cysteinyl leukotriene receptor 2 [Id:1917336] Cybb 9.56E-05 2.35 cytochrome b-245. beta polypeptide [Id:88574] triggering receptor expressed on myeloid cells 2 Trem2 0.0002 2.34 [Id:1913150] Ly86 2.06E-05 2.34 lymphocyte antigen 86 [Id:1321404] Fas 2.04E-05 2.34 Fas (TNF receptor superfamily member 6) [Id:95484] colony stimulating factor 3 receptor (granulocyte) Csf3r 8.94E-10 2.34 [Id:1339755] Sdf2l1 5.11E-05 2.34 stromal cell-derived factor 2-like 1 [Id:2149842] Gm21887 0.0034 2.33 predicted gene. 21887 [Id:5434051] Rnase6 0.0024 2.33 ribonuclease. RNase A family. 6 [Id:1925666] Cd48 7.62E-05 2.32 CD48 antigen [Id:88339] Sash3 0.0242 2.32 SAM and SH3 domain containing 3 [Id:1921381] IQ motif containing GTPase activating protein 3 Iqgap3 0.0335 2.32 [Id:3028642] Irf7 0.0035 2.32 interferon regulatory factor 7 [Id:1859212] Capg 5.58E-05 2.31 capping protein (actin filament). gelsolin-like [Id:1098259] colony stimulating factor 2 receptor. beta 2. low-affinity Csf2rb2 0.0017 2.31 (granulocyte-macrophage) [Id:1339760] Slc15a3 0.0045 2.29 solute carrier family 15. member 3 [Id:1929691] Adgre1 0.0020 2.29 adhesion G protein-coupled receptor E1 [Id:106912] Pld4 0.0001 2.29 phospholipase D family. member 4 [Id:2144765] Isg15 0.0121 2.28 ISG15 ubiquitin-like modifier [Id:1855694] Tyrobp 3.51E-05 2.27 TYRO protein tyrosine kinase binding protein [Id:1277211] Spint1 4.85E-06 2.27 serine protease inhibitor. Kunitz type 1 [Id:1338033] Siglecf 0.0042 2.27 sialic acid binding Ig-like lectin F [Id:2681107] Cd68 6.33E-09 2.26 CD68 antigen [Id:88342] S1pr3 2.64E-08 2.24 sphingosine-1-phosphate receptor 3 [Id:1339365] Rac2 0.000146 2.24 Rac family small GTPase 2 [Id:97846] macrophage galactose N-acetyl-galactosamine specific Mgl2 0.0063 2.22 lectin 2 [Id:2385729] Vav1 1.28E-05 2.22 vav 1 oncogene [Id:98923] Trim30a 0.0003 2.22 tripartite motif-containing 30A [Id:98178] 13

Lyl1 0.0004 2.22 lymphoblastomic leukemia 1 [Id:96891] Rtp4 9.14E-06 2.20 receptor transporter protein 4 [Id:1915025] Fblim1 0.0010 2.20 filamin binding LIM protein 1 [Id:1921452] Cmklr1 2.03E-05 2.19 chemokine-like receptor 1 [Id:109603] Cp 7.37E-12 2.18 ceruloplasmin [Id:88476] Socs3 0.0023 2.18 suppressor of cytokine signaling 3 [Id:1201791] Irf8 0.0001 2.17 interferon regulatory factor 8 [Id:96395] Ncf4 0.0068 2.17 neutrophil cytosolic factor 4 [Id:109186] AW112010 0.0001 2.16 expressed sequence AW112010 [Id:2147706] solute carrier family 11 (proton-coupled divalent metal ion Slc11a1 5.12E-06 2.16 transporters). member 1 [Id:1345275] Tlr7 4.31E-06 2.16 toll-like receptor 7 [Id:2176882] Aspg 0.0007 2.16 asparaginase [Id:2144822] Fyb 2.38E-05 2.15 FYN binding protein [Id:1346327] thymocyte selection associated family member 2 Themis2 0.0015 2.15 [Id:2446213] Ncf1 4.66E-07 2.15 neutrophil cytosolic factor 1 [Id:97283] Ip6k3 0.0101 2.15 inositol hexaphosphate kinase 3 [Id:3045325] Itgal 0.0050 2.15 integrin alpha L [Id:96606] Tusc5 0.0471 2.14 tumor suppressor candidate 5 [Id:3029307] Vim 0.0082 2.13 vimentin [Id:98932] E74-like factor 4 (ets domain transcription factor) Elf4 0.0001 2.12 [Id:1928377] Trim47 0.0001 2.12 tripartite motif-containing 47 [Id:1917374] lectin. galactoside-binding. soluble. 3 binding protein Lgals3bp 0.0042 2.12 [Id:99554] Gbp3 1.3E-06 2.12 guanylate binding protein 3 [Id:1926263] Arhgap45 6.02E-07 2.12 Rho GTPase activating protein 45 [Id:1917969] Mpeg1 2.87E-05 2.10 macrophage expressed gene 1 [Id:1333743] basic leucine zipper transcription factor. ATF-like 3 Batf3 0.0237 2.09 [Id:1925491] Irf5 0.0032 2.09 interferon regulatory factor 5 [Id:1350924] Rhoh 0.0081 2.09 ras homolog family member H [Id:1921984] Fermt3 1.63E-06 2.09 fermitin family member 3 [Id:2147790] interferon-induced protein with tetratricopeptide repeats 1 Ifit1 3.26E-06 2.09 [Id:99450] Plaur 0.0167 2.09 plasminogen activator. urokinase receptor [Id:97612] Cd86 2.06E-05 2.08 CD86 antigen [Id:101773] Naip5 0.0018 2.07 NLR family. apoptosis inhibitory protein 5 [Id:1298220] Bin2 2.86E-05 2.07 bridging integrator 2 [Id:3611448] Cybrd1 2.01E-05 2.07 cytochrome b reductase 1 [Id:2654575] Plin4 9.02E-05 2.07 perilipin 4 [Id:1929709] Btk 0.0060 2.07 Bruton agammaglobulinemia tyrosine kinase [Id:88216] Hvcn1 0.0021 2.07 hydrogen voltage-gated channel 1 [Id:1921346] Was 0.0174 2.06 Wiskott-Aldrich syndrome [Id:105059] Dock2 1.15E-05 2.04 dedicator of cyto-kinesis 2 [Id:2149010] 14

SAM domain. SH3 domain and nuclear localization Samsn1 0.0002 2.04 signals. 1 [Id:1914992] Hspa1a 1.72E-05 2.04 heat shock protein 1A [Id:96244] Usp18 7.94E-05 2.04 ubiquitin specific peptidase 18 [Id:1344364] Hck 0.0001 2.04 hemopoietic cell kinase [Id:96052] Neurl3 0.0020 2.04 neuralized E3 ubiquitin protein ligase 3 [Id:2429944] Zmynd15 0.0230 2.04 zinc finger. MYND-type containing 15 [Id:3603821] Itgb2 0.0002 2.04 integrin beta 2 [Id:96611] Il21r 0.0052 2.04 interleukin 21 receptor [Id:1890475] Ltc4s 0.0192 2.03 leukotriene C4 synthase [Id:107498] interferon-induced protein with tetratricopeptide repeats Ifit3b 3.01E-07 2.02 3B [Id:3698419] Alkal2 0.0242 2.02 ALK and LTK ligand 2 [Id:3697448] Arpc1b 0.0006 2.02 actin related protein 2/3 complex. subunit 1B [Id:1343142] Naip6 0.0030 2.02 NLR family. apoptosis inhibitory protein 6 [Id:1298222] Ctsh 0.0099 2.02 cathepsin H [Id:107285] potassium inwardly-rectifying channel. subfamily K. Kcnk6 8.91E-05 2.01 member 6 [Id:1891291] poly (ADP-ribose) polymerase family. member 14 Parp14 1.18E-07 2.01 [Id:1919489] Dusp2 0.0206 1.99 dual specificity phosphatase 2 [Id:101911] Fgd2 0.0001 1.99 FYVE. RhoGEF and PH domain-containing 2 [Id:1347084] Prrx2 0.0170 1.98 paired related homeobox 2 [Id:98218] apolipoprotein B mRNA editing enzyme. catalytic Apobec1 9.56E-05 1.97 polypeptide 1 [Id:103298] proteasome (prosome. macropain) subunit. beta type 9 Psmb9 0.0013 1.97 (large multifunctional peptidase 2) [Id:1346526] spleen focus forming virus (SFFV) proviral integration Spi1 0.0002 1.97 oncogene [Id:98282] Ptprc 1.18E-07 1.97 protein tyrosine phosphatase. receptor type. C [Id:97810] B2m 0.0019 1.96 beta-2 microglobulin [Id:88127] Tlr6 0.0295 1.95 toll-like receptor 6 [Id:1341296] Gadl1 0.0210 1.95 glutamate decarboxylase-like 1 [Id:1920998] Ncf2 0.0001 1.94 neutrophil cytosolic factor 2 [Id:97284] Ifi44 0.0016 1.94 interferon-induced protein 44 [Id:2443016] family with sequence similarity 83. member D Fam83d 0.0209 1.93 [Id:1919128] Adat2 2.22E-05 1.93 adenosine deaminase. tRNA-specific 2 [Id:1914007] Aif1 3.78E-06 1.93 allograft inflammatory factor 1 [Id:1343098] Lcp2 0.0005 1.93 lymphocyte cytosolic protein 2 [Id:1321402] Runx1 0.0051 1.92 runt related transcription factor 1 [Id:99852] Nckap1l 1.06E-09 1.92 NCK associated protein 1 like [Id:1926063] Syk 7.79E-06 1.91 spleen tyrosine kinase [Id:99515] Lpxn 0.0034 1.91 leupaxin [Id:2147677] protein tyrosine phosphatase. non-receptor type 6 Ptpn6 2.24E-06 1.90 [Id:96055] Mid1 0.0303 1.90 midline 1 [Id:1100537] 15

8430408G2 2Rik 0.0164 1.90 RIKEN cDNA 8430408G22 gene [Id:1918730] Hk3 0.0024 1.90 hexokinase 3 [Id:2670962] Bfsp2 7.6E-05 1.89 beaded filament structural protein 2. phakinin [Id:1333828] Wdfy4 0.0005 1.89 WD repeat and FYVE domain-containing 4 [Id:3584510] Tmem37 0.0174 1.88 transmembrane protein 37 [Id:2157899] Snx20 0.0100 1.88 sorting nexin 20 [Id:1918857] Traf3ip3 0.0126 1.88 TRAF3 interacting protein 3 [Id:2441706] Ifitm3 0.0006 1.87 interferon induced transmembrane protein 3 [Id:1913391] Ikzf1 5.6E-05 1.87 IKAROS family zinc finger 1 [Id:1342540] complement component 1. r subcomponent A C1ra 0.0015 1.87 [Id:1355313] antigen identified by monoclonal antibody Ki 67 Mki67 0.0106 1.87 [Id:106035] Havcr2 0.0006 1.86 hepatitis A virus cellular receptor 2 [Id:2159682] Icam1 0.0013 1.85 intercellular adhesion molecule 1 [Id:96392] suppression of tumorigenicity 14 (colon carcinoma) St14 0.0295 1.85 [Id:1338881] interferon-induced protein with tetratricopeptide repeats 3 Ifit3 4.3E-06 1.84 [Id:1101055] Gm5637 0.0011 1.84 predicted pseudogene 5637 [Id:3648120] Zfp366 3.45E-05 1.84 zinc finger protein 366 [Id:2178429] family with sequence similarity 46. member C Fam46c 4.65E-05 1.84 [Id:1921895] Ctsc 7.91E-08 1.84 cathepsin C [Id:109553] Slfn5 1.09E-05 1.84 schlafen 5 [Id:1329004] Unc93b1 0.0002 1.84 unc-93 homolog B1 (C. elegans) [Id:1859307] solute carrier family 7 (cationic amino acid transporter. y+ Slc7a7 0.0009 1.83 system). member 7 [Id:1337120] S100a11 0.0012 1.83 S100 calcium binding protein A11 [Id:1338798] Cd14 0.0007 1.83 CD14 antigen [Id:88318] apolipoprotein B mRNA editing enzyme. catalytic Apobec3 0.0204 1.83 polypeptide 3 [Id:1933111] Arl11 0.0352 1.82 ADP-ribosylation factor-like 11 [Id:2444054] bromodomain adjacent to zinc finger domain 1A Baz1a 0.0001 1.82 [Id:1309478] protein tyrosine phosphatase. non-receptor type 18 Ptpn18 0.0172 1.82 [Id:108410] Tmem119 4.31E-06 1.82 transmembrane protein 119 [Id:2385228] phosphoinositide-3-kinase regulatory subunit 5 Pik3r5 0.0006 1.82 [Id:2443588] Arhgap4 0.0003 1.81 Rho GTPase activating protein 4 [Id:2159577] G-protein signalling modulator 3 (AGS3-like. C. elegans) Gpsm3 0.0294 1.81 [Id:2146785] Mgmt 0.0276 1.81 O-6-methylguanine-DNA methyltransferase [Id:96977] Ggta1 0.0006 1.81 glycoprotein galactosyltransferase alpha 1. 3 [Id:95704] Adap2 0.0021 1.80 ArfGAP with dual PH domains 2 [Id:2663075] tumor necrosis factor receptor superfamily. member 1a Tnfrsf1a 6.02E-07 1.80 [Id:1314884] 16

guanine nucleotide-binding protein (G protein). gamma Gngt2 0.0010 1.79 transducing activity polypeptide 2 [Id:893584] CCAAT/enhancer binding protein (C/EBP). alpha Cebpa 4.08E-06 1.79 [Id:99480] Uba7 0.0001 1.79 ubiquitin-like modifier activating enzyme 7 [Id:1349462] Grrp1 0.0078 1.79 glycine/arginine rich protein 1 [Id:1919940] Slamf9 0.0199 1.79 SLAM family member 9 [Id:1923692] Hcls1 8.91E-05 1.79 hematopoietic cell specific Lyn substrate 1 [Id:104568] ATP-binding cassette. sub-family C (CFTR/MRP). Abcc3 0.0005 1.79 member 3 [Id:1923658] Ctsz 0.0006 1.78 cathepsin Z [Id:1891190] Fc receptor. IgE. High-affinity I. gamma polypeptide Fcer1g 6.61E-07 1.77 [Id:95496] lysosomal-associated protein transmembrane 5 Laptm5 5.08E-07 1.77 [Id:108046] Frrs1 0.0048 1.77 ferric-chelate reductase 1 [Id:108076] Trim34a 0.0133 1.77 tripartite motif-containing 34A [Id:2137359] Ptafr 0.0255 1.77 platelet-activating factor receptor [Id:106066] Gm42583 0.0440 1.77 predicted gene 42583 [Id:5662720] Pik3ap1 0.0020 1.76 phosphoinositide-3-kinase adaptor protein 1 [Id:1933177] Cyth4 2.86E-06 1.76 cytohesin 4 [Id:2441702] Hpse 0.0262 1.75 heparanase [Id:1343124] A2m 0.0018 1.75 alpha-2-macroglobulin [Id:2449119] Plcb2 0.0005 1.75 phospholipase C. beta 2 [Id:107465] Rhbdf2 0.0143 1.74 rhomboid 5 homolog 2 [Id:2442473] Banp 6.52E-09 1.74 BTG3 associated nuclear protein [Id:1889023] Gm7478 0.0407 1.74 predicted gene 7478 [Id:3648572] Igtp 0.0014 1.74 interferon gamma induced GTPase [Id:107729] nuclear factor of kappa light polypeptide gene enhancer in Nfkb2 0.0012 1.74 B cells 2. p49/p100 [Id:1099800] Lacc1 0.0004 1.73 laccase domain containing 1 [Id:2445077] Gm19439 1.23E-07 1.73 predicted gene. 19439 [Id:5011624] Cd44 2.27E-05 1.73 CD44 antigen [Id:88338] Tbx6 0.0405 1.73 T-box 6 [Id:102539] Nostrin 0.0043 1.73 nitric oxide synthase trafficker [Id:3606242] Gm4951 0.0498 1.72 predicted gene 4951 [Id:3644953] Gm24270 0.0442 1.71 predicted gene. 24270 [Id:5454047] N-acetylated alpha-linked acidic dipeptidase 2 Naalad2 0.0013 1.71 [Id:1919810] Vrk2 0.0238 1.71 vaccinia related kinase 2 [Id:1917172] Pycard 0.0020 1.71 PYD and CARD domain-containing [Id:1931465] Gm13611 0.0245 1.70 predicted gene 13611 [Id:3651300] Capn3 0.0002 1.70 calpain 3 [Id:107437] Tspo 0.0005 1.70 translocator protein [Id:88222] AI467606 0.0399 1.70 expressed sequence AI467606 [Id:2141979] Cd274 0.0001 1.70 CD274 antigen [Id:1926446] 17

