DOCSLIB.ORG

SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD Mice Used in This Study Accumulate Polyglucosan Inclusions (Lafora Bodies) in the Brain

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD Mice Used in This Study Accumulate Polyglucosan Inclusions (Lafora Bodies) in the Brain 1 SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD mice used in this study accumulate polyglucosan inclusions (Lafora bodies) in the brain. Samples from the hippocampus of five months old control, Epm2a-/- (lacking laforin) and Epm2b-/- mice (lacking malin) were stained with periodic acid Schiff reagent (PAS staining), which colors polysaccharide granules in red. Bar: 50 m. Supplementary Fig. S2. Principal component analysis (PCA) representing the first two components with the biggest level of phenotypic variability. Samples 1_S1 to 4_S4 corresponded to control, 5_S5, 6_S6 and 8_S8 to Epm2a-/- and 9_S9 to 12_S12 to Epm2b- /- samples, of animals of 16 months of age respectively. Supplementary Table S1. Primers used in this work to validate the expression of the corresponding genes by RT-qPCR. Supplementary Table S2: Genes downregulated more than 0.5 fold in Epm2a-/- and Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S3: Genes upregulated more than 1.5 fold in Epm2a-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S4: Genes upregulated more than 1.5 fold in Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. 2 Supplementary Table S5: Genes upregulated in both Epm2a-/- and Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S6: Genes upregulated more than 2.0 fold only in Epm2a-/- or only in Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S7: Common genes upregulated in both Epm2a-/- and Epm2b-/- mice of 16 months of age classified by putative physiological function. The gene name, fold change (FC), description and MGI Id (mouse genome informatics) are indicated. In each group genes are arranged by FC. Supplementary Table S8: Genes upregulated more than 1.2 fold (in grey) or downregulated less than 0.8 fold in Epm2a-/- or in Epm2b-/- mice of 3 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. 3 4 5 Supplementary Table S1. Primers used in this work to validate the expression of the corresponding genes by RT-qPCR. Gene Forward primer 5’-3’ Reserve primer 5’-3’ Lcn2 CAGAAGGCAGCTTTACGATG CCTGGAGCTTGGAACAAATG Mmp3 TTGTCCCGTTTCCATCTCTC AGAGCTGCACATTGGTGATG Cxcl10 CCGTCATTTTCTGCCTCATC CTCGCAGGGATGATTTCAAG C3 TCCTGAACTGGTCAACATGG AAACTGGGCAGCACGTATTC Ccl2 AGGTGTCCCAAAGAAGCTGTAG TCTGGACCCATTCCTTCTTG Ccl5 AGCAAGTGCTCCAATCTTGC CTTGAACCCACTTCTTCTCTGG Ccl12 ACCATCAGTCCTCAGGTATTGG TTCCGGACGTGAATCTTCTG H2-M2 TAAAGGATCCCACTCCTTGC TCAAACCTCGGATTCTCAGC Wisp2 ATACAGGTGCCAGGAAGGTG ACAAGGGCAGAAAGTTGGTG Actb ACTGAGCTGCGTTTTACACC AGCCATGCCAATGTTGTCTC 6 Supplementary Table S2: Genes downregulated more than 0.5 