Newly Identified Gon4l/Udu-Interacting Proteins
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody – AP08962PU-N
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AP08962PU-N ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: ELISA, IHC, WB Recommended Dilution: ELISA: 1/32000. Immunohistochemistry on Paraffin Sections: 3.75 µg/ml. Western Blot: 1 - 3 µg/ml. Reactivity: Canine, Human Host: Goat Clonality: Polyclonal Immunogen: Synthetic peptide from C-terminus of human ALS2CR2 Specificity: This antibody reacts to STE20-Related Kinase Adaptor Beta (STRADB/ALS2CR2) at aa 406-418. It is expected to recognise both human isoforms: ILPIP-alpha (NP_061041.2) and ILPIP-beta (AAF71042.1). Formulation: Tris saline buffer, pH 7.3, 0.5% BSA, 0.02% sodium azide State: Aff - Purified State: Liquid purified Ig Concentration: lot specific Purification: Immunoaffinity Chromatography Conjugation: Unconjugated Storage: Store the antibody undiluted at 2-8°C for one month or (in aliquots) at -20°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. Database Link: Entrez Gene 55437 Human Q9C0K7 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 ALS2CR2 (STRADB) 406-418) Goat Polyclonal Antibody – AP08962PU-N Background: Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2, is connected to transferase/kinase activity and ATP binding, it has recently been shown to interact with XIAP, a member of the IAP (Inhibitor of Apoptosis) protein family. -
Transcriptome Analyses of Rhesus Monkey Pre-Implantation Embryos Reveal A
Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptome analyses of rhesus monkey pre-implantation embryos reveal a reduced capacity for DNA double strand break (DSB) repair in primate oocytes and early embryos Xinyi Wang 1,3,4,5*, Denghui Liu 2,4*, Dajian He 1,3,4,5, Shengbao Suo 2,4, Xian Xia 2,4, Xiechao He1,3,6, Jing-Dong J. Han2#, Ping Zheng1,3,6# Running title: reduced DNA DSB repair in monkey early embryos Affiliations: 1 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 2 Key Laboratory of Computational Biology, CAS Center for Excellence in Molecular Cell Science, Collaborative Innovation Center for Genetics and Developmental Biology, Chinese Academy of Sciences-Max Planck Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 3 Yunnan Key Laboratory of Animal Reproduction, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 4 University of Chinese Academy of Sciences, Beijing, China 5 Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, Yunnan 650204, China 6 Primate Research Center, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, China * Xinyi Wang and Denghui Liu contributed equally to this work 1 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press # Correspondence: Jing-Dong J. Han, Email: [email protected]; Ping Zheng, Email: [email protected] Key words: rhesus monkey, pre-implantation embryo, DNA damage 2 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Pre-implantation embryogenesis encompasses several critical events including genome reprogramming, zygotic genome activation (ZGA) and cell fate commitment. -
Coupling of Spliceosome Complexity to Intron Diversity
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Coupling of spliceosome complexity to intron diversity Jade Sales-Lee1, Daniela S. Perry1, Bradley A. Bowser2, Jolene K. Diedrich3, Beiduo Rao1, Irene Beusch1, John R. Yates III3, Scott W. Roy4,6, and Hiten D. Madhani1,6,7 1Dept. of Biochemistry and Biophysics University of California – San Francisco San Francisco, CA 94158 2Dept. of Molecular and Cellular Biology University of California - Merced Merced, CA 95343 3Department of Molecular Medicine The Scripps Research Institute, La Jolla, CA 92037 4Dept. of Biology San Francisco State University San Francisco, CA 94132 5Chan-Zuckerberg Biohub San Francisco, CA 94158 6Corresponding authors: [email protected], [email protected] 7Lead Contact 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SUMMARY We determined that over 40 spliceosomal proteins are conserved between many fungal species and humans but were lost during the evolution of S. cerevisiae, an intron-poor yeast with unusually rigid splicing signals. We analyzed null mutations in a subset of these factors, most of which had not been investigated previously, in the intron-rich yeast Cryptococcus neoformans. -
Environmental Influences on Endothelial Gene Expression
ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
A Clinicopathological and Molecular Genetic Analysis of Low-Grade Glioma in Adults
A CLINICOPATHOLOGICAL AND MOLECULAR GENETIC ANALYSIS OF LOW-GRADE GLIOMA IN ADULTS Presented by ANUSHREE SINGH MSc A thesis submitted in partial fulfilment of the requirements of the University of Wolverhampton for the degree of Doctor of Philosophy Brain Tumour Research Centre Research Institute in Healthcare Sciences Faculty of Science and Engineering University of Wolverhampton November 2014 i DECLARATION This work or any part thereof has not previously been presented in any form to the University or to any other body whether for the purposes of assessment, publication or for any other purpose (unless otherwise indicated). Save for any express acknowledgments, references and/or bibliographies cited in the work, I confirm that the intellectual content of the work is the result of my own efforts and of no other person. The right of Anushree Singh to be identified as author of this work is asserted in accordance with ss.77 and 78 of the Copyright, Designs and Patents Act 1988. At this date copyright is owned by the author. Signature: Anushree Date: 30th November 2014 ii ABSTRACT The aim of the study was to identify molecular markers that can determine progression of low grade glioma. This was done using various approaches such as IDH1 and IDH2 mutation analysis, MGMT methylation analysis, copy number analysis using array comparative genomic hybridisation and identification of differentially expressed miRNAs using miRNA microarray analysis. IDH1 mutation was present at a frequency of 71% in low grade glioma and was identified as an independent marker for improved OS in a multivariate analysis, which confirms the previous findings in low grade glioma studies. -