Igsf6 0.0163 1.70 immunoglobulin superfamily. member 6 [Id:1891393] Mlph 0.0004 1.70 melanophilin [Id:2176380] Psd4 0.0196 1.70 pleckstrin and Sec7 domain containing 4 [Id:2674093] Derl3 0.0350 1.69 Der1-like domain family. member 3 [Id:1917627] Hif3a 0.0043 1.69 hypoxia inducible factor 3. alpha subunit [Id:1859778] Eda2r 0.0325 1.69 ectodysplasin A2 receptor [Id:2442860] Ifi35 0.0059 1.68 interferon-induced protein 35 [Id:1917360] Arhgap30 9.11E-05 1.68 Rho GTPase activating protein 30 [Id:2684948] Rin3 0.0062 1.68 Ras and Rab interactor 3 [Id:2385708] Tmem173 0.0018 1.67 transmembrane protein 173 [Id:1919762] Ormdl2 0.0025 1.67 ORM1-like 2 (S. cerevisiae) [Id:1914094] heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1 Hs3st3b1 0.0060 1.67 [Id:1333853] Ptges 0.0014 1.67 prostaglandin E synthase [Id:1927593] Ddx60 0.0151 1.66 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 [Id:2384570] v-maf musculoaponeurotic fibrosarcoma oncogene family. Mafb 1.46E-05 1.66 protein B (avian) [Id:104555] Flnc 0.0001 1.66 filamin C. gamma [Id:95557] Cdkn1a 7.91E-08 1.65 cyclin-dependent kinase inhibitor 1A (P21) [Id:104556] transporter 1. ATP-binding cassette. sub-family B Tap1 0.0011 1.65 (MDR/TAP) [Id:98483] tumor necrosis factor receptor superfamily. member 1b Tnfrsf1b 0.0001 1.65 [Id:1314883] Fes 0.0006 1.65 feline sarcoma oncogene [Id:95514] Prr5 0.0004 1.65 proline rich 5 (renal) [Id:1924714] Gbp7 3.88E-05 1.65 guanylate binding protein 7 [Id:2444421] Rbm38 0.0248 1.65 RNA binding motif protein 38 [Id:1889294] Klhl6 0.0458 1.65 kelch-like 6 [Id:2686922] Nfam1 0.0056 1.65 Nfat activating molecule with ITAM motif 1 [Id:1921289] Cd37 0.0007 1.65 CD37 antigen [Id:88330] Ccdc102a 0.0464 1.65 coiled-coil domain containing 102A [Id:2686927] serine (or cysteine) peptidase inhibitor. clade H. member Serpinh1 5.73E-07 1.64 1 [Id:88283] Cd109 0.0065 1.64 CD109 antigen [Id:2445221] Lcp1 2.82E-07 1.64 lymphocyte cytosolic protein 1 [Id:104808] Lgals9 0.0004 1.64 lectin. galactose binding. soluble 9 [Id:109496] Vcam1 6.69E-10 1.64 vascular cell adhesion molecule 1 [Id:98926] Gm38340 0.0305 1.64 predicted gene. 38340 [Id:5611568] Creld2 4.94E-06 1.64 cysteine-rich with EGF-like domains 2 [Id:1923987] Ifitm2 0.0051 1.64 interferon induced transmembrane protein 2 [Id:1933382] immunity-related GTPase family M member 2 Irgm2 0.0181 1.63 [Id:1926262] Plcg2 0.0014 1.63 phospholipase C. gamma 2 [Id:97616] Rnf213 3.82E-09 1.63 ring finger protein 213 [Id:1289196] Xdh 0.0019 1.63 xanthine dehydrogenase [Id:98973] Sgk1 0.0033 1.62 serum/glucocorticoid regulated kinase 1 [Id:1340062] 18

Hk2 0.0001 1.62 hexokinase 2 [Id:1315197] Rnase4 0.0318 1.62 ribonuclease. RNase A family 4 [Id:1926217] poly (ADP-ribose) polymerase family. member 9 Parp9 0.0038 1.62 [Id:1933117] Cd53 9.55E-06 1.61 CD53 antigen [Id:88341] Il3ra 0.0486 1.61 interleukin 3 receptor. alpha chain [Id:96553] Iigp1 0.0046 1.61 interferon inducible GTPase 1 [Id:1926259] Lrmp 0.0436 1.61 lymphoid-restricted membrane protein [Id:108424] negative regulator of reactive oxygen species Nrros 0.0007 1.60 [Id:2445095] Trim30d 0.0032 1.60 tripartite motif-containing 30D [Id:3035181] Dock8 0.0002 1.59 dedicator of cytokinesis 8 [Id:1921396] Gm8995 0.0008 1.59 predicted gene 8995 [Id:3644223] Grn 6.54E-07 1.59 granulin [Id:95832] minichromosome maintenance complex component 3 Mcm3 0.0478 1.59 [Id:101845] Sox18 0.0063 1.59 SRY (sex determining region Y)-box 18 [Id:103559] Blnk 0.0174 1.59 B cell linker [Id:96878] Emilin2 0.0023 1.58 elastin microfibril interfacer 2 [Id:2389136] Gm15564 9.14E-06 1.58 predicted gene 15564 [Id:3783013] Irgm1 0.0008 1.58 immunity-related GTPase family M member 1 [Id:107567] Tlr4 0.0063 1.58 toll-like receptor 4 [Id:96824] pelota mRNA surveillance and ribosome rescue factor Pelo 0.0390 1.58 [Id:2145154] Il10ra 0.0001 1.58 interleukin 10 receptor. alpha [Id:96538] Lyn 2.37E-05 1.57 LYN proto-oncogene. Src family tyrosine kinase [Id:96892] Atf3 0.0035 1.57 activating transcription factor 3 [Id:109384] solute carrier family 1 (neutral amino acid transporter). Slc1a5 0.0126 1.57 member 5 [Id:105305] Gsdmd 0.0071 1.57 gasdermin D [Id:1916396] Itgam 0.0001 1.57 integrin alpha M [Id:96607] Glipr2 0.0022 1.57 GLI pathogenesis-related 2 [Id:1917770] Gm12276 0.0243 1.57 predicted gene 12276 [Id:3649700] Arhgdib 0.0007 1.57 Rho. GDP dissociation inhibitor (GDI) beta [Id:101940] Hspa5 3.37E-10 1.57 heat shock protein 5 [Id:95835] pleckstrin homology domain-containing. family F (with Plekhf1 0.0008 1.56 FYVE domain) member 1 [Id:1919537] Sh3bp2 0.0068 1.56 SH3-domain binding protein 2 [Id:1346349] procollagen-lysine. 2-oxoglutarate 5-dioxygenase 1 Plod1 3.24E-07 1.56 [Id:99907] Parvg 0.0011 1.56 parvin. gamma [Id:2158329] Cela1 0.0229 1.56 chymotrypsin-like elastase family. member 1 [Id:95314] Tagln2 0.0003 1.56 transgelin 2 [Id:1312985] procollagen-proline. 2-oxoglutarate 4-dioxygenase (proline P4ha1 9.3E-07 1.56 4-hydroxylase). alpha 1 polypeptide [Id:97463] poly (ADP-ribose) polymerase family. member 10 Parp10 0.0045 1.55 [Id:3712326] 19

poly (ADP-ribose) polymerase family. member 3 Parp3 0.0001 1.55 [Id:1891258] Nupr1 0.0002 1.55 nuclear protein transcription regulator 1 [Id:1891834] Ccr5 0.0001 1.55 chemokine (C-C motif) receptor 5 [Id:107182] Ctsd 4.43E-05 1.55 cathepsin D [Id:88562] Csf1r 9E-09 1.55 colony stimulating factor 1 receptor [Id:1339758] CKLF-like MARVEL transmembrane domain containing 7 Cmtm7 0.0126 1.55 [Id:2447166] protein phosphatase 1. regulatory (inhibitor) subunit 14B Ppp1r14b 0.0014 1.55 [Id:107682] Vwa1 4.58E-07 1.54 von Willebrand factor A domain containing 1 [Id:2179729] Hmox1 0.0019 1.54 heme oxygenase 1 [Id:96163] TRAF-interacting protein with forkhead-associated Tifab 0.0059 1.54 domain. family member B [Id:2385852] Lsp1 0.0035 1.54 lymphocyte specific 1 [Id:96832] Klk6 0.0045 1.54 kallikrein related-peptidase 6 [Id:1343166] Olfml3 4.46E-05 1.54 olfactomedin-like 3 [Id:1914877] Fgl2 0.0403 1.54 fibrinogen-like protein 2 [Id:103266] Il6ra 0.0001 1.54 interleukin 6 receptor. alpha [Id:105304] Gm4811 0.0138 1.53 predicted gene 4811 [Id:3648985] Zfp36 0.0139 1.53 zinc finger protein 36 [Id:99180] Fam46a 6.47E-06 1.53 family with sequence similarity 46. member A [Id:2670964] mitogen-activated protein kinase kinase kinase 19 Map3k19 0.0004 1.53 [Id:1203481] Pdpn 4.01E-05 1.52 podoplanin [Id:103098] Adipor2 4.91E-10 1.52 adiponectin receptor 2 [Id:93830] Sipa1 0.0001 1.52 signal-induced proliferation associated gene 1 [Id:107576] Mgst1 4.27E-06 1.52 microsomal glutathione S-transferase 1 [Id:1913850] Acer2 0.0057 1.52 alkaline ceramidase 2 [Id:1920932] Selplg 3.47E-05 1.52 selectin. platelet (p-selectin) ligand [Id:106689] tumor necrosis factor receptor superfamily. member 25 Tnfrsf25 0.0081 1.52 [Id:1934667] Cd180 0.0203 1.52 CD180 antigen [Id:1194924] Inpp5d 4.24E-05 1.52 inositol polyphosphate-5-phosphatase D [Id:107357] Rinl 0.0138 1.52 Ras and Rab interactor-like [Id:2444024] solute carrier organic anion transporter family. member Slco2b1 0.0006 1.51 2b1 [Id:1351872] Anxa3 1.74E-05 1.51 annexin A3 [Id:1201378] Bag3 1.9E-05 1.50 BCL2-associated athanogene 3 [Id:1352493] Per2 0.0001 1.50 period circadian clock 2 [Id:1195265] Irx3 0.0286 1.50 Iroquois related homeobox 3 [Id:1197522] Hexb 3.79E-06 1.50 hexosaminidase B [Id:96074] family with sequence similarity 129. member A Fam129a 0.0014 1.50 [Id:2137237] nuclear factor of activated T cells. cytoplasmic. calcineurin Nfatc1 0.0027 1.50 dependent 1 [Id:102469]

Gene FDR FC Description [MGI Id] Chil3 0.0029 236.11 chitinase-like 3 [Id:1330860] Lcn2 2.05E-08 126.29 lipocalin 2 [Id:96757] Mmp3 3.91E-08 53.78 matrix metallopeptidase 3 [Id:97010] Retnla 0.0377 44.59 resistin like alpha [Id:1888504] H2-M2 2.72E-06 43.35histocompatibility 2. M region locus 2 [Id:95914] Mmp12 0.0037 34.09 matrix metallopeptidase 12 [Id:97005] ATPase. H+ transporting. lysosomal V0 subunit D2 Atp6v0d2 0.0011 30.48 [Id:1924415] Ccl8 0.0007 29.66 chemokine (C-C motif) ligand 8 [Id:101878] Cxcl10 1.57E-12 20.06 chemokine (C-X-C motif) ligand 10 [Id:1352450] C3 1.18E-05 14.94 complement component 3 [Id:88227] serine (or cysteine) peptidase inhibitor. clade A. member Serpina3i 3.66E-05 14.12 3I [Id:2182841] Ccl5 1.61E-12 13.71 chemokine (C-C motif) ligand 5 [Id:98262] Arg1 0.0392 13.70 arginase. liver [Id:88070] WNT1 inducible signaling pathway protein 2 Wisp2 4.24E-07 13.49 [Id:1328326] Ccl2 9.7E-08 12.68 chemokine (C-C motif) ligand 2 [Id:98259] Steap4 2.03E-16 12.37 STEAP family member 4 [Id:1923560] Fcgr4 3.23E-07 10.65 Fc receptor. IgG. low affinity IV [Id:2179523] Hcar2 3.62E-06 10.49 hydroxycarboxylic acid receptor 2 [Id:1933383] Timp1 5.49E-13 10.09 tissue inhibitor of metalloproteinase 1 [Id:98752] Tgm1 2.86E-09 9.85 transglutaminase 1. K polypeptide [Id:98730] Clec7a 0.0006 8.82 C-type lectin domain family 7. member a [Id:1861431] Gm8113 0.0334 8.72 predicted gene 8113 [Id:3648791] Cxcl5 0.0003 8.13 chemokine (C-X-C motif) ligand 5 [Id:1096868] Cst7 0.0021 7.11 cystatin F (leukocystatin) [Id:1298217] T cell-interacting. activating receptor on myeloid cells 1 Tarm1 0.0312 6.53 [Id:2442280] Il1rl1 0.0110 6.52 interleukin 1 receptor-like 1 [Id:98427] Lyz2 0.0001 6.51 lysozyme 2 [Id:96897] CD74 antigen (invariant polypeptide of major histocompatibility complex. class II antigen-associated) Cd74 0.0129 6.36 [Id:96534] Ccl12 9.36E-09 6.36 chemokine (C-C motif) ligand 12 [Id:108224] Acp5 0.0001 6.12 acid phosphatase 5. tartrate resistant [Id:87883] Itgax 0.0029 5.95 integrin alpha X [Id:96609] AI838599 3.56E-05 5.46 expressed sequence AI838599 [Id:3510989] Gimap3 1.11E-05 5.21 GTPase. IMAP family member 3 [Id:1932723] H2-Ab1 0.0117 5.11 histocompatibility 2. class II antigen A. beta 1 21

[Id:103070] Cxcr6 0.0007 5.09 chemokine (C-X-C motif) receptor 6 [Id:1934582] Lgals3 0.0001 5.00 lectin. galactose binding. soluble 3 [Id:96778] H2-Aa 0.0127 4.79 histocompatibility 2. class II antigen A. alpha [Id:95895] Cd52 8.82E-05 4.76 CD52 antigen [Id:1346088] leukocyte immunoglobulin-like receptor. subfamily B. Lilrb4a 1.06E-05 4.76 member 4A [Id:102701] Ly9 4.23E-06 4.57 lymphocyte antigen 9 [Id:96885] Gm26917 0.0001 4.51 predicted gene. 26917 [Id:5504032] Gpnmb 0.0024 4.42 glycoprotein (transmembrane) nmb [Id:1934765] Siglec1 0.0024 4.32 sialic acid-binding Ig-like lectin 1. sialoadhesin [Id:99668] B cell leukemia/lymphoma 2 related protein A1b Bcl2a1b 0.0005 4.20 [Id:1278326] H2-Eb1 0.0209 4.13 histocompatibility 2. class II antigen E beta [Id:95901] Wfdc17 0.0001 4.12 WAP four-disulfide core domain 17 [Id:3649773] Zbp1 6.18E-05 4.05 Z-DNA binding protein 1 [Id:1927449] Gm1966 1.75E-06 4.04 predicted gene 1966 [Id:3584360] tumor necrosis factor receptor superfamily. member 9 Tnfrsf9 0.0002 3.97 [Id:1101059] tumor necrosis factor. alpha-induced protein 2 Tnfaip2 1.89E-10 3.80 [Id:104960] Gpr65 0.0004 3.67 G-protein coupled receptor 65 [Id:108031] Ifi213 8.71E-05 3.63 interferon activated gene 213 [Id:3695276] Rps24-ps2 0.0001 3.62 ribosomal protein S24. pseudogene 2 [Id:3649025] paired immunoglobin-like type 2 receptor alpha Pilra 0.0055 3.50 [Id:2450529] Cd72 0.0001 3.47 CD72 antigen [Id:88345] caspase 4. apoptosis-related cysteine peptidase Casp4 2.65E-05 3.47 [Id:107700] Pirb 4.78E-05 3.47 paired Ig-like receptor B [Id:894311] Ifi204 5.35E-06 3.46 interferon activated gene 204 [Id:96429] Fcgr2b 0.0101 3.46 Fc receptor. IgG. low affinity IIb [Id:95499] tumor necrosis factor (ligand) superfamily. member 8 Tnfsf8 0.0010 3.45 [Id:88328] leukocyte immunoglobulin-like receptor. subfamily B. Lilr4b 0.0012 3.44 member 4B [Id:102702] Cd22 3.55E-05 3.40 CD22 antigen [Id:88322] Ccl6 2.21E-05 3.39 chemokine (C-C motif) ligand 6 [Id:98263] Ifi209 0.0001 3.34 interferon activated gene 209 [Id:2138243] membrane-spanning 4-domains. subfamily A. member 7 Ms4a7 0.0079 3.32 [Id:1918846] complement component 4B (Chido blood group) C4b 5.04E-05 3.31 [Id:88228] Slamf8 0.0038 3.28 SLAM family member 8 [Id:1921998] DMRT-like family B with proline-rich C-terminal. 1 Dmrtb1 0.0353 3.28 [Id:1927125] Gbp8 0.0007 3.23 guanylate-binding protein 8 [Id:1923324] Cd300lf 1.17E-05 3.21 CD300 molecule like family member F [Id:2442359] 22