fold in Epm2a-/- and Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. A) Epm2a-/- Gene FDR FC Description [MGI Id] Gm48677 0.0259 0.49 predicted gene. 48677 [Id:6098297] AU022754 0.0207 0.49 expressed sequence AU022754 [Id:2146143] Gm16386 0.0164 0.49 predicted gene 16386 [Id:3646848] D930015M05Rik 0.0281 0.49 RIKEN cDNA D930015M05 gene [Id:3612068] Krt20 0.0006 0.48 keratin 20 [Id:1914059] Zfp951 9.55E-05 0.48 zinc finger protein 951 [Id:2441896] aryl-hydrocarbon receptor repressor Ahrr 0.0272 0.47 [Id:1333776] Arhgap28 0.0151 0.47 Rho GTPase activating protein 28 [Id:2147003] Gm45533 0.0335 0.47 predicted gene 45533 [Id:5791369] A830036E02Rik 6.47E-12 0.47 RIKEN cDNA A830036E02 gene [Id:3686876] Gm28307 0.0222 0.47 predicted gene 28307 [Id:5579013] 5930430L01Rik 0.0007 0.46 RIKEN cDNA 5930430L01 gene [Id:2443110] Gm5066 0.0053 0.46 predicted gene 5066 [Id:3645897] cytochrome P450. family 2. subfamily e. Cyp2e1 0.0165 0.46 polypeptide 1 [Id:88607] Car3 0.0118 0.46 carbonic anhydrase 3 [Id:88270] Gm9752 0.0130 0.45 predicted gene 9752 [Id:3641896] Zfp474 0.0175 0.45 zinc finger protein 474 [Id:1914008] 2010001K21Rik 0.0399 0.44 RIKEN cDNA 2010001K21 gene [Id:1917079] Gm38101 0.0012 0.44 predicted gene. 38101 [Id:5611329] B230303O12Rik 0.0020 0.43 RIKEN cDNA B230303O12 gene [Id:2442644] Sostdc1 0.0024 0.43 sclerostin domain containing 1 [Id:1913292] family with sequence similarity 166. member B Fam166b 0.0210 0.42 [Id:2445194] Gm45104 0.0392 0.42 predicted gene 45104 [Id:5753680] Gm28455 0.0070 0.38 predicted gene 28455 [Id:5579161] 3110070M22Rik 0.0024 0.28 RIKEN cDNA 3110070M22 gene [Id:1914554] Gm15834 0.0001 0.26 predicted gene 15834 [Id:3802168] Gm28438 8.27E-10 0.24 predicted gene 28438 [Id:5579144] epilepsy. progressive myoclonic epilepsy. type 2 Epm2a 1.75E-08 0.04 gene alpha [Id:1341085] 7 B) Epm2b-/- Gene FDR FC Description [MGI Id] Gm11249 0.0234 0.49 predicted gene 11249 [Id:3650834] Gm44249 0.0276 0.49 predicted gene. 44249 [Id:5690641] maestro heat-like repeat family member 5 Mroh5 0.0049 0.48 [Id:2685474] Gm26981 0.0095 0.48 predicted gene. 26981 [Id:5504096] ribosomal protein L17. pseudogene 10 Rpl17-ps10 0.0005 0.48 [Id:3642871] Rnf138rt1 0.0274 0.48 ring finger protein 138. retrogene 1 [Id:1921514] Gm16618 0.0154 0.48 predicted gene. 16618 [Id:4439542] Gm15834 0.0040 0.48 predicted gene 15834 [Id:3802168] Aldoa-ps4 0.0073 0.46 aldolase A. pseudogene 4 [Id:3643617] Gm9570 0.0022 0.46 predicted gene 9570 [Id:3779980] solute carrier family 6 (neurotransmitter Slc6a5 3.48E-05 0.44 transporter. glycine). member 5 [Id:105090] S100 calcium binding protein A9 (calgranulin B) S100a9 0.0294 0.42 [Id:1338947] G530011O06Rik 0.0154 0.39 RIKEN cDNA G530011O06 gene [Id:3603513] Gm5083 3.28E-05 0.39 predicted gene 5083 [Id:3779454] Gm5822 0.0052 0.38 predicted gene 5822 [Id:3648836] Hoxb5 0.0275 0.28 