Gbp5 5.16E-10 3.19 guanylate binding protein 5 [Id:2429943] B430306N03 Rik 0.0025 3.18 RIKEN cDNA B430306N03 gene [Id:2443478] triggering receptor expressed on myeloid cells-like 2 Treml2 0.0001 3.07 [Id:2147038] Bcl3 0.0002 3.05 B cell leukemia/lymphoma 3 [Id:88140] Gbp10 0.0005 3.04 guanylate-binding protein 10 [Id:4359647] Cnr2 0.0016 3.01 cannabinoid receptor 2 (macrophage) [Id:104650] Gimap4 0.0060 3.01 GTPase. IMAP family member 4 [Id:1349656] Il1b 0.0022 2.99 interleukin 1 beta [Id:96543] radical S-adenosyl methionine domain containing 2 Rsad2 2.44E-08 2.98 [Id:1929628] Il1rl2 0.0041 2.89 interleukin 1 receptor-like 2 [Id:1913107] colony stimulating factor 2 receptor. beta. low-affinity Csf2rb 1.62E-06 2.87 (granulocyte-macrophage) [Id:1339759] Ptx3 0.0054 2.86 pentraxin related gene [Id:104641] Naip2 2.91E-06 2.84 NLR family. apoptosis inhibitory protein 2 [Id:1298226] Gbp2 1.89E-10 2.81 guanylate binding protein 2 [Id:102772] colony stimulating factor 2 receptor. beta 2. low-affinity Csf2rb2 4.17E-05 2.79 (granulocyte-macrophage) [Id:1339760] Tusc5 0.0015 2.79 tumor suppressor candidate 5 [Id:3029307] Ifi207 0.0063 2.78 interferon activated gene 207 [Id:2138302] Cd84 1.22E-07 2.77 CD84 antigen [Id:1336885] Slc43a3 2.74E-05 2.75 solute carrier family 43. member 3 [Id:1931054] 1810011H11 Rik 0.0006 2.73 RIKEN cDNA 1810011H11 gene [Id:1916319] Ctss 0.0007 2.72 cathepsin S [Id:107341] C3ar1 1.51E-05 2.70 complement component 3a receptor 1 [Id:1097680] serine (or cysteine) peptidase inhibitor. clade A. member Serpina3n 0.0012 2.69 3N [Id:105045] Plbd1 0.0090 2.67 phospholipase B domain containing 1 [Id:1914107] AW112010 1.15E-06 2.66 expressed sequence AW112010 [Id:2147706] Slfn2 9.67E-07 2.65 schlafen 2 [Id:1313258] capping protein (actin filament). gelsolin-like Capg 2.04E-06 2.63 [Id:1098259] Gna15 1.27E-05 2.63 guanine nucleotide binding protein. alpha 15 [Id:95770] complement component 1. q subcomponent. alpha C1qa 0.0003 2.61 polypeptide [Id:88223] TYRO protein tyrosine kinase binding protein Tyrobp 4.19E-06 2.61 [Id:1277211] Gbp6 9.75E-07 2.58 guanylate binding protein 6 [Id:2140937] interferon. alpha-inducible protein 27 like 2A Ifi27l2a 8.83E-07 2.58 [Id:1924183] Oas1a 0.0015 2.57 2'-5' oligoadenylate synthetase 1A [Id:2180860] H2-Oa 0.0111 2.57 histocompatibility 2. O region alpha locus [Id:95924] Nlrc5 1.09E-05 2.55 NLR family. CARD domain containing 5 [Id:3612191] complement component 1. q subcomponent. C chain C1qc 0.0009 2.55 [Id:88225] 23

AU020206 0.0043 2.54 expressed sequence AU020206 [Id:2142134] complement component 1. q subcomponent. beta C1qb 0.0006 2.54 polypeptide [Id:88224] membrane-spanning 4-domains. subfamily A. member Ms4a6d 1.92E-05 2.52 6D [Id:1916024] Ifi47 5.33E-05 2.51 interferon gamma inducible protein 47 [Id:99448] tumor necrosis factor. alpha-induced protein 8-like 2 Tnfaip8l2 0.0031 2.51 [Id:1917019] Clec10a 0.0136 2.51 C-type lectin domain family 10. member A [Id:96975] Gfap 0.0005 2.50 glial fibrillary acidic protein [Id:95697] Ccl9 4.75E-05 2.50 chemokine (C-C motif) ligand 9 [Id:104533] CCAAT/enhancer binding protein (C/EBP). delta Cebpd 6.13E-05 2.50 [Id:103573] Lag3 0.0007 2.49 lymphocyte-activation gene 3 [Id:106588] Slamf9 6.09E-05 2.47 SLAM family member 9 [Id:1923692] Cxcl16 2.63E-05 2.47 chemokine (C-X-C motif) ligand 16 [Id:1932682] Clec4a2 0.0038 2.45 C-type lectin domain family 4. member a2 [Id:1349412] pyrimidinergic receptor P2Y. G-protein coupled. 6 P2ry6 8.01E-06 2.44 [Id:2673874] FGR proto-oncogene. Src family tyrosine kinase Fgr 0.0245 2.42 [Id:95527] Epsti1 0.0001 2.42 epithelial stromal interaction 1 (breast) [Id:1915168] Gm6008 0.0054 2.41 predicted gene 6008 [Id:3647051] Tmem106a 0.0002 2.39 transmembrane protein 106A [Id:1922056] Adora3 0.0086 2.39 adenosine A3 receptor [Id:104847] Tgtp1 0.0034 2.39 T cell specific GTPase 1 [Id:98734] Cyba 0.0004 2.37 cytochrome b-245. alpha polypeptide [Id:1316658] Cd48 1.93E-05 2.36 CD48 antigen [Id:88339] Gm8894 0.0043 2.36 predicted gene 8894 [Id:3643084] Chil1 1.4E-13 2.35chitinase-like 1 [Id:1340899] BC035044 0.0013 2.35 cDNA sequence BC035044 [Id:2448540] Rasal3 9.81E-07 2.34 RAS protein activator like 3 [Id:2444128] Socs3 0.0003 2.33 suppressor of cytokine signaling 3 [Id:1201791] Tlr2 7.18E-07 2.32 toll-like receptor 2 [Id:1346060] Fcgr3 0.0049 2.32 Fc receptor. IgG. low affinity III [Id:95500] Top2a 0.0046 2.32 topoisomerase (DNA) II alpha [Id:98790] H2-Q6 5.74E-06 2.32histocompatibility 2. Q region locus 6 [Id:95935] Ticam2 0.0332 2.32 toll-like receptor adaptor molecule 2 [Id:3040056] H2-Q7 8.05E-05 2.31histocompatibility 2. Q region locus 7 [Id:95936] interferon-induced protein with tetratricopeptide repeats Ifit1 1.81E-07 2.31 1 [Id:99450] Oasl1 0.0192 2.31 2'-5' oligoadenylate synthetase-like 1 [Id:2180849] Gpx6 0.0070 2.31 glutathione peroxidase 6 [Id:1922762] Cd300c2 2.29E-05 2.31 CD300C molecule 2 [Id:2153249] H2-Q4 0.0011 2.30 histocompatibility 2. Q region locus 4 [Id:95933] Btk 0.0004 2.30 Bruton agammaglobulinemia tyrosine kinase [Id:88216] 24

Bst2 0.0008 2.30 bone marrow stromal cell antigen 2 [Id:1916800] Prrx2 0.0011 2.28 paired related homeobox 2 [Id:98218] Myo1g 0.0024 2.28 myosin IG [Id:1927091] Gpr84 0.0018 2.27 G protein-coupled receptor 84 [Id:1934129] complement component 1. s subcomponent 1 C1s1 0.0006 2.27 [Id:1355312] Gpr35 0.0027 2.26 G protein-coupled receptor 35 [Id:1929509] Isg15 0.0057 2.26 ISG15 ubiquitin-like modifier [Id:1855694] triggering receptor expressed on myeloid cells 2 Trem2 0.0001 2.26 [Id:1913150] S100a6 0.0041 2.26 S100 calcium binding protein A6 (calcyclin) [Id:1339467] Irf7 0.0018 2.25 interferon regulatory factor 7 [Id:1859212] Aspg 0.0001 2.25 asparaginase [Id:2144822] family with sequence similarity 83. member D Fam83d 0.0012 2.25 [Id:1919128] Oasl2 3.24E-09 2.23 2'-5' oligoadenylate synthetase-like 2 [Id:1344390] proteasome (prosome. macropain) subunit. beta type 8 Psmb8 3.93E-05 2.23 (large multifunctional peptidase 7) [Id:1346527] suppression of tumorigenicity 14 (colon carcinoma) St14 0.0011 2.23 [Id:1338881] Bin2 2.71E-06 2.22 bridging integrator 2 [Id:3611448] Cysltr1 0.0046 2.20 cysteinyl leukotriene receptor 1 [Id:1926218] linker for activation of T cells family. member 2 Lat2 0.0331 2.20 [Id:1926479] Pld4 0.0001 2.19 phospholipase D family. member 4 [Id:2144765] Was 0.0036 2.19 Wiskott-Aldrich syndrome [Id:105059] Rhoh 0.0018 2.18 ras homolog family member H [Id:1921984] H2-D1 0.0068 2.18 histocompatibility 2. D region locus 1 [Id:95896] Rtp4 4.67E-06 2.17 receptor transporter protein 4 [Id:1915025] Osmr 5.53E-06 2.17 oncostatin M receptor [Id:1330819] Myo1f 4.93E-07 2.17 myosin IF [Id:107711] Ccr2 0.0405 2.17 chemokine (C-C motif) receptor 2 [Id:106185] Gm4817 0.0056 2.17 predicted gene 4817 [Id:3644402] H2-K1 0.0034 2.17 histocompatibility 2. K1. K region [Id:95904] Fas 3.57E-05 2.16 Fas (TNF receptor superfamily member 6) [Id:95484] S1pr3 3.07E-08 2.16 sphingosine-1-phosphate receptor 3 [Id:1339365] Il2rg 0.0345 2.16 interleukin 2 receptor. gamma chain [Id:96551] Sash3 0.0199 2.15 SAM and SH3 domain containing 3 [Id:1921381] Ifi30 0.0388 2.15 interferon gamma inducible protein 30 [Id:2137648] Ang 0.0038 2.15 angiogenin. ribonuclease. RNase A family. 5 [Id:88022] Slc15a3 0.0037 2.13 solute carrier family 15. member 3 [Id:1929691] protein tyrosine phosphatase. non-receptor type 18 Ptpn18 0.0007 2.13 [Id:108410] Lyl1 0.0003 2.12 lymphoblastomic leukemia 1 [Id:96891] Tlr1 0.0017 2.12 toll-like receptor 1 [Id:1341295] Slc11a1 3.29E-06 2.12 solute carrier family 11 (proton-coupled divalent metal 25

ion transporters). member 1 [Id:1345275] Gm5086 0.0013 2.12 predicted gene 5086 [Id:3644417] Irf5 0.0011 2.11 interferon regulatory factor 5 [Id:1350924] Aif1 1.45E-07 2.11 allograft inflammatory factor 1 [Id:1343098] Rac2 0.0001 2.10 Rac family small GTPase 2 [Id:97846] Ggta1 1.93E-05 2.10 glycoprotein galactosyltransferase alpha 1. 3 [Id:95704] Cytip 0.0226 2.10 cytohesin 1 interacting protein [Id:2183535] Gadl1 0.0035 2.10 glutamate decarboxylase-like 1 [Id:1920998] Neurl3 0.0004 2.09 neuralized E3 ubiquitin protein ligase 3 [Id:2429944] Fermt3 6.66E-07 2.09 fermitin family member 3 [Id:2147790] Abi3 0.0039 2.08 ABI gene family. member 3 [Id:1913860] Arhgap45 4.25E-07 2.08 Rho GTPase activating protein 45 [Id:1917969] Naip5 0.0006 2.08 NLR family. apoptosis inhibitory protein 5 [Id:1298220] Ctsh 0.0035 2.07 cathepsin H [Id:107285] Haao 0.0477 2.07 3-hydroxyanthranilate 3.4-dioxygenase [Id:1349444] Nos2 0.0152 2.06 nitric oxide synthase 2. inducible [Id:97361] Lst1 0.0058 2.05 leukocyte specific transcript 1 [Id:1096324] Klhl6 0.0009 2.05 kelch-like 6 [Id:2686922] Igsf6 0.0002 2.04 immunoglobulin superfamily. member 6 [Id:1891393] UDP-GlcNAc:betaGal beta-1.3-N- B3gnt7 0.0368 2.04 acetylglucosaminyltransferase 7 [Id:2384394] H2-DMb1 0.0070 2.03 histocompatibility 2. class II. locus Mb1 [Id:95922] Cp 2.87E-11 2.03 ceruloplasmin [Id:88476] Siglecf 0.0067 2.02 sialic acid binding Ig-like lectin F [Id:2681107] Hcls1 1.52E-06 2.02 hematopoietic cell specific Lyn substrate 1 [Id:104568] Ltc4s 0.0089 2.01 leukotriene C4 synthase [Id:107498] thymocyte selection associated family member 2 Themis2 0.0015 2.01 [Id:2446213] Il1r2 0.0431 2.00 interleukin 1 receptor. type II [Id:96546] 5430427O19 Rik 0.0392 2.00 RIKEN cDNA 5430427O19 gene [Id:1918648] Mpeg1 2.49E-05 1.99 macrophage expressed gene 1 [Id:1333743] Ncf1 1.27E-06 1.99 neutrophil cytosolic factor 1 [Id:97283] Trim47 0.0001 1.99 tripartite motif-containing 47 [Id:1917374] Vav1 4.33E-05 1.99 vav 1 oncogene [Id:98923] Ip6k3 0.0105 1.98 inositol hexaphosphate kinase 3 [Id:3045325] FYVE. RhoGEF and PH domain-containing 2 Fgd2 4.56E-05 1.98 [Id:1347084] Itgal 0.0057 1.97 integrin alpha L [Id:96606] Mx1 0.0126 1.97 MX dynamin-like GTPase 1 [Id:97243] Arl11 0.0063 1.97 ADP-ribosylation factor-like 11 [Id:2444054] Vim 0.0064 1.97 vimentin [Id:98932] phosphoinositide-3-kinase adaptor protein 1 Pik3ap1 8.21E-05 1.96 [Id:1933177] Runx1 0.0013 1.96 runt related transcription factor 1 [Id:99852] 26

colony stimulating factor 3 receptor (granulocyte) Csf3r 8.48E-08 1.96 [Id:1339755] Adgre1 0.0035 1.95 adhesion G protein-coupled receptor E1 [Id:106912] Gm4951 0.0051 1.95 predicted gene 4951 [Id:3644953] spleen focus forming virus (SFFV) proviral integration Spi1 8.34E-05 1.95 oncogene [Id:98282] basic leucine zipper transcription factor. ATF-like 3 Batf3 0.0237 1.94 [Id:1925491] Irf8 0.0003 1.94 interferon regulatory factor 8 [Id:96395] Gm15493 0.0241 1.93 predicted gene 15493 [Id:3782939] guanine nucleotide-binding protein (G protein). gamma Gngt2 8.83E-05 1.93 transducing activity polypeptide 2 [Id:893584] Ptafr 0.0032 1.93 platelet-activating factor receptor [Id:106066] Itgb2 0.0002 1.93 integrin beta 2 [Id:96611] Gbp3 4.58E-06 1.93 guanylate binding protein 3 [Id:1926263] Trim30a 0.0007 1.93 tripartite motif-containing 30A [Id:98178] Snx20 0.0029 1.92 sorting nexin 20 [Id:1918857] Pkd2l1 0.0002 1.92 polycystic kidney disease 2-like 1 [Id:1352448] Fcgr1 9.15E-06 1.92 Fc receptor. IgG. high affinity I [Id:95498] Cyth4 8.48E-08 1.91 cytohesin 4 [Id:2441702] Tlr7 2.65E-05 1.91 toll-like receptor 7 [Id:2176882] Cd68 3.12E-07 1.91 CD68 antigen [Id:88342] Gm7478 0.0058 1.91 predicted gene 7478 [Id:3648572] Rab7b 0.0014 1.91 RAB7B. member RAS oncogene family [Id:2442295] Fyb 0.0001 1.90 FYN binding protein [Id:1346327] Cd86 6.16E-05 1.89 CD86 antigen [Id:101773] protein tyrosine phosphatase. receptor type. C Ptprc 1.63E-07 1.89 [Id:97810] H2-Q5 0.0283 1.89 histocompatibility 2. Q region locus 5 [Id:95934] Ifi44 0.0009 1.88 interferon-induced protein 44 [Id:2443016] Lpxn 0.0015 1.88 leupaxin [Id:2147677] B2m 0.0011 1.88 beta-2 microglobulin [Id:88127] Ptges 3.66E-05 1.87 prostaglandin E synthase [Id:1927593] actin related protein 2/3 complex. subunit 1B Arpc1b 0.0006 1.87 [Id:1343142] Fes 1.01E-05 1.87 feline sarcoma oncogene [Id:95514] Tspo 2.12E-05 1.87 translocator protein [Id:88222] Hck 0.0003 1.87 hemopoietic cell kinase [Id:96052] Cybrd1 7.44E-05 1.86 cytochrome b reductase 1 [Id:2654575] anti-silencing function 1B histone chaperone Asf1b 0.0170 1.86 [Id:1914179] Slfn8 0.0014 1.86 schlafen 8 [Id:2672859] Unc93b1 7.65E-05 1.86 unc-93 homolog B1 (C. elegans) [Id:1859307] Arhgap9 0.0122 1.86 Rho GTPase activating protein 9 [Id:2143764] G-protein signalling modulator 3 (AGS3-like. C. elegans) Gpsm3 0.0097 1.86 [Id:2146785] 27