homeobox B5 [Id:96186] Hoxa5 0.0343 0.21 homeobox A5 [Id:96177] A330076C08Rik 7.84E-09 0.16 RIKEN cDNA A330076C08 gene [Id:2443693] Nhlrc1 4.49E-21 0.00 NHL repeat containing 1 [Id:2145264] 8 Supplementary Table S3: Genes upregulated more than 1.5 fold in Epm2a-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Gene FDR FC Description [MGI Id] Chil3 0.0080 201.73 chitinase-like 3 [Id:1330860] Lcn2 1.57E-08 138.06 lipocalin 2 [Id:96757] Retnla 0.0498 50.80 resistin like alpha [Id:1888504] Mmp3 4.46E-07 44.19 matrix metallopeptidase 3 [Id:97010] H2-M2 6.16E-06 42.23 histocompatibility 2. M region locus 2 [Id:95914] Mmp12 0.0062 36.94 matrix metallopeptidase 12 [Id:97005] Ccl8 0.0023 26.36 chemokine (C-C motif) ligand 8 [Id:101878] ATPase. H+ transporting. lysosomal V0 subunit D2 Atp6v0d2 0.0068 22.77 [Id:1924415] Cxcl10 1.65E-12 21.84 chemokine (C-X-C motif) ligand 10 [Id:1352450] Arg1 0.0489 15.92 arginase. liver [Id:88070] C3 1.74E-05 15.51 complement component 3 [Id:88227] Ccl2 9.12E-08 13.40 chemokine (C-C motif) ligand 2 [Id:98259] Ccl5 7.37E-12 13.10 chemokine (C-C motif) ligand 5 [Id:98262] Steap4 5.84E-16 12.91 STEAP family member 4 [Id:1923560] Hcar2 9.3E-07 12.91 hydroxycarboxylic acid receptor 2 [Id:1933383] Tgm1 1.32E-10 12.80 transglutaminase 1. K polypeptide [Id:98730] Cxcl5 0.0001 12.73 chemokine (C-X-C motif) ligand 5 [Id:1096868] Gm47283 3.49E-06 12.14 predicted gene. 47283 [Id:6096131] Wisp2 4.03E-06 11.47 WNT1 inducible signaling pathway protein 2 [Id:1328326] serine (or cysteine) peptidase inhibitor. clade A. member Serpina3i 0.0005 11.30 3I [Id:2182841] T cell-interacting. activating receptor on myeloid cells 1 Tarm1 0.0084 10.82 [Id:2442280] Il1rl1 0.0047 9.42 interleukin 1 receptor-like 1 [Id:98427] Timp1 6.48E-12 9.19 tissue inhibitor of metalloproteinase 1 [Id:98752] Fcgr4 2.38E-06 9.15 Fc receptor. IgG. low affinity IV [Id:2179523] CD74 antigen (invariant polypeptide of major histocompatibility complex. class II antigen-associated) Cd74 0.0138 7.96 [Id:96534] Clec7a 0.0020 7.87 C-type lectin domain family 7. member a [Id:1861431] Ccl12 3.82E-09 6.99 chemokine (C-C motif) ligand 12 [Id:108224] Cst7 0.0064 6.50 cystatin F (leukocystatin) [Id:1298217] Itgax 0.0046 6.47 integrin alpha X [Id:96609] Ccl11 0.0274 6.47 chemokine (C-C motif) ligand 11 [Id:103576] AI838599 1.55E-05 6.40 expressed sequence AI838599 [Id:3510989] Acp5 0.0002 6.17 acid phosphatase 5. tartrate resistant [Id:87883] H2-Ab1 0.0136 6.03 histocompatibility 2. class II antigen A. beta 1 [Id:103070] H2-Aa 0.0136 5.81 histocompatibility 2. class II antigen A. alpha [Id:95895] 9 AA465934 1.64E-13 5.65 expressed sequence AA465934 [Id:2671018] Lyz2 0.0004 5.47 lysozyme 2 [Id:96897] Ly9 1.35E-06 5.44 lymphocyte antigen 9 [Id:96885] Zbp1 1.03E-05 5.14 Z-DNA binding protein 1 [Id:1927449] leukocyte immunoglobulin-like receptor.