apolipoprotein B mRNA editing enzyme. catalytic Apobec1 0.0001 1.86 polypeptide 1 [Id:103298] Cybb 0.0019 1.85 cytochrome b-245. beta polypeptide [Id:88574] Cd200r1 0.0444 1.85 CD200 receptor 1 [Id:1889024] Spint1 0.0001 1.85 serine protease inhibitor. Kunitz type 1 [Id:1338033] Havcr2 0.0002 1.84 hepatitis A virus cellular receptor 2 [Id:2159682] proteasome (prosome. macropain) subunit. beta type 9 Psmb9 0.0015 1.84 (large multifunctional peptidase 2) [Id:1346526] 1810024B03 Rik 0.0176 1.84 RIKEN cDNA 1810024B03 gene [Id:1925560] Ncf4 0.0203 1.83 neutrophil cytosolic factor 4 [Id:109186] interferon-induced protein with tetratricopeptide repeats Ifit3b 2.11E-06 1.82 3B [Id:3698419] Zc3h12a 0.0298 1.82 zinc finger CCCH type containing 12A [Id:2385891] Naip6 0.0051 1.82 NLR family. apoptosis inhibitory protein 6 [Id:1298222] Il1a 0.0267 1.82 interleukin 1 alpha [Id:96542] Mgmt 0.0121 1.81 O-6-methylguanine-DNA methyltransferase [Id:96977] solute carrier family 2 (facilitated glucose transporter). Slc2a9 0.0050 1.81 member 9 [Id:2152844] Rps3a3 0.0001 1.81 ribosomal protein S3A3 [Id:3643406] Arhgap4 0.0001 1.80 Rho GTPase activating protein 4 [Id:2159577] Gm6109 0.0030 1.79 predicted gene 6109 [Id:3643032] interferon-induced protein with tetratricopeptide repeats Ifit3 3.58E-06 1.79 3 [Id:1101055] Gm8971 0.0003 1.79 predicted gene 8971 [Id:3648536] 8430408G22 Rik 0.0146 1.79 RIKEN cDNA 8430408G22 gene [Id:1918730] E74-like factor 4 (ets domain transcription factor) Elf4 0.0012 1.79 [Id:1928377] Gm42047 0.0333 1.78 predicted gene. 42047 [Id:5624932] Lrmp 0.0048 1.78 lymphoid-restricted membrane protein [Id:108424] Icam1 0.0010 1.78 intercellular adhesion molecule 1 [Id:96392] Gm6988 0.0007 1.77 predicted gene 6988 [Id:3647486] lectin. galactoside-binding. soluble. 3 binding protein Lgals3bp 0.0078 1.77 [Id:99554] Lat 0.0294 1.77 linker for activation of T cells [Id:1342293] protein tyrosine phosphatase. non-receptor type 6 Ptpn6 6.13E-06 1.77 [Id:96055] Cryba4 0.0296 1.77 crystallin. beta A4 [Id:102716] Hk3 0.0029 1.77 hexokinase 3 [Id:2670962] Wdfy4 0.0006 1.76 WD repeat and FYVE domain-containing 4 [Id:3584510] solute carrier family 1 (neutral amino acid transporter). Slc1a5 0.0005 1.76 member 5 [Id:105305] Ikzf1 8.74E-05 1.76 IKAROS family zinc finger 1 [Id:1342540] Uba7 6.34E-05 1.75 ubiquitin-like modifier activating enzyme 7 [Id:1349462] Hoga1 0.0293 1.75 4-hydroxy-2-oxoglutarate aldolase 1 [Id:1914682] Gm47942 0.0343 1.75 predicted gene. 47942 [Id:6097208] Fcer1g 4.74E-07 1.75 Fc receptor. IgE. High-affinity I. gamma polypeptide 28

[Id:95496] Il21r 0.0156 1.74 interleukin 21 receptor [Id:1890475] Gm5637 0.0011 1.74 predicted pseudogene 5637 [Id:3648120] Hist1h4i 0.0128 1.74 histone cluster 1. H4i [Id:2448432] complement component 4A (Rodgers blood group) C4a 0.0044 1.74 [Id:98320] Flnc 1E-05 1.74 filamin C. gamma [Id:95557] Liph 0.0160 1.73 lipase. member H [Id:2388029] poly (ADP-ribose) polymerase family. member 10 Parp10 0.0001 1.73 [Id:3712326] Jak3 2.87E-05 1.73 Janus kinase 3 [Id:99928] protein phosphatase 1. regulatory (inhibitor) subunit 14B Ppp1r14b 2.69E-05 1.73 [Id:107682] tumor necrosis factor receptor superfamily. member 1a Tnfrsf1a 8.83E-07 1.73 [Id:1314884] Ccdc102a 0.0118 1.72 coiled-coil domain containing 102A [Id:2686927] Oas2 0.0202 1.72 2'-5' oligoadenylate synthetase 2 [Id:2180852] tyrosine 3-monooxygenase/tryptophan 5- monooxygenase activation protein theta. pseudogene 3 Ywhaq-ps3 0.0019 1.72 [Id:3650241] C5ar2 0.0448 1.72 complement component 5a receptor 2 [Id:2442013] Baiap2l2 0.0076 1.71 BAI1-associated protein 2-like 2 [Id:2652819] Capn3 7.44E-05 1.71 calpain 3 [Id:107437] Gm7600 0.0160 1.70 predicted gene 7600 [Id:3647502] Nckap1l 3.91E-08 1.70 NCK associated protein 1 like [Id:1926063] poly (ADP-ribose) polymerase family. member 14 Parp14 6.57E-06 1.70 [Id:1919489] CCAAT/enhancer binding protein (C/EBP). alpha Cebpa 7.41E-06 1.70 [Id:99480] Mmp19 0.0226 1.70 matrix metallopeptidase 19 [Id:1927899] SAM domain. SH3 domain and nuclear localization Samsn1 0.0026 1.70 signals. 1 [Id:1914992] potassium inwardly-rectifying channel. subfamily K. Kcnk6 0.0009 1.69 member 6 [Id:1891291] Gm4149 4.1E-06 1.69 predicted pseudogene 4149 [Id:3782325] Mettl24 0.0437 1.69 methyltransferase like 24 [Id:3045338] Clcf1 0.0094 1.69 cardiotrophin-like cytokine factor 1 [Id:1930088] Dock2 0.0002 1.69 dedicator of cyto-kinesis 2 [Id:2149010] Hvcn1 0.0146 1.69 hydrogen voltage-gated channel 1 [Id:1921346] Usp18 0.0013 1.68 ubiquitin specific peptidase 18 [Id:1344364] Cd14 0.0014 1.68 CD14 antigen [Id:88318] Syk 8E-05 1.68 spleen tyrosine kinase [Id:99515] Cd53 1.02E-06 1.68 CD53 antigen [Id:88341] Cd180 0.001304 1.67 CD180 antigen [Id:1194924] Cd44 2.29E-05 1.66 CD44 antigen [Id:88338] Sspo 0.0003 1.66 SCO-spondin [Id:2674311] Tcap 0.0050 1.66 titin-cap [Id:1330233] 29

Gm10635 0.0145 1.66 predicted gene 10635 [Id:3641740] family with sequence similarity 46. member C Fam46c 0.0001 1.66 [Id:1921895] Lcp2 0.0029 1.66 lymphocyte cytosolic protein 2 [Id:1321402] lysosomal-associated protein transmembrane 5 Laptm5 1.38E-06 1.66 [Id:108046] H2-Ob 0.0480 1.66 histocompatibility 2. O region beta locus [Id:95925] Il10ra 1.25E-05 1.66 interleukin 10 receptor. alpha [Id:96538] Pycard 0.0013 1.65 PYD and CARD domain-containing [Id:1931465] Gm24270 0.0319 1.65 predicted gene. 24270 [Id:5454047] I830077J02R ik 0.0431 1.65 RIKEN cDNA I830077J02 gene [Id:3588284] Traf3ip3 0.0288 1.65 TRAF3 interacting protein 3 [Id:2441706] Cd37 0.0002 1.65 CD37 antigen [Id:88330] Cmklr1 0.0023 1.65 chemokine-like receptor 1 [Id:109603] Ncf2 0.0013 1.65 neutrophil cytosolic factor 2 [Id:97284] Casp8 0.0016 1.65 caspase 8 [Id:1261423] poly (ADP-ribose) polymerase family. member 9 Parp9 0.0009 1.65 [Id:1933117] Dapk2 0.0096 1.65 death-associated protein kinase 2 [Id:1341297] Ctsz 0.0007 1.64 cathepsin Z [Id:1891190] Fblim1 0.0253 1.64 filamin binding LIM protein 1 [Id:1921452] Gm13611 0.0181 1.64 predicted gene 13611 [Id:3651300] Gm7276 0.0369 1.64 predicted gene 7276 [Id:3646549] Hspb1 0.0042 1.64 heat shock protein 1 [Id:96240] Gm7436 0.0065 1.63 predicted gene 7436 [Id:3646488] Zfp36 0.0015 1.63 zinc finger protein 36 [Id:99180] CKLF-like MARVEL transmembrane domain containing Cmtm3 0.0001 1.63 3 [Id:2447162] Gm12906 0.0116 1.62 predicted gene 12906 [Id:3650884] Gbp4 0.0303 1.62 guanylate binding protein 4 [Id:97072] membrane-spanning 4-domains. subfamily A. member Ms4a6b 0.0292 1.62 6B [Id:1917024] Hpse 0.0323 1.62 heparanase [Id:1343124] Il3ra 0.0231 1.62 interleukin 3 receptor. alpha chain [Id:96553] Gm13743 0.0048 1.62 predicted gene 13743 [Id:3650802] Lacc1 0.0007 1.62 laccase domain containing 1 [Id:2445077] Cela1 0.0054 1.61 chymotrypsin-like elastase family. member 1 [Id:95314] Sh3bp2 0.0013 1.61 SH3-domain binding protein 2 [Id:1346349] AA414992 0.0496 1.61 expressed sequence AA414992 [Id:2142939] Mlxipl 0.0045 1.60 MLX interacting protein-like [Id:1927999] Pdlim4 2.72E-06 1.60 PDZ and LIM domain 4 [Id:1353470] Upk1b 0.0408 1.60 uroplakin 1B [Id:98912] Col4a6 0.0085 1.60 collagen. type IV. alpha 6 [Id:2152695] Trim34a 0.0229 1.60 tripartite motif-containing 34A [Id:2137359] Plau 0.0059 1.60 plasminogen activator. urokinase [Id:97611] 30

Lrrc3 3.6E-06 1.60 leucine rich repeat containing 3 [Id:2447899] Igtp 0.0024 1.59 interferon gamma induced GTPase [Id:107729] Olfml3 5.68E-06 1.59olfactomedin-like 3 [Id:1914877] Plcb2 0.0016 1.59 phospholipase C. beta 2 [Id:107465] Gm15432 0.0058 1.59 predicted gene 15432 [Id:3801969] apolipoprotein B mRNA editing enzyme. catalytic Apobec3 0.0429 1.59 polypeptide 3 [Id:1933111] Dok1 0.0132 1.58 docking protein 1 [Id:893587] AI467606 0.0462 1.58 expressed sequence AI467606 [Id:2141979] Cd274 0.000 1.58 CD274 antigen [Id:1926446] Ifi35 0.0067 1.58 interferon-induced protein 35 [Id:1917360] S100a11 0.0071 1.58 S100 calcium binding protein A11 [Id:1338798] Mgst1 3.69E-07 1.58 microsomal glutathione S-transferase 1 [Id:1913850] Iigp1 0.0027 1.57 interferon inducible GTPase 1 [Id:1926259] A830009L08 Rik 0.0388 1.57 RIKEN cDNA A830009L08 gene [Id:2443762] Rhbdf2 0.0278 1.57 rhomboid 5 homolog 2 [Id:2442473] interferon induced transmembrane protein 3 Ifitm3 0.0036 1.57 [Id:1913391] Gm10269 0.0330 1.56 predicted gene 10269 [Id:3642381] Tmem119 5.88E-05 1.56 transmembrane protein 119 [Id:2385228] piezo-type mechanosensitive ion channel component 2 Piezo2 0.0093 1.56 [Id:1918781] Gm16399 0.0012 1.56 predicted pseudogene 16399 [Id:3645963] Gm20501 0.0240 1.56 predicted gene 20501 [Id:5141966] Jrk 4.06E-05 1.56 jerky [Id:106214] Fzd10 0.0170 1.56 frizzled class receptor 10 [Id:2136761] Zfp429 0.0109 1.56 zinc finger protein 429 [Id:1920057] Klk6 0.0013 1.56 kallikrein related-peptidase 6 [Id:1343166] Vcam1 2.98E-09 1.56 vascular cell adhesion molecule 1 [Id:98926] Plcg2 0.0014 1.56 phospholipase C. gamma 2 [Id:97616] pleckstrin homology domain-containing. family A (phosphoinositide binding specific) member 4 Plekha4 0.0153 1.56 [Id:1916467] H2-T23 1.86E-05 1.55 histocompatibility 2. T region locus 23 [Id:95957] Cnmd 0.0449 1.55 chondromodulin [Id:1341171] Zfp524 0.0187 1.55 zinc finger protein 524 [Id:1916740] phosphoinositide-3-kinase regulatory subunit 5 Pik3r5 0.0054 1.55 [Id:2443588] Parvg 0.0004 1.55 parvin. gamma [Id:2158329] DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 Ddx60 0.0172 1.55 [Id:2384570] Nfam1 0.0067 1.55 Nfat activating molecule with ITAM motif 1 [Id:1921289] transporter 1. ATP-binding cassette. sub-family B Tap1 0.0017 1.55 (MDR/TAP) [Id:98483] Rnase4 0.0249 1.54 ribonuclease. RNase A family 4 [Id:1926217] Emilin2 0.0014 1.54 elastin microfibril interfacer 2 [Id:2389136] 31

Lpcat2 1.61E-05 1.54 lysophosphatidylcholine acyltransferase 2 [Id:3606214] Glipr2 0.0011 1.54 GLI pathogenesis-related 2 [Id:1917770] Casp1 0.0002 1.54 caspase 1 [Id:96544] Gm4950 3.02E-05 1.54 predicted pseudogene 4950 [Id:3649015] interferon induced transmembrane protein 2 Ifitm2 0.0060 1.54 [Id:1933382] Cxcr4 0.0115 1.54 chemokine (C-X-C motif) receptor 4 [Id:109563] v-maf musculoaponeurotic fibrosarcoma oncogene Mafb 4.84E-05 1.54 family. protein B (avian) [Id:104555] nuclear factor of kappa light polypeptide gene enhancer Nfkb2 0.0055 1.53 in B cells 2. p49/p100 [Id:1099800] Inpp5d 1.04E-05 1.53 inositol polyphosphate-5-phosphatase D [Id:107357] Tlr13 0.0032 1.53 toll-like receptor 13 [Id:3045213] Ctsc 1.56E-05 1.53 cathepsin C [Id:109553] Nupr1 0.0001 1.53 nuclear protein transcription regulator 1 [Id:1891834] protein phosphatase 1. regulatory subunit 18 Ppp1r18 0.0015 1.53 [Id:1923698] Gm20559 0.0118 1.53 predicted gene. 20559 [Id:5295666] Arl5c 0.0097 1.53 ADP-ribosylation factor-like 5C [Id:3028577] Tmem258 1.78E-07 1.52 transmembrane protein 258 [Id:1916288] Gbp7 0.0001 1.52 guanylate binding protein 7 [Id:2444421] Snx22 0.0010 1.52 sorting nexin 22 [Id:2685966] N-acetylated alpha-linked acidic dipeptidase 2 Naalad2 0.0055 1.52 [Id:1919810] poly (ADP-ribose) polymerase family. member 3 Parp3 0.0001 1.51 [Id:1891258] Angptl4 0.0102 1.51 angiopoietin-like 4 [Id:1888999] Grn 1.63E-06 1.51 granulin [Id:95832] Ly75 0.0439 1.50 lymphocyte antigen 75 [Id:106662] Adam8 0.0067 1.50 a disintegrin and metallopeptidase domain 8 [Id:107825] Igfbp7 0.0056 1.50 insulin-like growth factor binding protein 7 [Id:1352480] ArfGAP with SH3 domain. ankyrin repeat and PH Asap3 8.01E-05 1.50 domain 3 [Id:2684986] A2m 0.0054 1.50 alpha-2-macroglobulin [Id:2449119] Chia1 0.0269 1.50 chitinase. acidic 1 [Id:1932052] Fgfrl1 1.74E-06 1.50 fibroblast growth factor receptor-like 1 [Id:2150920] Tagln2 0.0003 1.50 transgelin 2 [Id:1312985]

Epm2a-/- Epm2b-/- Gene FDR FC FC FDR Description [MGI Id] Chil3 0.0079 201.73 236.11 0.0029 chitinase-like 3 [Id:1330860] Lcn2 1.57E-08 138.06 126.29 2.05E-08 lipocalin 2 [Id:96757] Retnla 0.0498 50.80 44.59 0.0377 resistin like alpha [Id:1888504] Mmp3 4.46E-07 44.19 53.78 3.91E-08 matrix metallopeptidase 3 [Id:97010] H2-M2 6.15E-06 42.23 43.35 2.71E-06 histocompatibility 2. M region locus 2 [Id:95914] Mmp12 0.0062 36.94 34.09 0.0037 matrix metallopeptidase 12 [Id:97005] Ccl8 0.0022 26.36 29.66 0.0007 chemokine (C-C motif) ligand 8 [Id:101878] ATPase. H+ transporting. lysosomal V0 subunit D2 Atp6v0d2 0.0068 22.77 30.48 0.0011 [Id:1924415] Cxcl10 1.65E-12 21.84 20.06 1.57E-12 chemokine (C-X-C motif) ligand 10 [Id:1352450] Arg1 0.0489 15.92 13.70 0.0392 arginase. liver [Id:88070] C3 1.73E-05 15.51 14.94 1.18E-05 complement component 3 [Id:88227] Ccl2 9.12E-08 13.40 12.68 9.69E-08 chemokine (C-C motif) ligand 2 [Id:98259] Ccl5 7.37E-12 13.10 13.71 1.61E-12 chemokine (C-C motif) ligand 5 [Id:98262] Steap4 5.84E-16 12.91 12.37 2.03E-16 STEAP family member 4 [Id:1923560] Hcar2 9.29E-07 12.91 10.49 3.62E-06 hydroxycarboxylic acid receptor 2 [Id:1933383] Tgm1 1.32E-10 12.80 9.85 2.86E-09 transglutaminase 1. K polypeptide [Id:98730] Cxcl5 0.0001 12.73 8.13 0.0003 chemokine (C-X-C motif) ligand 5 [Id:1096868] WNT1 inducible signaling pathway protein 2 Wisp2 4.03E-06 11.47 13.49 4.24E-07 [Id:1328326] serine (or cysteine) peptidase inhibitor. clade A. Serpina3i 0.0004 11.30 14.12 3.66E-05 member 3I [Id:2182841] T cell-interacting. activating receptor on myeloid cells Tarm1 0.0084 10.82 6.53 0.0312 1 [Id:2442280] Il1rl1 0.0047 9.42 6.52 0.0110interleukin 1 receptor-like 1 [Id:98427] Timp1 6.47E-12 9.19 10.09 5.48E-13 tissue inhibitor of metalloproteinase 1 [Id:98752] Fcgr4 2.37E-06 9.15 10.65 3.22E-07 Fc receptor. IgG. low affinity IV [Id:2179523] CD74 antigen (invariant polypeptide of major histocompatibility complex. class II antigen- Cd74 0.0138 7.96 6.36 0.0129 associated) [Id:96534] C-type lectin domain family 7. member a Clec7a 0.0020 7.87 8.82 0.0006 [Id:1861431] Ccl12 3.82E-09 6.99 6.36 9.35E-09 chemokine (C-C motif) ligand 12 [Id:108224] Cst7 0.0064 6.50 7.11 0.0021 cystatin F (leukocystatin) [Id:1298217] Itgax 0.0046 6.47 5.95 0.0029 integrin alpha X [Id:96609] AI838599 1.54E-05 6.40 5.46 3.56E-05 expressed sequence AI838599 [Id:3510989] Acp5 0.0002 6.17 6.12 0.0001 acid phosphatase 5. tartrate resistant [Id:87883] histocompatibility 2. class II antigen A. beta 1 H2-Ab1 0.0136 6.03 5.11 0.0117 [Id:103070] H2-Aa 0.0136 5.81 4.79 0.0127 histocompatibility 2. class II antigen A. alpha 33

[Id:95895] Lyz2 0.0004 5.47 6.51 0.0001 lysozyme 2 [Id:96897] Ly9 1.35E-06 5.44 4.57 4.22E-06 lymphocyte antigen 9 [Id:96885] Zbp1 1.02E-05 5.14 4.05 6.18E-05 Z-DNA binding protein 1 [Id:1927449] leukocyte immunoglobulin-like receptor. subfamily B. Lilrb4a 1.13E-05 5.07 4.76 1.06E-05 member 4A [Id:102701] Lgals3 0.0002 5.03 5.00 0.0001 lectin. galactose binding. soluble 3 [Id:96778] Gm26917 0.0002 5.00 4.51 0.0001 predicted gene. 26917 [Id:5504032] H2-Eb1 0.0224 4.91 4.13 0.0209 histocompatibility 2. class II antigen E beta [Id:95901] B cell leukemia/lymphoma 2 related protein A1b Bcl2a1b 0.0002 4.89 4.20 0.0005 [Id:1278326] sialic acid binding Ig-like lectin 1. sialoadhesin Siglec1 0.0029 4.87 4.32 0.0024 [Id:99668] Cxcr6 0.0029 4.82 5.09 0.0007 chemokine (C-X-C motif) receptor 6 [Id:1934582] Slamf8 0.0004 4.60 3.28 0.0038 SLAM family member 8 [Id:1921998] Gm1966 1.08E-06 4.41 4.04 1.75E-06 predicted gene 1966 [Id:3584360] Fcgr2b 0.0080 4.37 3.46 0.0101 Fc receptor. IgG. low affinity IIb [Id:95499] leukocyte immunoglobulin-like receptor. subfamily B. Lilr4b 0.0003 4.34 3.44 0.0012 member 4B [Id:102702] Gimap3 0.0002 4.33 5.21 1.11E-05 GTPase. IMAP family member 3 [Id:1932723] tumor necrosis factor (ligand) superfamily. member 8 Tnfsf8 0.0002 4.30 3.45 0.0010 [Id:88328] Pirb 7.61E-06 4.27 3.47 4.78E-05paired Ig-like receptor B [Id:894311] Ifi213 4.07E-05 4.17 3.63 8.70E-05 interferon activated gene 213 [Id:3695276] Gpnmb 0.0069 4.12 4.42 0.0024 glycoprotein (transmembrane) nmb [Id:1934765] Cd52 0.0004 4.11 4.76 8.82E-05 CD52 antigen [Id:1346088] B430306 N03Rik 0.0005 4.07 3.18 0.0063 RIKEN cDNA B430306N03 gene [Id:2443478] Ifi207 0.0007 3.98 2.78 0.0063 interferon activated gene 207 [Id:2138302] Cd72 9.75E-05 3.91 3.47 0.0001 CD72 antigen [Id:88345] Gimap4 0.0013 3.91 3.01 0.0060 GTPase. IMAP family member 4 [Id:1349656] Ifi204 3.48E-06 3.78 3.46 5.35E-06 interferon activated gene 204 [Id:96429] Cd300lf 3.50E-06 3.70 3.21 1.16E-05 CD300 molecule like family member F [Id:2442359] membrane-spanning 4-domains. subfamily A. Ms4a7 0.0091 3.67 3.32 0.0079 member 7 [Id:1918846] paired immunoglobin-like type 2 receptor alpha Pilra 0.0091 3.67 3.50 0.0055 [Id:2450529] Oasl1 0.0007 3.52 2.31 0.01922'-5' oligoadenylate synthetase-like 1 [Id:2180849] serine (or cysteine) peptidase inhibitor. clade A. Serpina3n 0.0006 3.51 2.69 0.0012 member 3N [Id:105045] Cnr2 0.0010 3.45 3.01 0.0016 cannabinoid receptor 2 (macrophage) [Id:104650] Gpr65 0.0020 3.45 3.67 0.0004 G-protein coupled receptor 65 [Id:108031] triggering receptor expressed on myeloid cells-like 2 Treml2 9.55E-05 3.44 3.07 0.0001 [Id:2147038] Slc43a3 2.85E-06 3.44 2.75 2.73E-05 solute carrier family 43. member 3 [Id:1931054] complement component 4B (Chido blood group) C4b 8.76E-05 3.44 3.31 5.04E-05 [Id:88228] Oas1a 0.0001 3.36 2.57 0.0015 2'-5' oligoadenylate synthetase 1A [Id:2180860] 34

Rps24- ps2 0.0007 3.33 3.62 0.0001 ribosomal protein S24. pseudogene 2 [Id:3649025] tumor necrosis factor. alpha-induced protein 2 Tnfaip2 7.47E-09 3.31 3.80 1.89E-10 [Id:104960] Ptx3 0.0038 3.30 2.86 0.0054 pentraxin related gene [Id:104641] tumor necrosis factor receptor superfamily. member Tnfrsf9 0.0047 3.28 3.97 0.0002 9 [Id:1101059] Adora3 0.0009 3.25 2.39 0.0085 adenosine A3 receptor [Id:104847] Gbp5 7.37E-10 3.24 3.19 5.15E-10 guanylate binding protein 5 [Id:2429943] Ifi209 0.0005 3.24 3.34 0.0001 interferon activated gene 209 [Id:2138243] Il1rl2 0.0048 3.18 2.89 0.0041interleukin 1 receptor-like 2 [Id:1913107] colony stimulating factor 2 receptor. beta. low-affinity Csf2rb 5.90E-07 3.18 2.87 1.61E-06 (granulocyte-macrophage) [Id:1339759] Cd22 0.0002 3.17 3.40 3.54E-05 CD22 antigen [Id:88322] BC03504 4 5.60E-05 3.17 2.35 0.0013 cDNA sequence BC035044 [Id:2448540] CCAAT/enhancer binding protein (C/EBP). delta Cebpd 8.69E-06 3.15 2.50 6.12E-05 [Id:103573] caspase 4. apoptosis-related cysteine peptidase Casp4 0.0002 3.14 3.47 2.64E-05 [Id:107700] Il2rg 0.0026 3.12 2.16 0.0345 interleukin 2 receptor. gamma chain [Id:96551] C-type lectin domain family 4. member a2 Clec4a2 0.0006 3.12 2.45 0.0038 [Id:1349412] Ccl6 0.0001 3.06 3.39 2.20E-05 chemokine (C-C motif) ligand 6 [Id:98263] 1810011 H11Rik 0.0004 3.04 2.73 0.0006 RIKEN cDNA 1810011H11 gene [Id:1916319] NLR family. apoptosis inhibitory protein 2 Naip2 2.41E-06 3.02 2.84 2.90E-06 [Id:1298226] C3ar1 9.14E-06 2.99 2.70 1.51E-05 complement component 3a receptor 1 [Id:1097680] Gbp2 1.32E-10 2.97 2.81 1.89E-10 guanylate binding protein 2 [Id:102772] Slfn2 3.00E-07 2.93 2.65 9.67E-07 schlafen 2 [Id:1313258] radical S-adenosyl methionine domain containing 2 Rsad2 7.91E-08 2.92 2.98 2.43E-08 [Id:1929628] pyrimidinergic receptor P2Y. G-protein coupled. 6 P2ry6 6.61E-07 2.91 2.44 8.01E-06 [Id:2673874] Tlr1 5.45E-05 2.87 2.12 0.0017toll-like receptor 1 [Id:1341295] Top2a 0.0011 2.87 2.32 0.0046 topoisomerase (DNA) II alpha [Id:98790] complement component 1. s subcomponent 1 C1s1 6.67E-05 2.85 2.27 0.0006 [Id:1355312] Ctss 0.0014 2.83 2.72 0.0007 cathepsin S [Id:107341] Lag3 0.0006 2.81 2.49 0.0007 lymphocyte-activation gene 3 [Id:106588] Ifi47 2.30E-05 2.80 2.51 5.32E-05 interferon gamma inducible protein 47 [Id:99448] guanine nucleotide binding protein. alpha 15 Gna15 1.11E-05 2.79 2.63 1.26E-05 [Id:95770] Nlrc5 6.15E-06 2.79 2.55 1.09E-05 NLR family. CARD domain containing 5 [Id:3612191] Myo1g 0.0004 2.79 2.28 0.0024 myosin IG [Id:1927091] Ifi30 0.0181 2.78 2.15 0.0388 interferon gamma inducible protein 30 [Id:2137648] complement component 1. q subcomponent. alpha C1qa 0.0006 2.75 2.61 0.0003 polypeptide [Id:88223] 35

Gbp8 0.0092 2.74 3.23 0.0007 guanylate-binding protein 8 [Id:1923324] Cd84 3.25E-07 2.73 2.77 1.22E-07 CD84 antigen [Id:1336885] membrane-spanning 4-domains. subfamily A. Ms4a6d 1.23E-05 2.73 2.52 1.91E-05 member 6D [Id:1916024] AU02020 6 0.0063 2.72 2.54 0.0043 expressed sequence AU020206 [Id:2142134] Bst2 0.0004 2.71 2.30 0.0008 bone marrow stromal cell antigen 2 [Id:1916800] Myo1f 6.12E-09 2.68 2.17 4.92E-07 myosin IF [Id:107711] H2-Q7 2.02E-05 2.68 2.31 8.05E-05histocompatibility 2. Q region locus 7 [Id:95936] Gfap 0.0007 2.67 2.50 0.0005 glial fibrillary acidic protein [Id:95697] Gpr35 0.0008 2.67 2.26 0.0027 G protein-coupled receptor 35 [Id:1929509] Rasal3 1.18E-07 2.67 2.34 9.80E-07 RAS protein activator like 3 [Id:2444128] Tlr2 7.91E-08 2.65 2.32 7.17E-07 toll-like receptor 2 [Id:1346060] Fcgr3 0.0048 2.65 2.32 0.0049 Fc receptor. IgG. low affinity III [Id:95500] proteasome (prosome. macropain) subunit. beta type Psmb8 6.47E-06 2.63 2.23 3.93E-05 8 (large multifunctional peptidase 7) [Id:1346527] Epsti1 0.0001 2.62 2.42 0.0001 epithelial stromal interaction 1 (breast) [Id:1915168] Chil1 1.85E-14 2.62 2.35 1.40E-13 chitinase-like 1 [Id:1340899] complement component 1. q subcomponent. C chain C1qc 0.0018 2.62 2.55 0.0009 [Id:88225] Osmr 5.07E-07 2.61 2.17 5.52E-06 oncostatin M receptor [Id:1330819] Il1b 0.0197 2.60 2.99 0.0022 interleukin 1 beta [Id:96543] angiogenin. ribonuclease. RNase A family. 5 Ang 0.0012 2.59 2.15 0.0038 [Id:88022] Cxcl16 4.07E-05 2.54 2.47 2.62E-05 chemokine (C-X-C motif) ligand 16 [Id:1932682] Gbp10 0.0095 2.54 3.04 0.0005 guanylate-binding protein 10 [Id:4359647] H2-Oa 0.0267 2.54 2.57 0.0111 histocompatibility 2. O region alpha locus [Id:95924] Oasl2 2.24E-10 2.54 2.23 3.24E-092'-5' oligoadenylate synthetase-like 2 [Id:1344390] H2-Q4 0.0011 2.53 2.30 0.0011histocompatibility 2. Q region locus 4 [Id:95933] interferon. alpha-inducible protein 27 like 2A Ifi27l2a 3.18E-06 2.52 2.58 8.82E-07 [Id:1924183] complement component 1. q subcomponent. beta C1qb 0.0016 2.49 2.54 0.0006 polypeptide [Id:88224] Cyba 0.0007 2.49 2.37 0.0004 cytochrome b-245. alpha polypeptide [Id:1316658] Clec10a 0.0321 2.48 2.51 0.0136 C-type lectin domain family 10. member A [Id:96975] H2-Q6 4.44E-06 2.46 2.32 5.73E-06histocompatibility 2. Q region locus 6 [Id:95935] Cd300c2 2.05E-05 2.46 2.31 2.29E-05 CD300C molecule 2 [Id:2153249] Gbp6 6.60E-06 2.44 2.58 9.74E-07 guanylate binding protein 6 [Id:2140937] H2-K1 0.0038 2.41 2.17 0.0034 histocompatibility 2. K1. K region [Id:95904] H2-D1 0.0083 2.40 2.18 0.0068histocompatibility 2. D region locus 1 [Id:95896] Tmem106 a 0.0005 2.40 2.39 0.0002 transmembrane protein 106A [Id:1922056] S100 calcium binding protein A6 (calcyclin) S100a6 0.0062 2.39 2.26 0.0041 [Id:1339467] tumor necrosis factor. alpha-induced protein 8-like 2 Tnfaip8l2 0.0109 2.39 2.51 0.0031 [Id:1917019] Gm5086 0.0006 2.37 2.12 0.0013 predicted gene 5086 [Id:3644417] 36