Load more

Recommended publications
  • Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma
    ARTICLE https://doi.org/10.1038/s41467-020-18839-1 OPEN Aberrant methylation underlies insulin gene expression in human insulinoma Esra Karakose1,6, Huan Wang 2,6, William Inabnet1, Rajesh V. Thakker 3, Steven Libutti4, Gustavo Fernandez-Ranvier 1, Hyunsuk Suh1, Mark Stevenson 3, Yayoi Kinoshita1, Michael Donovan1, Yevgeniy Antipin1,2, Yan Li5, Xiaoxiao Liu 5, Fulai Jin 5, Peng Wang 1, Andrew Uzilov 1,2, ✉ Carmen Argmann 1, Eric E. Schadt 1,2, Andrew F. Stewart 1,7 , Donald K. Scott 1,7 & Luca Lambertini 1,6 1234567890():,; Human insulinomas are rare, benign, slowly proliferating, insulin-producing beta cell tumors that provide a molecular “recipe” or “roadmap” for pathways that control human beta cell regeneration. An earlier study revealed abnormal methylation in the imprinted p15.5-p15.4 region of chromosome 11, known to be abnormally methylated in another disorder of expanded beta cell mass and function: the focal variant of congenital hyperinsulinism. Here, we compare deep DNA methylome sequencing on 19 human insulinomas, and five sets of normal beta cells. We find a remarkably consistent, abnormal methylation pattern in insu- linomas. The findings suggest that abnormal insulin (INS) promoter methylation and altered transcription factor expression create alternative drivers of INS expression, replacing cano- nical PDX1-driven beta cell specification with a pathological, looping, distal enhancer-based form of transcriptional regulation. Finally, NFaT transcription factors, rather than the cano- nical PDX1 enhancer complex, are predicted to drive INS transactivation. 1 From the Diabetes Obesity and Metabolism Institute, The Department of Surgery, The Department of Pathology, The Department of Genetics and Genomics Sciences and The Institute for Genomics and Multiscale Biology, The Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.
    [Show full text]
  • Novel Candidate Key Drivers in the Integrative Network of Genes, Micrornas, Methylations, and Copy Number Variations in Squamous Cell Lung Carcinoma
    Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 358125, 11 pages http://dx.doi.org/10.1155/2015/358125 Research Article Novel Candidate Key Drivers in the Integrative Network of Genes, MicroRNAs, Methylations, and Copy Number Variations in Squamous Cell Lung Carcinoma Tao Huang,1,2 Jing Yang,2 and Yu-dong Cai1 1 CollegeofLifeScience,ShanghaiUniversity,Shanghai200444,China 2Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200031, China Correspondence should be addressed to Tao Huang; [email protected] and Yu-dong Cai; cai [email protected] Received 17 September 2014; Revised 6 January 2015; Accepted 22 January 2015 Academic Editor: Aparup Das Copyright © 2015 Tao Huang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The mechanisms of lung cancer are highly complex. Not only mRNA gene expression but also microRNAs, DNA methylation, and copy number variation (CNV) play roles in tumorigenesis. It is difficult to incorporate so much information into a single model that can comprehensively reflect all these lung cancer mechanisms. In this study, we analyzed the 129 TCGA (The Cancer Genome Atlas) squamous cell lung carcinoma samples with gene expression, microRNA expression, DNA methylation, and CNV data. First, we used variance inflation factor (VIF) regression to build the whole genome integrative network. Then, we isolated the lung cancer subnetwork by identifying the known lung cancer genes and their direct regulators.