triggering receptor expressed on myeloid cells 2 Trem2 0.0002 2.34 2.26 0.0001 [Id:1913150] Fas 2.03E-05 2.34 2.16 3.57E-05 Fas (TNF receptor superfamily member 6) [Id:95484] Cd48 7.62E-05 2.32 2.36 1.93E-05 CD48 antigen [Id:88339] Sash3 0.0242 2.32 2.15 0.0199 SAM and SH3 domain containing 3 [Id:1921381] Irf7 0.0035 2.32 2.25 0.0018 interferon regulatory factor 7 [Id:1859212] capping protein (actin filament). gelsolin-like Capg 5.57E-05 2.31 2.63 2.03E-06 [Id:1098259] colony stimulating factor 2 receptor. beta 2. low- Csf2rb2 0.0017 2.31 2.79 4.17E-05 affinity (granulocyte-macrophage) [Id:1339760] Slc15a3 0.0045 2.29 2.13 0.0037 solute carrier family 15. member 3 [Id:1929691] Pld4 0.0001 2.29 2.19 0.0001 phospholipase D family. member 4 [Id:2144765] Isg15 0.0121 2.28 2.26 0.0057ISG15 ubiquitin-like modifier [Id:1855694] Tyrobp/D TYRO protein tyrosine kinase binding protein AP12 3.51E-05 2.27 2.61 4.18E-06 [Id:1277211] Siglecf 0.0042 2.27 2.02 0.0067 sialic acid binding Ig-like lectin F [Id:2681107] S1pr3 2.63E-08 2.24 2.16 3.06E-08 sphingosine-1-phosphate receptor 3 [Id:1339365] Rac2 0.0001 2.24 2.10 0.0001 Rac family small GTPase 2 [Id:97846] Lyl1 0.0004 2.22 2.12 0.0003 lymphoblastomic leukemia 1 [Id:96891] Rtp4 9.14E-06 2.20 2.17 4.67E-06 receptor transporter protein 4 [Id:1915025] Cp 7.37E-12 2.18 2.03 2.87E-11 ceruloplasmin [Id:88476] Socs3 0.0023 2.18 2.33 0.0003 suppressor of cytokine signaling 3 [Id:1201791] solute carrier family 11 (proton-coupled divalent Slc11a1 5.11E-06 2.16 2.12 3.28E-06 metal ion transporters). member 1 [Id:1345275] Aspg 0.0007 2.16 2.25 0.0001 asparaginase [Id:2144822] thymocyte selection associated family member 2 Themis2 0.0015 2.16 2.01 0.0015 [Id:2446213] AW11201 0 0.0001 2.15 2.66 1.15E-06 expressed sequence AW112010 [ID:2147706] Tusc5 0.0471 2.14 2.79 0.0015 tumor suppressor candidate 5 [Id:3029307] Arhgap45 6.01E-07 2.12 2.08 4.24E-07 Rho GTPase activating protein 45 [Id:1917969] Irf5 0.0032 2.09 2.11 0.0011 interferon regulatory factor 5 [Id:1350924] Rhoh 0.0081 2.09 2.18 0.0018 ras homolog family member H [Id:1921984] Fermt3 1.63E-06 2.09 2.09 6.65E-07 fermitin family member 3 [Id:2147790] interferon-induced protein with tetratricopeptide Ifit1 3.26E-06 2.09 2.31 1.80E-07 repeats 1 [Id:99450] NLR family. apoptosis inhibitory protein 5 Naip5 0.0018 2.07 2.08 0.0006 [Id:1298220] Bin2 2.85E-05 2.07 2.22 2.70E-06 bridging integrator 2 [Id:3611448] Bruton agammaglobulinemia tyrosine kinase Btk 0.0060 2.07 2.30 0.0004 [Id:88216] Was 0.0174 2.06 2.19 0.0036 Wiskott-Aldrich syndrome [Id:105059] Neurl3 0.0020 2.04 2.09 0.0004 neuralized E3 ubiquitin protein ligase 3 [Id:2429944] Ltc4s 0.0192 2.03 2.01 0.0089 leukotriene C4 synthase [Id:107498] Ctsh 0.0099 2.02 2.07 0.0035 cathepsin H [Id:107285] Mx1 4.30E-06 3.88 1.97 0.0126MX dynamin-like GTPase 1 [Id:97243] Hspb1 7.23E-07 2.66 1.64 0.0042 heat shock protein 1 [Id:96240] 37

Arhgap9 0.0002 2.65 1.86 0.0122 Rho GTPase activating protein 9 [Id:2143764] Gm42047 0.0022 2.51 1.78 0.0333 predicted gene. 42047 [Id:5624932] Fcgr1 5.32E-08 2.47 1.92 9.14E-06 Fc receptor. IgG. high affinity I [Id:95498] Il1a 0.0028 2.38 1.82 0.0267 interleukin 1 alpha [Id:96542] Oas2 0.0006 2.38 1.72 0.0202 2'-5' oligoadenylate synthetase 2 [Id:2180852] Cybb 9.55E-05 2.35 1.85 0.0019 cytochrome b-245. beta polypeptide [Id:88574] colony stimulating factor 3 receptor (granulocyte) Csf3r 8.93E-10 2.34 1.96 8.47E-08 [Id:1339755] Adgre1 0.0020 2.29 1.95 0.0035 adhesion G protein-coupled receptor E1 [Id:106912] Spint1 4.84E-06 2.27 1.85 0.0001 serine protease inhibitor. Kunitz type 1 [Id:1338033] Cd68 6.33E-09 2.26 1.91 3.11E-07 CD68 antigen [Id:88342] Vav1 1.28E-05 2.22 1.99 4.32E-05 vav 1 oncogene [Id:98923] Trim30a 0.0003 2.22 1.93 0.0007 tripartite motif-containing 30A [Id:98178] Fblim1 0.0010 2.20 1.64 0.0253 filamin binding LIM protein 1 [Id:1921452] Cmklr1 2.02E-05 2.19 1.65 0.0023 chemokine-like receptor 1 [Id:109603] Irf8 0.0001 2.17 1.94 0.0003 interferon regulatory factor 8 [Id:96395] Ncf4 0.0068 2.17 1.83 0.0203 neutrophil cytosolic factor 4 [Id:109186] Tlr7 4.30E-06 2.16 1.91 2.64E-05 toll-like receptor 7 [Id:2176882] Fyb 2.38E-05 2.15 1.90 0.0001 FYN binding protein [Id:1346327] Ncf1 4.65E-07 2.15 1.99 1.27E-06 neutrophil cytosolic factor 1 [Id:97283] Ip6k3 0.0101 2.15 1.98 0.0105 inositol hexaphosphate kinase 3 [Id:3045325] Itgal 0.0050 2.15 1.97 0.0057 integrin alpha L [Id:96606] Vim 0.0082 2.13 1.97 0.0064 vimentin [Id:98932] E74-like factor 4 (ets domain transcription factor) Elf4 0.0001 2.12 1.79 0.0012 [Id:1928377] Trim47 0.0001 2.12 1.99 0.0001 tripartite motif-containing 47 [Id:1917374] lectin. galactoside-binding. soluble. 3 binding protein Lgals3bp 0.0042 2.12 1.77 0.0078 [Id:99554] Gbp3 1.29E-06 2.12 1.93 4.57E-06 guanylate binding protein 3 [Id:1926263] Mpeg1 2.87E-05 2.10 1.99 2.49E-05 macrophage expressed gene 1 [Id:1333743] basic leucine zipper transcription factor. ATF-like 3 Batf3 0.0237 2.09 1.94 0.0237 [Id:1925491] Cd86 2.05E-05 2.08 1.89 6.15E-05 CD86 antigen [Id:101773] Cybrd1 2.01E-05 2.07 1.86 7.44E-05 cytochrome b reductase 1 [Id:2654575] Hvcn1 0.0021 2.07 1.69 0.0146 hydrogen voltage-gated channel 1 [Id:1921346] Dock2 1.14E-05 2.04 1.69 0.0002 dedicator of cyto-kinesis 2 [Id:2149010] SAM domain. SH3 domain and nuclear localization Samsn1 0.0002 2.04 1.70 0.0026 signals. 1 [Id:1914992] Usp18 7.94E-05 2.04 1.68 0.0013 ubiquitin specific peptidase 18 [Id:1344364] Hck 0.0001 2.04 1.87 0.0003 hemopoietic cell kinase [Id:96052] Itgb2 0.0002 2.04 1.93 0.0002 integrin beta 2 [Id:96611] Il21r 0.0052 2.04 1.74 0.0156 interleukin 21 receptor [Id:1890475] interferon-induced protein with tetratricopeptide Ifit3b 3.01E-07 2.02 1.82 2.10E-06 repeats 3B [Id:3698419] actin related protein 2/3 complex. subunit 1B Arpc1b 0.0006 2.02 1.87 0.0006 [Id:1343142] 38

NLR family. apoptosis inhibitory protein 6 Naip6 0.0030 2.02 1.82 0.0051 [Id:1298222] potassium inwardly-rectifying channel. subfamily K. Kcnk6 8.90E-05 2.01 1.69 0.0009 member 6 [Id:1891291] poly (ADP-ribose) polymerase family. member 14 Parp14 1.18E-07 2.01 1.70 6.57E-06 [Id:1919489] Prrx2 0.0170 1.98 2.28 0.0011 paired related homeobox 2 [Id:98218] Gadl1 0.0210 1.95 2.10 0.0035 glutamate decarboxylase-like 1 [Id:1920998] family with sequence similarity 83. member D Fam83d 0.0209 1.93 2.25 0.0012 [Id:1919128] Aif1 3.77E-06 1.93 2.11 1.44E-07 allograft inflammatory factor 1 [Id:1343098] suppression of tumorigenicity 14 (colon carcinoma) St14 0.0295 1.85 2.23 0.0011 [Id:1338881] protein tyrosine phosphatase. non-receptor type 18 Ptpn18 0.0172 1.82 2.13 0.0007 [Id:108410] glycoprotein galactosyltransferase alpha 1. 3 Ggta1 0.0006 1.81 2.10 1.93E-05 [Id:95704] Slamf9 0.0199 1.79 2.47 6.09E-05 SLAM family member 9 [Id:1923692] hematopoietic cell specific Lyn substrate 1 Hcls1 8.90E-05 1.79 2.02 1.52E-06 [Id:104568] Igsf6 0.0163 1.70 2.04 0.0002 immunoglobulin superfamily. member 6 [Id:1891393] Klhl6 0.0458 1.65 2.05 0.0009 kelch-like 6 [Id:2686922]

A) Epm2a-/-

Gene FDR FC Description [MGI Id] Gm47283 3.48E-06 12.14 predicted gene. 47283 [Id:6096131] Ccl11 0.0274 6.47 chemokine (C-C motif) ligand 11 [Id:103576] AA465934 1.63E-13 5.65 expressed sequence AA465934 [Id:2671018] Igha 0.0124 4.85 immunoglobulin heavy constant alpha [Id:96444] membrane-spanning 4-domains. subfamily A. Ms4a6c 0.0003 3.47 member 6C [Id:2385644] Slfn9 6.15E-06 3.36 schlafen 9 [Id:2445121] Ccl17 0.0001 3.05 chemokine (C-C motif) ligand 17 [Id:1329039] Hspa1b 0.0004 2.98 heat shock protein 1B [Id:99517] Slamf6 0.0058 2.94 SLAM family member 6 [Id:1353620] Xaf1 0.0217 2.80 XIAP associated factor 1 [Id:3772572] cytochrome P450. family 4. subfamily f. Cyp4f18 0.0092 2.74 polypeptide 18 [Id:1919304] Mx2 4.61E-06 2.53 MX dynamin-like GTPase 2 [Id:97244] C5ar1 0.0045 2.42 complement component 5a receptor 1 [Id:88232] Gm45456 0.0022 2.53 predicted gene. 42047 [Id:5624932] Cysltr2 0.0127 2.37 cysteinyl leukotriene receptor 2 [Id:1917336] Ly86 2.05E-05 2.34 lymphocyte antigen 86 [Id:1321404] Sdf2l1 5.11E-05 2.34 stromal cell-derived factor 2-like 1 [Id:2149842] Rnase6 0.0024 2.33 ribonuclease. RNase A family. 6 [Id:1925666] Gm21887 0.0034 2.33 predicted gene. 21887 [Id:5434051] IQ motif containing GTPase activating protein 3 Iqgap3 0.0335 2.32 [Id:3028642] macrophage galactose N-acetyl-galactosamine Mgl2 0.0063 2.22 specific lectin 2 [Id:2385729] plasminogen activator. urokinase receptor Plaur 0.0167 2.09 [Id:97612] Plin4 9.01E-05 2.07 perilipin 4 [Id:1929709] Hspa1a 1.71E-05 2.04 heat shock protein 1A [Id:96244] zinc finger. MYND-type containing 15 Zmynd15 0.0230 2.04 [Id:3603821] Alkal2 0.0242 2.02 ALK and LTK ligand 2 [Id:3697448]

B) Epm2b-/-

Gene FDR FC Description [MGI Id] Gm8113 0.0334 8.72 predicted gene 8113 [Id:3648791] Wfdc17 0.0001 4.12 WAP four-disulfide core domain 17 [Id:3649773] DMRT-like family B with proline-rich C-terminal. 1 Dmrtb1 0.0353 3.28 [Id:1927125] Bcl3 0.0002 3.05 B cell leukemia/lymphoma 3 [Id:88140] Plbd1 0.0090 2.67 phospholipase B domain containing 1 [Id:1914107] Ccl9 4.75E-05 2.50 chemokine (C-C motif) ligand 9 [Id:104533] FGR proto-oncogene. Src family tyrosine kinase Fgr 0.0245 2.42 [Id:95527] Gm6008 0.0054 2.41 predicted gene 6008 [Id:3647051] Tgtp1 0.0034 2.39 T cell specific GTPase 1 [Id:98734] Gm8894 0.0043 2.36 predicted gene 8894 [Id:3643084] Ticam2 0.0332 2.32 toll-like receptor adaptor molecule 2 [Id:3040056] Gpx6 0.0070 2.31 glutathione peroxidase 6 [Id:1922762] Gpr84 0.0018 2.27 G protein-coupled receptor 84 [Id:1934129] Cysltr1 0.0046 2.20 cysteinyl leukotriene receptor 1 [Id:1926218] linker for activation of T cells family. member 2 Lat2 0.0331 2.20 [Id:1926479] Ccr2 0.0405 2.17 chemokine (C-C motif) receptor 2 [Id:106185] Gm4817 0.0056 2.17 predicted gene 4817 [Id:3644402] Cytip 0.0226 2.10 cytohesin 1 interacting protein [Id:2183535] Abi3 0.0039 2.08 ABI gene family. member 3 [Id:1913860] 3-hydroxyanthranilate 3.4-dioxygenase Haao 0.0477 2.07 [Id:1349444] Nos2 0.0152 2.06 nitric oxide synthase 2. inducible [Id:97361] Lst1 0.0058 2.05 leukocyte specific transcript 1 [Id:1096324] UDP-GlcNAc:betaGal beta-1.3-N- B3gnt7 0.0368 2.04 acetylglucosaminyltransferase 7 [Id:2384394] H2-DMb1 0.0070 2.03 histocompatibility 2. class II. locus Mb1 [Id:95922] Il1r2 0.0431 2.00 interleukin 1 receptor. type II [Id:96546] 5430427O19Rik 0.0392 2.00 RIKEN cDNA 5430427O19 gene [Id:1918648]

Epm2a-/- Epm2b-/- Gene FC FC Description [MGI Id] Cytokines and receptors Il1rl1 9.42 6.52 interleukin 1 receptor-like 1 [Id:98427] tumor necrosis factor (ligand) superfamily. member 8 Tnfsf8 4.30 3.45 [Id:88328] Tnfaip2 3.31 3.80 tumor necrosis factor. alpha-induced protein 2 [Id:104960] tumor necrosis factor receptor superfamily. member 9 Tnfrsf9 3.28 3.97 [Id:1101059] Il1rl2 3.18 2.89 interleukin 1 receptor-like 2 [Id:1913107] colony stimulating factor 2 receptor. beta. low-affinity Csf2rb 3.18 2.87 (granulocyte-macrophage) [Id:1339759] Il2rg 3.12 2.16 interleukin 2 receptor. gamma chain [Id:96551] Osmr 2.61 2.17 oncostatin M receptor [Id:1330819] Il1b 2.60 2.99 interleukin 1 beta [Id:96543] tumor necrosis factor. alpha-induced protein 8-like 2 Tnfaip8l2 2.39 2.51 [Id:1917019] Fas 2.34 2.16 Fas (TNF receptor superfamily member 6) [Id:95484] Il1a 2.38 1.82 interleukin 1 alpha [Id:96542] colony stimulating factor 2 receptor. beta 2. low-affinity Csf2rb2 2.31 2.79 (granulocyte-macrophage) [Id:1339760] Il21r 2.04 1.74 interleukin 21 receptor [Id:1890475]