    [Show full text]
  • Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T
    www.nature.com/scientificreports OPEN Mechanical forces induce an asthma gene signature in healthy airway epithelial cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T. Kho4, Kelan Tantisira1, Marc Santolini 1,5, Feixiong Cheng6,7,8, Jennifer A. Mitchel3, Maureen McGill3, Michael J. O’Sullivan3, Margherita De Marzio1,3, Amitabh Sharma1, Scott H. Randell9, Jefrey M. Drazen3, Jefrey J. Fredberg3 & Scott T. Weiss1,3* Bronchospasm compresses the bronchial epithelium, and this compressive stress has been implicated in asthma pathogenesis. However, the molecular mechanisms by which this compressive stress alters pathways relevant to disease are not well understood. Using air-liquid interface cultures of primary human bronchial epithelial cells derived from non-asthmatic donors and asthmatic donors, we applied a compressive stress and then used a network approach to map resulting changes in the molecular interactome. In cells from non-asthmatic donors, compression by itself was sufcient to induce infammatory, late repair, and fbrotic pathways. Remarkably, this molecular profle of non-asthmatic cells after compression recapitulated the profle of asthmatic cells before compression. Together, these results show that even in the absence of any infammatory stimulus, mechanical compression alone is sufcient to induce an asthma-like molecular signature. Bronchial epithelial cells (BECs) form a physical barrier that protects pulmonary airways from inhaled irritants and invading pathogens1,2. Moreover, environmental stimuli such as allergens, pollutants and viruses can induce constriction of the airways3 and thereby expose the bronchial epithelium to compressive mechanical stress. In BECs, this compressive stress induces structural, biophysical, as well as molecular changes4,5, that interact with nearby mesenchyme6 to cause epithelial layer unjamming1, shedding of soluble factors, production of matrix proteins, and activation matrix modifying enzymes, which then act to coordinate infammatory and remodeling processes4,7–10.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Autophagy Modulation in Bladder Cancer Development and Treatment (Review)
    ONCOLOGY REPORTS 42: 1647-1655, 2019 Autophagy modulation in bladder cancer development and treatment (Review) FAPING LI, HUI GUO, YUXUAN YANG, MINGLIANG FENG, BIN LIU, XIANG REN and HONGLAN ZHOU Department of Urology, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China Received April 24, 2019; Accepted August 1, 2019 DOI: 10.3892/or.2019.7286 Abstract. Bladder cancer (BC) is a potentially life-threatening 1. Introduction malignancy. Due to a high recurrence rate, frequent surveil- lance strategies and intravesical drug therapies, BC is Bladder cancer (BC) is a potentially life-threatening malig- considered one of the most expensive tumors to treat. As a nancy that is considered one of the most expensive tumors fundamental evolutionary catabolic process, autophagy plays in terms of treatment and medical care (1-3). After prostate an important role in the maintenance of cellular environ- cancer, it is the second most common type of urological cancer mental homeostasis by degrading and recycling damaged and ranks 10th among the most common types of cancer cytoplasmic components, including macromolecules and around the globe (4). It has been estimated that there were organelles. Scientific studies in the last two decades have 549,393 new cases of BC and 199,922 deaths resulting from shown that autophagy acts as a double‑edged sword with this disease worldwide in 2018, according to a report from regard to the treatment of cancer. On one hand, autophagy the International Agency for Research on Cancer (4). The inhibition is able to increase the sensitivity of cancer cells to primary histological subtype of human BC is transitional cell treatment, a process known as protective autophagy.
    [Show full text]
  • The Proximal Signaling Network of the BCR-ABL1 Oncogene Shows a Modular Organization
    Oncogene (2010) 29, 5895–5910 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc ORIGINAL ARTICLE The proximal signaling network of the BCR-ABL1 oncogene shows a modular organization B Titz, T Low, E Komisopoulou, SS Chen, L Rubbi and TG Graeber Crump Institute for Molecular Imaging, Institute for Molecular Medicine, Jonsson Comprehensive Cancer Center, California NanoSystems Institute, Department of Molecular and Medical Pharmacology, University of California, Los Angeles, CA, USA BCR-ABL1 is a fusion tyrosine kinase, which causes signaling effects of BCR-ABL1 toward leukemic multiple types of leukemia. We used an integrated transformation. proteomic approach that includes label-free quantitative Oncogene (2010) 29, 5895–5910; doi:10.1038/onc.2010.331; protein complex and phosphorylation profiling by mass published online 9 August 2010 spectrometry to systematically characterize the proximal signaling network of this oncogenic kinase. The proximal Keywords: adaptor protein; BCR-ABL1; phospho- BCR-ABL1 signaling network shows a modular and complex; quantitative mass spectrometry; signaling layered organization with an inner core of three leukemia network; systems biology transformation-relevant adaptor protein complexes (Grb2/Gab2/Shc1 complex, CrkI complex and Dok1/ Dok2 complex). We introduced an ‘interaction direction- ality’ analysis, which annotates static protein networks Introduction with information on the directionality of phosphorylation- dependent interactions. In this analysis, the observed BCR-ABL1 is a constitutively active oncogenic fusion network structure was consistent with a step-wise kinase that arises through a chromosomal translocation phosphorylation-dependent assembly of the Grb2/Gab2/ and causes multiple types of leukemia. It is found in Shc1 and the Dok1/Dok2 complexes on the BCR-ABL1 many cases (B25%) of adult acute lymphoblastic core.
    [Show full text]
  • SPATA33 Localizes Calcineurin to the Mitochondria and Regulates Sperm Motility in Mice
    SPATA33 localizes calcineurin to the mitochondria and regulates sperm motility in mice Haruhiko Miyataa, Seiya Ouraa,b, Akane Morohoshia,c, Keisuke Shimadaa, Daisuke Mashikoa,1, Yuki Oyamaa,b, Yuki Kanedaa,b, Takafumi Matsumuraa,2, Ferheen Abbasia,3, and Masahito Ikawaa,b,c,d,4 aResearch Institute for Microbial Diseases, Osaka University, Osaka 5650871, Japan; bGraduate School of Pharmaceutical Sciences, Osaka University, Osaka 5650871, Japan; cGraduate School of Medicine, Osaka University, Osaka 5650871, Japan; and dThe Institute of Medical Science, The University of Tokyo, Tokyo 1088639, Japan Edited by Mariana F. Wolfner, Cornell University, Ithaca, NY, and approved July 27, 2021 (received for review April 8, 2021) Calcineurin is a calcium-dependent phosphatase that plays roles in calcineurin can be a target for reversible and rapidly acting male a variety of biological processes including immune responses. In sper- contraceptives (5). However, it is challenging to develop molecules matozoa, there is a testis-enriched calcineurin composed of PPP3CC and that specifically inhibit sperm calcineurin and not somatic calci- PPP3R2 (sperm calcineurin) that is essential for sperm motility and male neurin because of sequence similarities (82% amino acid identity fertility. Because sperm calcineurin has been proposed as a target for between human PPP3CA and PPP3CC and 85% amino acid reversible male contraceptives, identifying proteins that interact with identity between human PPP3R1 and PPP3R2). Therefore, identi- sperm calcineurin widens the choice for developing specific inhibitors. fying proteins that interact with sperm calcineurin widens the choice Here, by screening the calcineurin-interacting PxIxIT consensus motif of inhibitors that target the sperm calcineurin pathway. in silico and analyzing the function of candidate proteins through the The PxIxIT motif is a conserved sequence found in generation of gene-modified mice, we discovered that SPATA33 inter- calcineurin-binding proteins (8, 9).
    [Show full text]
  • Transcriptome-Wide Identification of Transient RNA G-Quadruplexes In
    ARTICLE DOI: 10.1038/s41467-018-07224-8 OPEN Transcriptome-wide identification of transient RNA G-quadruplexes in human cells Sunny Y. Yang1, Pauline Lejault2, Sandy Chevrier3, Romain Boidot 3, A. Gordon Robertson4, Judy M.Y. Wong 1 & David Monchaud 2 Guanine-rich RNA sequences can fold into four-stranded structures, termed G-quadruplexes (G4-RNAs), whose biological roles are poorly understood, and in vivo existence is debated. 1234567890():,; To profile biologically relevant G4-RNA in the human transcriptome, we report here on G4RP-seq, which combines G4-RNA-specific precipitation (G4RP) with sequencing. This protocol comprises a chemical crosslinking step, followed by affinity capture with the G4- specific small-molecule ligand/probe BioTASQ, and target identification by sequencing, allowing for capturing global snapshots of transiently folded G4-RNAs. We detect wide- spread G4-RNA targets within the transcriptome, indicative of transient G4 formation in living human cells. Using G4RP-seq, we also demonstrate that G4-stabilizing ligands (BRACO-19 and RHPS4) can change the G4 transcriptomic landscape, most notably in long non-coding RNAs. G4RP-seq thus provides a method for studying the G4-RNA landscape, as well as ways of considering the mechanisms underlying G4-RNA formation, and the activity of G4-stabilizing ligands. 1 Faculty of Pharmaceutical Sciences, University of British Columbia, Pharmaceutical Sciences Building, 2405 Wesbrook Mall, Vancouver, BC V6T 1Z3, Canada. 2 Institut de Chimie Moléculaire (ICMUB), UBFC Dijon, CNRS UMR6302, 9, Rue Alain Savary, 21078 Dijon, France. 3 Platform of Transfer in Cancer Biology, Centre Georges-François Leclerc, BP 77980, 1, Rue Professeur Marion, 21079 Dijon, France.