Chemokines and receptors Ccl8 26.36 29.66 chemokine (C-C motif) ligand 8 [Id:101878] Cxcl10 21.84 20.06 chemokine (C-X-C motif) ligand 10 [Id:1352450] Ccl2 13.40 12.68 chemokine (C-C motif) ligand 2 [Id:98259] Ccl5 13.10 13.71 chemokine (C-C motif) ligand 5 [Id:98262] Cxcl5 12.73 8.13 chemokine (C-X-C motif) ligand 5 [Id:1096868] Ccl12 6.99 6.36 chemokine (C-C motif) ligand 12 [Id:108224] Cxcr6 4.82 5.09 chemokine (C-X-C motif) receptor 6 [Id:1934582] Ccl6 3.06 3.39 chemokine (C-C motif) ligand 6 [Id:98263] Cxcl16 2.54 2.47 chemokine (C-X-C motif) ligand 16 [Id:1932682]

Complement proteins C3 15.51 14.94 complement component 3 [Id:88227] C4b 3.44 3.31 complement component 4B (Chido blood group) [Id:88228] C3ar1 2.99 2.70 complement component 3a receptor 1 [Id:1097680] C1s1 2.85 2.27 complement component 1. s subcomponent 1 [Id:1355312] complement component 1. q subcomponent. alpha C1qa 2.75 2.61 polypeptide [Id:88223] 42

complement component 1. q subcomponent. C chain C1qc 2.62 2.55 [Id:88225] complement component 1. q subcomponent. beta C1qb 2.49 2.54 polypeptide [Id:88224]

Toll-like receptors Tlr1 2.87 2.12 toll-like receptor 1 [Id:1341295] Tlr2 2.65 2.32 toll-like receptor 2 [Id:1346060] Tlr7 2.16 1.91 toll-like receptor 7 [Id:2176882]

Interferon activated genes Ifi213/ Pydc4 4.17 3.63 interferon activated gene 213 [Id:3695276] Ifi207/ AI607873 3.98 2.78 interferon activated gene 207 [Id:2138302] Ifi204 3.78 3.46 interferon activated gene 204 [Id:96429] Ifi209/ Pyhin1 3.24 3.34 interferon activated gene 209 [Id:2138243] radical S-adenosyl methionine domain containing 2 Rsad2 2.92 2.98 [Id:1929628] Ifi47 2.80 2.51 interferon gamma inducible protein 47 [Id:99448] Nlrc5 2.79 2.55 NLR family. CARD domain containing 5 [Id:3612191] Ifi30 2.78 2.15 interferon gamma inducible protein 30 [Id:2137648] Ifi27l2a 2.52 2.58 interferon. alpha-inducible protein 27 like 2A [Id:1924183] Irf7 2.32 2.25 interferon regulatory factor 7 [Id:1859212] Trim30a 2.22 1.93 tripartite motif-containing 30A [Id:98178] Irf5 2.09 2.11 interferon regulatory factor 5 [Id:1350924] interferon-induced protein with tetratricopeptide repeats 1 Ifit1 2.09 2.31 [Id:99450] Irf8 2.17 1.94 interferon regulatory factor 8 [Id:96395] interferon-induced protein with tetratricopeptide repeats 3B Ifit3b 2.02 1.82 [Id:3698419]

Inflammasome related proteins Gbp5 3.24 3.19 guanylate binding protein 5 [Id:2429943] Casp4 3.14 3.47 caspase 4. apoptosis-related cysteine peptidase [Id:107700] Naip2 3.02 2.84 NLR family. apoptosis inhibitory protein 2 [Id:1298226] Naip5 2.07 2.08 NLR family. apoptosis inhibitory protein 5 [Id:1298220] Naip6 2.02 1.82 NLR family. apoptosis inhibitory protein 6 [Id:1298222]

Histocompatibility complex H2-M2 42.23 43.35 histocompatibility 2. M region locus 2 [Id:95914] CD74 antigen (invariant polypeptide of major histocompatibility complex. class II antigen-associated) Cd74 7.96 6.36 [Id:96534] H2-Ab1 6.03 5.11 histocompatibility 2. class II antigen A. beta 1 [Id:103070] H2-Aa 5.81 4.79 histocompatibility 2. class II antigen A. alpha [Id:95895] 43

H2-Eb1 4.91 4.13 histocompatibility 2. class II antigen E beta [Id:95901] Pirb/Lilrb3 4.27 3.47 paired Ig-like receptor B [Id:894311] Ctss 2.83 2.72 cathepsin S [Id:107341] H2-Q7 2.68 2.31 histocompatibility 2. Q region locus 7 [Id:95936] H2-Oa 2.54 2.57 histocompatibility 2. O region alpha locus [Id:95924] H2-Q4/ H2-Gs10 2.53 2.30 histocompatibility 2. Q region locus 4 [Id:95933] H2-Q6 2.46 2.32 histocompatibility 2. Q region locus 6 [Id:95935] H2-K1 2.41 2.17 histocompatibility 2. K1. K region [Id:95904] H2-D1 2.40 2.18 histocompatibility 2. D region locus 1 [Id:95896]

Other immunological functions Chil3/ Chi3l3 201.73 236.11 chitinase-like 3 [Id:1330860] Lcn2 138.06 126.29 lipocalin 2 [Id:96757] Mmp3 44.19 53.78 matrix metallopeptidase 3 [Id:97010] Mmp12 36.94 34.09 matrix metallopeptidase 12 [Id:97005] T cell-interacting. activating receptor on myeloid cells 1 Tarm1 10.82 6.53 [Id:2442280] Timp1 9.19 10.09 tissue inhibitor of metalloproteinase 1 [Id:98752] Fcgr4 9.15 10.65 Fc receptor. IgG. low affinity IV [Id:2179523] Clec7a 7.87 8.82 C-type lectin domain family 7. member a [Id:1861431] Itgax/ CD11c 6.47 5.95 integrin alpha X [Id:96609] Zbp1 5.14 4.05 Z-DNA binding protein 1 [Id:1927449] leukocyte immunoglobulin-like receptor. subfamily B. member Lilrb4a 5.07 4.76 4A [Id:102701] Lgals3/ Galectin3 5.03 5.00 lectin. galactose binding. soluble 3 [Id:96778] Fcgr2b 4.37 3.46 Fc receptor. IgG. low affinity IIb [Id:95499] leukocyte immunoglobulin-like receptor. subfamily B. member Lilr4b 4.34 3.44 4B [Id:102702] Cd72 3.91 3.47 CD72 antigen [Id:88345] Cd300lf 3.70 3.21 CD300 molecule like family member F [Id:2442359] Pilra 3.67 3.50 paired immunoglobin-like type 2 receptor alpha [Id:2450529] Ptx3 3.30 2.86 pentraxin related gene [Id:104641] Cd22 3.17 3.40 CD22 antigen [Id:88322] Lag3 2.81 2.49 lymphocyte-activation gene 3 [Id:106588] Bst2 2.71 2.30 bone marrow stromal cell antigen 2 [Id:1916800] Fcgr3 2.65 2.32 Fc receptor. IgG. low affinity III [Id:95500] Epsti1 2.62 2.42 epithelial stromal interaction 1 (breast) [Id:1915168] Fcgr1 2.47 1.92 Fc receptor. IgG. high affinity I [Id:95498] Cd300c2 2.46 2.31 CD300C molecule 2 [Id:2153249] colony stimulating factor 3 receptor (granulocyte) Csf3r 2.34 1.96 [Id:1339755] Trem2 2.34 2.26 triggering receptor expressed on myeloid cells 2 [Id:1913150] 44

Cd48 2.32 2.36 CD48 antigen [Id:88339] Tyrobp/DA P12 2.27 2.61 TYRO protein tyrosine kinase binding protein [Id:1277211] Cd68 2.26 1.91 CD68 antigen [Id:88342] thymocyte selection associated family member 2 Themis2 2.15 2.01 [Id:2446213] Itgal 2.15 1.97 integrin alpha L [Id:96606] lectin. galactoside-binding. soluble. 3 binding protein Lgals3bp 2.12 1.77 [Id:99554] Mpeg1 2.10 1.99 macrophage expressed gene 1 [Id:1333743] Cd86 2.08 1.89 CD86 antigen [Id:101773] Itgb2 2.04 1.93 integrin beta 2 [Id:96611] Hcls1 1.79 2.02 hematopoietic cell specific Lyn substrate 1 [Id:104568] Igsf6 1.70 2.04 immunoglobulin superfamily. member 6 [Id:1891393] Klhl6 1.65 2.05 kelch-like 6 [Id:2686922]

Cytoskeleton proteins Myo1g 2.79 2.28 myosin IG [Id:1927091] Myo1f 2.68 2.17 myosin IF [Id:107711] Gfap 2.67 2.50 glial fibrillary acidic protein [Id:95697] Ang 2.59 2.15 angiogenin. ribonuclease. RNase A family. 5 [Id:88022] Capg 2.31 2.63 capping protein (actin filament). gelsolin-like [Id:1098259] Fblim1 2.20 1.64 filamin binding LIM protein 1 [Id:1921452] Fyb 2.15 1.90 FYN binding protein [Id:1346327] Vim 2.13 1.97 vimentin [Id:98932] Bin2 2.07 2.22 bridging integrator 2 [Id:3611448] Was 2.06 2.19 Wiskott-Aldrich syndrome [Id:105059] Dock2 2.04 1.69 dedicator of cyto-kinesis 2 [Id:2149010] Arpc1b 2.02 1.87 actin related protein 2/3 complex. subunit 1B [Id:1343142] Aif1/IBA1 1.93 2.11 allograft inflammatory factor 1 [Id:1343098]

Intracellular proteolysis ATPase. H+ transporting. lysosomal V0 subunit D2 Atp6v0d2 22.77 30.48 [Id:1924415] serine (or cysteine) peptidase inhibitor. clade A. member 3I Serpina3i 11.30 14.12 [Id:2182841] Cst7 6.50 7.11 cystatin F (leukocystatin) [Id:1298217] Acp5 6.17 6.12 acid phosphatase 5. tartrate resistant [Id:87883] serine (or cysteine) peptidase inhibitor. clade A. member 3N Serpina3n 3.51 2.69 [Id:105045] Hspb1 2.66 1.64 heat shock protein 1 [Id:96240] proteasome (prosome. macropain) subunit. beta type 8 (large Psmb8 2.63 2.23 multifunctional peptidase 7) [Id:1346527] Isg15 2.28 2.26 ISG15 ubiquitin-like modifier [Id:1855694] Trim47 2.12 1.99 tripartite motif-containing 47 [Id:1917374] Neurl3 2.04 2.09 neuralized E3 ubiquitin protein ligase 3 [Id:2429944] 45

Usp18 2.04 1.68 ubiquitin specific peptidase 18 [Id:1344364] Ctsh 2.02 2.07 cathepsin H [Id:107285]

Metabolism Arg1 15.92 13.70 arginase. liver [Id:88070] Steap4 12.91 12.37 STEAP family member 4 [Id:1923560] Tgm1 12.80 9.85 transglutaminase 1. K polypeptide [Id:98730] Lyz2 5.47 6.51 lysozyme 2 [Id:96897] Gimap3 4.33 5.21 GTPase. IMAP family member 3 [Id:1932723] Cd52 4.11 4.76 CD52 antigen [Id:1346088] Gimap4 3.91 3.01 GTPase. IMAP family member 4 [Id:1349656] Oasl1 3.52 2.31 2'-5' oligoadenylate synthetase-like 1 [Id:2180849] Oas1a 3.36 2.57 2'-5' oligoadenylate synthetase 1A [Id:2180860] Rps24-ps2 3.33 3.62 ribosomal protein S24. pseudogene 2 [Id:3649025] Gbp2 2.97 2.81 guanylate binding protein 2 [Id:102772] Gna15 2.79 2.63 guanine nucleotide binding protein. alpha 15 [Id:95770] Gbp8 2.74 3.23 guanylate-binding protein 8 [Id:1923324] Chil1/ Chi3l1 2.62 2.35 chitinase-like 1 [Id:1340899] Gbp10 2.54 3.04 guanylate-binding protein 10 [Id:4359647] Oasl2 2.54 2.23 2'-5' oligoadenylate synthetase-like 2 [Id:1344390] Cyba 2.49 2.37 cytochrome b-245. alpha polypeptide [Id:1316658] Gbp6 2.44 2.58 guanylate binding protein 6 [Id:2140937] Pld4 2.29 2.19 phospholipase D family. member 4 [Id:2144765] Rac2 2.24 2.10 Rac family small GTPase 2 [Id:97846] Aspg 2.16 2.25 asparaginase [Id:2144822] Siglecf/ Siglec5 2.12 2.08 Rho GTPase activating protein 45 [Id:1917969] Rhoh 2.09 2.18 ras homolog family member H [Id:1921984] Ltc4s 2.03 2.01 leukotriene C4 synthase [Id:107498] Mx1 3.88 1.97 MX dynamin-like GTPase 1 [Id:97243] Rasal3 2.67 2.34 RAS protein activator like 3 [Id:2444128] Arhgap9 2.65 1.86 Rho GTPase activating protein 9 [Id:2143764] Oas2 2.38 1.72 2'-5' oligoadenylate synthetase 2 [Id:2180852] Cybb/ Nox2 2.35 1.85 cytochrome b-245. beta polypeptide [Id:88574] Spint1 2.27 1.85 serine protease inhibitor. Kunitz type 1 [Id:1338033] Cp 2.18 2.03 ceruloplasmin [Id:88476] Ncf4 2.17 1.83 neutrophil cytosolic factor 4 [Id:109186] Ncf1 2.15 1.99 neutrophil cytosolic factor 1 [Id:97283] Ip6k3 2.15 1.98 inositol hexaphosphate kinase 3 [Id:3045325] Gbp3 2.12 1.93 guanylate binding protein 3 [Id:1926263] Cybrd1 2.07 1.86 cytochrome b reductase 1 [Id:2654575] Hck 2.04 1.87 hemopoietic cell kinase [Id:96052] 46

SAM domain. SH3 domain and nuclear localization signals. 1 Samsn1 2.04 1.70 [Id:1914992] poly (ADP-ribose) polymerase family. member 14 Parp14 2.01 1.70 [Id:1919489] Gadl1 1.95 2.10 glutamate decarboxylase-like 1 [Id:1920998] suppression of tumorigenicity 14 (colon carcinoma) St14 1.85 2.23 [Id:1338881] protein tyrosine phosphatase. non-receptor type 18 Ptpn18 1.82 2.13 [Id:108410] Ggta1 1.81 2.10 glycoprotein galactosyltransferase alpha 1. 3 [Id:95704]

Membrane transporters and receptors Hcar2/ Niacr1 12.91 10.49 hydroxycarboxylic acid receptor 2 [Id:1933383] Gpnmb 4.12 4.42 glycoprotein (transmembrane) nmb [Id:1934765] Cnr2 3.45 3.01 cannabinoid receptor 2 (macrophage) [Id:104650] Slc43a3 3.44 2.75 solute carrier family 43. member 3 [Id:1931054] Adora3 3.25 2.39 adenosine A3 receptor [Id:104847] pyrimidinergic receptor P2Y. G-protein coupled. 6 P2ry6 2.91 2.44 [Id:2673874] Tmem106a 2.40 2.39 transmembrane protein 106A [Id:1922056] Slc15a3 2.29 2.13 solute carrier family 15. member 3 [Id:1929691] S1pr3 2.24 2.16 sphingosine-1-phosphate receptor 3 [Id:1339365] Rtp4 2.20 2.17 receptor transporter protein 4 [Id:1915025] solute carrier family 11 (proton-coupled divalent metal ion Slc11a1 2.16 2.12 transporters). member 1 [Id:1345275] Hvcn1 2.07 1.69 hydrogen voltage-gated channel 1 [Id:1921346] potassium inwardly-rectifying channel. subfamily K. member Kcnk6 2.01 1.69 6 [Id:1891291]