    [Show full text]
  • Dietary Supplementation with L-Arginine, Single Nucleotide
    The Journal of Nutrition Commentary Dietary Supplementation with L-Arginine, Single Nucleotide Polymorphisms of Arginase Downloaded from https://academic.oup.com/jn/advance-article/doi/10.1093/jn/nxaa431/6131937 by University of Memphis - Library user on 10 February 2021 1 and 2, and Plasma L-Arginine Keith R Martin Center for Nutraceutical and Dietary Supplement Research, College of Health Sciences, University of Memphis, Memphis, TN, USA There are ∼3 million single nucleotide polymorphisms (SNPs) Arginine-dependent NO impacts the immune, neuronal, and between 2 unrelated individuals, with each SNP representing cardiovascular systems and is a potent vasodilator critical for a single modification in the genomic code and cumulatively vascular tone, blood pressure modulation, vascular permeabil- representing 0.1% human genetic diversity. Although many of ity, and angiogenesis (7–9). SNPs in the ARG1 gene are clinically these differences are silent, relatively recent data suggest that associated with cardiovascular diseases such as hypertension, around half of the various responses to dietary agents could cardiomyopathy, myocardial infarction, and carotid intima be related to genetic variation, a field coined as nutrigenetics. media thickness, and upregulation of arginase is implicated in These variations are of considerable interest in improving the vascular dysfunction (10, 11). Thus, dietary supplementation health of individuals and collectively mitigating the risk of with l-arginine could be warranted. chronic disease. In this issue of the Journal, Hannemann et The study by Hannemann et al. is the first to describe al. (1) describe a possible functional relation between arginase an association between genotypes of ARG1 and ARG2 with isoforms, important in the urea cycle and nitric oxide (NO) consequent circulating plasma concentrations of l-arginine.
    [Show full text]
  • Low Basal Expression and Slow Induction of IFITM3 Puts Immune
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.20.885590; this version posted December 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 TITLE: Low basal expression and slow induction of IFITM3 puts immune 2 cells at risk of influenza A infection 3 4 Running head (40 characters): 5 Cells at risk of Influenza A infection 6 7 Authors: 8 Dannielle Wellington1,2,*, , Zixi Yin1,2, Liwei Zhang1, Jessica Forbester1,3, Kerry 9 Kite1, Henry Laurenson-Schafer1, Shokouh Makvandi-Nejad1 , Boquan Jin4, 10 Emma Bowes5, Krishnageetha Manoharan5, David Maldonado-Perez5, Clare 11 Verill5, Ian Humphreys3 & Tao Dong1,2,* 12 1. MRC Human Immunology Unit, MRC Weatherall Institute of Molecular Medicine, Radcliffe 13 Department of Medicine, Oxford University, Oxford OX3 9DS, UK 14 2. Chinese Academy of Medical Sciences (CAMS) Oxford Institute, Nuffield Department of 15 Medicine, Oxford University, OX3 7BN, UK 16 3. Division of Infection and Immunity/Systems Immunity University Research Institute, Cardiff 17 University, Cardiff, CF14 4XN, UK 18 4. Fourth Military Medical University, Xian, China 19 5. Oxford Radcliffe BioBank, Nuffield Department of Surgical Sciences, Oxford University, 20 Oxford OX3 9DU, UK 21 *Corresponding to Dannielle Wellington [email protected] or Tao Dong, 22 [email protected] 23 24 Acknowledgements: 25 The authors would like to thank the following facilities and individuals within 26 the MRC Weatherall Institute (Oxford) for their invaluaBle help in the following 27 experiments: Mass Cytometry Facility and Alain Townsend for kindly providing 28 virus stocks.