Signaling pathways Wisp2 11.47 13.49 WNT1 inducible signaling pathway protein 2 [Id:1328326] Ly9 5.44 4.57 lymphocyte antigen 9 [Id:96885] Bcl2a1b 4.89 4.20 B cell leukemia/lymphoma 2 related protein A1b [Id:1278326] Siglec1 4.87 4.32 sialic acid-binding Ig-like lectin 1. sialoadhesin [Id:99668] Slamf8 4.60 3.28 SLAM family member 8 [Id:1921998] membrane-spanning 4-domains. subfamily A. member 7 Ms4a7 3.67 3.32 [Id:1918846] Gpr65 3.45 3.67 G-protein coupled receptor 65 [Id:108031] triggering receptor expressed on myeloid cells-like 2 Treml2 3.44 3.07 [Id:2147038] Clec4a2 3.12 2.45 C-type lectin domain family 4. member a2 [Id:1349412] Cd84 2.73 2.77 CD84 antigen [Id:1336885] membrane-spanning 4-domains. subfamily A. member 6D Ms4a6d 2.73 2.52 [Id:1916024] Gpr35 2.67 2.26 G protein-coupled receptor 35 [Id:1929509] Clec10a 2.48 2.51 C-type lectin domain family 10. member A [Id:96975] Sash3 2.32 2.15 SAM and SH3 domain containing 3 [Id:1921381] 47

Siglecf/Sigl ec5 2.27 2.02 sialic acid binding Ig-like lectin F [Id:2681107] Socs3 2.18 2.33 suppressor of cytokine signaling 3 [Id:1201791] Btk 2.07 2.30 Bruton agammaglobulinemia tyrosine kinase [Id:88216] Adgre1/Emr 1 2.29 1.95 adhesion G protein-coupled receptor E1 [Id:106912] Vav1 2.22 1.99 vav 1 oncogene [Id:98923] Cmklr1 2.19 1.65 chemokine-like receptor 1 [Id:109603] Slamf9 1.79 2.47 SLAM family member 9 [Id:1923692]

Nuclear function Cebpd 3.15 2.50 CCAAT/enhancer binding protein (C/EBP). delta [Id:103573] Top2a 2.87 2.32 topoisomerase (DNA) II alpha [Id:98790] Lyl1 2.22 2.12 lymphoblastomic leukemia 1 [Id:96891] E74-like factor 4 (ets domain transcription factor) Elf4 2.12 1.79 [Id:1928377] basic leucine zipper transcription factor. ATF-like 3 Batf3 2.09 1.94 [Id:1925491] Prrx2 1.98 2.28 paired related homeobox 2 [Id:98218]

Other functions Retnla 50.80 44.59 resistin like alpha [Id:1888504] Slfn2 2.93 2.65 schlafen 2 [Id:1313258] S100a6 2.39 2.26 S100 calcium binding protein A6 (calcyclin) [Id:1339467] Fermt3 2.09 2.09 fermitin family member 3 [Id:2147790] Tusc5 2.14 2.79 tumor suppressor candidate 5 [Id:3029307] Fam83d 1.93 2.25 family with sequence similarity 83. member D [Id:1919128]

A) Epm2a-/- Gene FDR FC Description [MGI Id] Spon1 0.0086 1.26 spondin 1 [Id:2385287] Gfap 0.0434 1.23 glial fibrillary acidic protein [Id:95697] R3hdm1 0.0086 0.79 R3H domain containing 1 [Id:2448514] Vip 0.0434 0.75 vasoactive intestinal polypeptide [Id:98933] cysteine and histidine-rich domain (CHORD)- Chordc1 0.0086 0.74 containing, zinc-binding protein 1 [Id:1914167] Per2 0.0018 0.70 period circadian clock 2 [Id:1195265] tumor necrosis factor receptor superfamily, Tnfrsf25 0.0315 0.51 member 25 [Id:1934667] Tmem181 transmembrane protein 181B, pseudogene b-ps 7.35E-12 0.41 [Id:3779544] epilepsy, progressive myoclonic epilepsy, type 2 Epm2a 2.47E-22 0.06 gene alpha [Id:1341085]

B) Epm2b-/-

Gene FDR FC Description [MGI Id] Gm8730 0.0216 1.90 predicted pseudogene 8730 [Id:3644565] Hes5 0.0150 1.68 Hes family bHLH transcription factor 5 [Id:104876] Jrk 0.0033 1.54 jerky [Id:106214] Sall3 0.0198 1.51 spalt like transcription factor 3 [Id:109295] Gal3st1 0.0197 1.44 galactose-3-O-sulfotransferase 1 [Id:1858277] Klk6 0.0356 1.42 kallikrein related-peptidase 6 [Id:1343166] Itgb4 0.0095 1.35 integrin beta 4 [Id:96613] Gpr137b 0.0172 1.35 G protein-coupled receptor 137B [Id:1891463] Rlbp1 0.0314 1.32 retinaldehyde binding protein 1 [Id:97930] aldehyde dehydrogenase family 1. subfamily A1 Aldh1a1 0.0004 1.31 [Id:1353450] Gsn 0.0021 1.31 gelsolin [Id:95851] Gfap 0.0012 1.31 glial fibrillary acidic protein [Id:95697] Prr5l 0.0414 1.30 proline rich 5 like [Id:1919696] calcium channel, voltage-dependent, gamma Cacng5 0.0128 1.29 subunit 5 [Id:2157946] Trf 0.0324 1.29 transferrin [Id:98821] Cldn11 0.0049 1.29 claudin 11 [Id:106925] pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 Plekha2 0.0414 1.28 [Id:1928144] Adssl1 0.0383 1.27 adenylosuccinate synthetase like 1 [Id:87947] Mbp 0.0032 1.27 myelin basic protein [Id:96925] 49

adenosine deaminase, RNA-specific, B2 Adarb2 0.0324 1.27 [Id:2151118] Mog 0.0032 1.26 myelin oligodendrocyte glycoprotein [Id:97435] Scfd2 0.0395 1.25 Sec1 family domain containing 2 [Id:2443446] Mag 0.0083 1.25 myelin-associated glycoprotein [Id:96912] Plp1 0.0030 1.25 proteolipid protein (myelin) 1 [Id:97623] guanine nucleotide binding protein, alpha 12 Gna12 0.0342 1.25 [Id:95767] Abhd4 0.0150 1.24 abhydrolase domain containing 4 [Id:1915938] AU RNA binding protein/enoyl-coenzyme A Auh 0.0123 1.26 hydratase [Id:1338011] glucose-fructose oxidoreductase domain containing Gfod1 0.0322 1.23 1 [Id:2145304] pleckstrin homology domain containing, family H Plekhh1 0.0233 1.23 (with MyTH4 domain) member 1 [Id:2144989] spondin 1. (f-spondin) extracellular matrix protein Spon1 0.0068 1.23 [Id:2385287] potassium channel tetramerisation domain Kctd5 0.0402 1.23 containing 5 [Id:1916509] Pcbp3 0.0086 1.23 poly(rC) binding protein 3 [Id:1890470] Wdr89 0.0383 1.22 WD repeat domain 89 [Id:1919588] Vim 0.0322 1.22 vimentin [Id:98932] myelin and lymphocyte protein, T cell differentiation Mal 0.0214 1.22 protein [Id:892970] Slc38a3 0.0233 1.22 solute carrier family 38, member 3 [Id:1923507] pleckstrin homology domain containing, family B Plekhb1 0.0061 1.22 (evectins) member 1 [Id:1351469] breast carcinoma amplified sequence 1 Bcas1 0.0418 1.21 [Id:1924210] signal peptide, CUB domain, EGF-like 1 Scube1 0.0395 1.21 [Id:1890616] Axl 0.0414 1.21 AXL receptor tyrosine kinase [Id:1347244] Snrnp70 0.0150 0.79 small nuclear ribonucleoprotein 70 (U1) [Id:98341] Safb2 0.0217 0.79 scaffold attachment factor B2 [Id:2146808] ral guanine nucleotide dissociation stimulator-like Rgl2 0.0435 0.79 2 [Id:107483] zinc finger with KRAB and SCAN domains 3 Zkscan3 0.0150 0.79 [Id:1919989] Ryr3 0.0172 0.79 ryanodine receptor 3 [Id:99684] DOT1-like, histone H3 methyltransferase (S. Dot1l 0.0435 0.79 cerevisiae) [Id:2143886] Zc3h7a 0.0387 0.79 zinc finger CCCH type containing 7 A [Id:2445044] Tra2a 0.0198 0.79 transformer 2 alpha [Id:1933972] tetratricopeptide repeat and ankyrin repeat Trank1 0.0135 0.79 containing 1 [Id:1341834] Ccnt2 0.0072 0.79 cyclin T2 [Id:1920199] membrane-associated ring finger (C3HC4) 7 March7 0.0180 0.79 [Id:1931053] Per2 0.0180 0.79 period circadian clock 2 [Id:1195265] Chuk 0.0216 0.79 conserved helix-loop-helix ubiquitous kinase 50

[Id:99484] Gm14480 0.0387 0.78 predicted gene 14480 [Id:3650191] mitochondrially encoded NADH dehydrogenase 2 mt-Nd2 0.0387 0.78 [Id:102500] lysine (K)-specific methyltransferase 2D Kmt2d 0.0216 0.78 [Id:2682319] Pabpn1 0.0270 0.78 poly(A) binding protein, nuclear 1 [Id:1859158] RNA imprinted and accumulated in the nucleus Rian 0.0068 0.78 [Id:1922995] Zfp207 0.0087 0.78 zinc finger protein 207 [Id:1340045] Ints6l 0.0198 0.77 integrator complex subunit 6 like [Id:2442593] Zfp933 0.0410 0.77 zinc finger protein 933 [Id:1922865] ribosomal RNA adenine dimethylase domain Rrnad1 0.0180 0.77 containing 1 [Id:2387197] Junb 0.0442 0.77 jun B proto-oncogene [Id:96647] A kinase (PRKA) anchor protein 8-like Akap8l 0.0068 0.77 [Id:1860606] Ryr1 0.0216 0.77 ryanodine receptor 1. skeletal muscle [Id:99659] Sclt1 0.0452 0.76 sodium channel and clathrin linker 1 [Id:1914411] Zfp948 0.0179 0.76 zinc finger protein 948 [Id:3040683] ethanolamine phosphate phospholyase Etnppl 0.0068 0.76 [Id:1919010] Krit1 0.0097 0.75 KRIT1. ankyrin repeat containing [Id:1930618] Cep70 0.0314 0.75 centrosomal protein 70 [Id:1915371] P3h3 0.0269 0.75 prolyl 3-hydroxylase 3 [Id:1315208] Cep95 0.0179 0.74 centrosomal protein 95 [Id:2443502] Zmym1 0.0314 0.73 zinc finger, MYM domain containing 1 [Id:1915560] Tbce 0.0068 0.73 tubulin-specific chaperone E [Id:1917680] 4930570 G19Rik 0.0481 0.73 RIKEN cDNA 4930570G19 gene [Id:1923158] natural killer tumor recognition sequence Nktr 0.0078 0.72 [Id:97346] Id4 0.0439 0.72 inhibitor of DNA binding 4 [Id:99414] Hdx 0.0342 0.72 highly divergent homeobox [Id:2685226] Kmt5c 0.0217 0.72 lysine methyltransferase 5C [Id:2385262] Stxbp2 0.0126 0.72 syntaxin binding protein 2 [Id:107370] ras responsive element binding protein 1 Rreb1 0.0216 0.72 [Id:2443664] Zfp950 0.0353 0.71 zinc finger protein 950 [Id:2652824] Mirg 0.0150 0.71 miRNA containing gene [Id:3781106] Gm11611 0.0214 0.70 predicted gene 11611 [Id:3707011] Rgs11 0.0126 0.70 regulator of G-protein signaling 11 [Id:1354739] aryl hydrocarbon receptor nuclear translocator-like Arntl2 0.0414 0.70 2 [Id:2684845] transient receptor potential cation channel, Trpc6 0.0214 0.70 subfamily C, member 6 [Id:109523] Inha 0.0314 0.69 inhibin alpha [Id:96569] Cspp1 0.0059 0.69 centrosome and spindle pole associated protein 1 51

[Id:2681832] Mov10 0.0268 0.68 Moloney leukemia virus 10 [Id:97054] Traip 0.0214 0.67 TRAF-interacting protein [Id:1096377] Shkbp1 0.0405 0.67 Sh3kbp1 binding protein 1 [Id:2385803] C78859 0.0135 0.66 expressed sequence C78859 [Id:2142856] myocardial infarction associated transcript 1 Mirt1 0.0442 0.66 [Id:1922001] Lin28b 0.0214 0.66 lin-28 homolog B (C. elegans) [Id:3584032] Gm28439 0.0059 0.66 predicted gene 28439 [Id:5579145] Rtl1 0.0395 0.65 retrotransposon Gaglike 1 [Id:2656842] Gm37090 0.0223 0.65 predicted gene, 37090 [Id:5610318] L3MBTL1 histone methyl-lysine binding protein L3mbtl1 0.0418 0.65 [Id:2676663] Gm38372 0.0314 0.63 predicted gene, 38372 [Id:5611600] 6430511E 19Rik 0.0269 0.63 RIKEN cDNA 6430511E19 gene [Id:2443259] C230004 F18Rik 0.0072 0.63 RIKEN cDNA C230004F18 gene [Id:3041217] Col5a1 0.0084 0.62 collagen, type V, alpha 1 [Id:88457] 4930447C 04Rik 0.0126 0.62 RIKEN cDNA 4930447C04 gene [Id:1923051] Gm43980 0.0280 0.62 predicted gene, 43980 [Id:5690372] Gm44168 0.0412 0.62 predicted gene, 44168 [Id:5690560] BC03049 9 0.0095 0.61 cDNA sequence BC030499 [Id:2652869] glutamate receptor, ionotropic, NMDA1 (zeta 1), Grin1os 0.0216 0.61 opposite strand [Id:2443867] Gm43843 0.0144 0.61 predicted gene 43843 [Id:5663980] Slc2a4rg- ps 0.0059 0.61 Slc2a4 regulator, pseudogene [Id:3651388] myocardial infarction associated transcript (non- Miat 0.0455 0.60 protein coding) [Id:2444886] solute carrier family 39 (zinc transporter), member Slc39a2 0.0095 0.60 2 [Id:2684326] Kcnq1ot1 0.0180 0.59 KCNQ1 overlapping transcript 1 [Id:1926855] Sycp2 0.0474 0.59 synaptonemal complex protein 2 [Id:1933281] Ly86 0.0068 0.59 lymphocyte antigen 86 [Id:1321404] Gm37963 0.0387 0.58 predicted gene, 37963 [Id:5611191] Gm20219 0.0464 0.58 predicted gene, 20219 [Id:5012404] C130023 A14Rik 0.0485 0.58 RIKEN cDNA C130023A14 gene [Id:2442654] Gm45591 0.0314 0.57 predicted gene 45591 [Id:5791427] Gm43858 0.0489 0.57 predicted gene 43858 [Id:5663995] Gm38190 0.0144 0.56 predicted gene, 38190 [Id:5611418] cerebellar degeneration related antigen 1 Cdr1 0.0147 0.56 [Id:88359] Ece2 0.0109 0.56 endothelin converting enzyme 2 [Id:1101356] Gm37181 0.0414 0.55 predicted gene, 37181 [Id:5610409] 52

Gm49204 0.0302 0.55 predicted gene, 49204 [Id:6118653] a disintegrin and metallopeptidase domain 8 Adam8 0.0123 0.52 [Id:107825] tumor necrosis factor receptor superfamily, Tnfrsf25 0.0068 0.51 member 25 [Id:1934667] A230006 K03Rik 0.0133 0.50 RIKEN cDNA A230006K03 gene [Id:3644205] Gm14827 0.0097 0.50 predicted gene 14827 [Id:3705192] Gm42549 0.0324 0.49 predicted gene 42549 [Id:5662686] Gm38336 0.0418 0.47 predicted gene, 38336 [Id:5611564] Gm37773 0.0150 0.46 predicted gene, 37773 [Id:5611001] Gm5083 0.0059 0.44 predicted gene 5083 [Id:3779454] Stac3 0.0020 0.44 SH3 and cysteine rich domain 3 [Id:3606571] Gm43039 0.0342 0.43 predicted gene 43039 [Id:5663176] Lpin3 0.0216 0.43 lipin 3 [Id:1891342] A230103L 15Rik 0.0068 0.42 RIKEN cDNA A230103L15 gene [Id:1925005] Gm37776 0.0302 0.42 predicted gene, 37776 [Id:5611004] Gm44562 0.0059 0.40 predicted gene 44562 [Id:5753138] Gm44559 0.0059 0.38 predicted gene 44559 [Id:5753135] Gm34354 0.0150 0.37 predicted gene, 34354 [Id:5593513] Nucleoside diphosphate-linked moiety X motif 8 Nudt8 0.0484 0.35 [Source:UniProtKB/Swiss-Prot;Acc:Q9CR24] 4933408B 17Rik 0.0402 0.34 RIKEN cDNA 4933408B17 gene [Id:3045347] Gm44560 0.0095 0.30 predicted gene 44560 [Id:5753136] Gm42656 0.0024 0.30 predicted gene 42656 [Id:5662793] Col6a4 0.0034 0.28 collagen, type VI, alpha 4 [Id:1915803] A330076 C08Rik 5.88E-07 0.14 RIKEN cDNA A330076C08 gene [Id:2443693] Nhlrc1 2.53E-19 0.01 NHL repeat containing 1 [Id:2145264]