    [Show full text]
  • The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs221606. doi:10.1242/jcs.221606 TOOLS AND RESOURCES The N-cadherin interactome in primary cardiomyocytes as defined using quantitative proximity proteomics Yang Li1,*, Chelsea D. Merkel1,*, Xuemei Zeng2, Jonathon A. Heier1, Pamela S. Cantrell2, Mai Sun2, Donna B. Stolz1, Simon C. Watkins1, Nathan A. Yates1,2,3 and Adam V. Kwiatkowski1,‡ ABSTRACT requires multiple adhesion, cytoskeletal and signaling proteins, The junctional complexes that couple cardiomyocytes must transmit and mutations in these proteins can cause cardiomyopathies (Ehler, the mechanical forces of contraction while maintaining adhesive 2018). However, the molecular composition of ICD junctional homeostasis. The adherens junction (AJ) connects the actomyosin complexes remains poorly defined. – networks of neighboring cardiomyocytes and is required for proper The core of the AJ is the cadherin catenin complex (Halbleib and heart function. Yet little is known about the molecular composition of the Nelson, 2006; Ratheesh and Yap, 2012). Classical cadherins are cardiomyocyte AJ or how it is organized to function under mechanical single-pass transmembrane proteins with an extracellular domain that load. Here, we define the architecture, dynamics and proteome of mediates calcium-dependent homotypic interactions. The adhesive the cardiomyocyte AJ. Mouse neonatal cardiomyocytes assemble properties of classical cadherins are driven by the recruitment of stable AJs along intercellular contacts with organizational and cytosolic catenin proteins to the cadherin tail, with p120-catenin β structural hallmarks similar to mature contacts. We combine (CTNND1) binding to the juxta-membrane domain and -catenin β quantitative mass spectrometry with proximity labeling to identify the (CTNNB1) binding to the distal part of the tail.
    [Show full text]
  • Mesenchymal Stem Cells Prevent the Progression of Diabetic
    Lee et al. Experimental & Molecular Medicine (2019) 51:77 https://doi.org/10.1038/s12276-019-0268-5 Experimental & Molecular Medicine ARTICLE Open Access Mesenchymal stem cells prevent the progression of diabetic nephropathy by improving mitochondrial function in tubular epithelial cells Seung Eun Lee1,2,7,JungEunJang1,2,8,HyunSikKim2,MinKyoJung2,MyoungSeokKo2,Mi-OkKim2, Hye Sun Park2, Wonil Oh3, Soo Jin Choi3,HyeJinJin3, Sang-Yeob Kim4,YunJaeKim2,SeongWhoKim5, Min Kyung Kim5, Chang Ohk Sung6, Chan-Gi Pack 2,Ki-UpLee1,2 and Eun Hee Koh1,2 Abstract The administration of mesenchymal stem cells (MSCs) was shown to attenuate overt as well as early diabetic nephropathy in rodents, but the underlying mechanism of this beneficial effect is largely unknown. Inflammation and mitochondrial dysfunction are major pathogenic factors in diabetic nephropathy. In this study, we found that the repeated administration of MSCs prevents albuminuria and injury to tubular epithelial cells (TECs), an important element in the progression of diabetic nephropathy, by improving mitochondrial function. The expression of M1 macrophage markers was significantly increased in diabetic kidneys compared with that in control kidneys. Interestingly, the expression of arginase-1 (Arg1), an important M2 macrophage marker, was reduced in diabetic kidneys and increased by MSC treatment. In cultured TECs, conditioned media from lipopolysaccharide-activated 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; macrophages reduced peroxisomal proliferator-activated receptor gamma coactivator 1α (Pgc1a) expression and impaired mitochondrial function. The coculture of macrophages with MSCs increased and decreased the expression of Arg1 and M1 markers, respectively. Treatment with conditioned media from cocultured macrophages prevented activated macrophage-induced mitochondrial dysfunction in TECs.
    [Show full text]