BNIPL Antibody - Middle Region Rabbit Polyclonal Antibody Catalog # AI13432
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 BNIPL antibody - middle region Rabbit Polyclonal Antibody Catalog # AI13432 Specification BNIPL antibody - middle region - Product Information Application WB Primary Accession Q7Z465 Other Accession NM_138278, NP_612122 Reactivity Human, Mouse, Rat, Rabbit, Horse, Bovine, Guinea Pig, Dog Predicted Human, Mouse, Rat, Rabbit, Pig, WB Suggested Anti-BNIPL Antibody Titration: Horse, Bovine, 0.2-1 μg/ml Guinea Pig, Dog Positive Control: OVCAR-3 cell lysate Host Rabbit Clonality Polyclonal Calculated MW 40kDa KDa BNIPL antibody - middle region - BNIPL antibody - middle region - Additional References Information Zhou Y.T.,et al.J. Biol. Chem. Gene ID 149428 277:7483-7492(2002). Qin W.,et al.Biochem. Biophys. Res. Commun. Alias Symbol BNIP-S, BNIPL-1, 308:379-385(2003). BNIPL-2, PP753 Gregory S.G.,et al.Nature 441:315-321(2006). Other Names Shen L.,et al.FEBS Lett. 540:86-90(2003). Bcl-2/adenovirus E1B 19 kDa-interacting protein 2-like protein, BNIPL Format Liquid. Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose. Reconstitution & Storage Add 50 ul of distilled water. Final anti-BNIPL antibody concentration is 1 mg/ml in PBS buffer with 2% sucrose. For longer periods of storage, store at 20°C. Avoid repeat freeze-thaw cycles. Precautions BNIPL antibody - middle region is for research use only and not for use in diagnostic or therapeutic procedures. Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 BNIPL antibody - middle region - Protein Information Name BNIPL Function May be a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. -
Cacybp (NM 009786) Mouse Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR202748 Cacybp (NM_009786) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cacybp (NM_009786) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cacybp Synonyms: SIP Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR202748 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTTCCGTTTTGGAAGAGTTGCAGAAAGACCTAGAAGAGGTCAAAGTATTGCTGGAAAAGTCCACTA GGAAAAGACTACGTGATACTCTTACAAGTGAAAAGTCCAAGATTGAGACGGAACTCAAGAACAAGATGCA ACAGAAGTCGCAGAAGAAACCAGAACTTGATAATGAAAAGCCAGCTGCTGTGGTTGCTCCTCTTACAACA GGATACACCGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATCTACATTACCT TGACTGGCGTCCATCAGGTGCCCACTGAGAACGTGCAGGTGCACTTCACAGAGAGGTCATTTGATCTTCT GGTAAAAAACCTCAATGGCAAGAATTACTCCATGATTGTGAACAATCTTTTGAAACCTATCTCTGTGGAA AGCAGTTCAAAAAAAGTCAAGACTGATACAGTAATTATTCTATGTAGAAAGAAAGCAGAAAACACAAGAT GGGACTACTTAACACAGGTGGAAAAGGAATGCAAAGAGAAAGAAAAGCCTTCCTACGACACGGAGGCAGA CCCTAGTGAGGGATTAATGAATGTTCTAAAGAAAATTTATGAAGACGGAGACGATGATATGAAGCGAACC ATTAATAAAGCGTGGGTGGAATCCAGAGAGAAGCAAGCCAGAGAAGACACGGAATTT ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online -
Deutsche Gesellschaft Für Experimentelle Und Klinische Pharmakologie Und Toxikologie E.V
Naunyn-Schmiedeberg´s Arch Pharmacol (2013 ) 386 (Suppl 1):S1–S104 D OI 10.1007/s00210-013-0832-9 Deutsche Gesellschaft für Experimentelle und Klinische Pharmakologie und Toxikologie e.V. Abstracts of the 79 th Annual Meeting March 5 – 7, 2013 Halle/Saale, Germany This supplement was not sponsored by outside commercial interests. It was funded entirely by the publisher. 123 S2 S3 001 003 Multitarget approach in the treatment of gastroesophagel reflux disease – Nucleoside Diphosphate Kinase B is a Novel Receptor-independent Activator of comparison of a proton-pump inhibitor with STW 5 G-protein Signaling in Clinical and Experimental Atrial Fibrillation Abdel-Aziz H.1,2, Khayyal M. T.3, Kelber O.2, Weiser D.2, Ulrich-Merzenich G.4 Abu-Taha I.1, Voigt N.1, Nattel S.2, Wieland T.3, Dobrev D.1 1Inst. of Pharmaceutical & Medicinal Chemistry, University of Münster Pharmacology, 1Universität Duisburg-Essen Institut für Pharmakologie, Hufelandstr. 55, 45122 Essen, Hittorfstr 58-62, 48149 Münster, Germany Germany 2Steigerwald Arzneimittelwerk Wissenschaft, Havelstr 5, 64295 Darmstadt, Germany 2McGill University Montreal Heart Institute, 3655 Promenade Sir-William-Osler, Montréal 3Faculty of Pharmacy, Cairo University Pharmacology, Cairo Egypt Québec H3G 1Y6, Canada 4Medizinische Poliklinik, University of Bonn, Wilhelmstr. 35-37, 53111 Bonn, Germany 3Medizinische Fakultät Mannheim der Universität Heidelberg Institutes für Experimentelle und Klinische Pharmakologie und Toxikologie, Maybachstr. 14, 68169 Gastroesophageal reflux disease (GERD) was the most common GI-diagnosis (8.9 Mannheim, Germany million visits) in the US in 2012 (1). Proton pump inhibitors (PPI) are presently the mainstay of therapy, but in up to 40% of the patients complete symptom control fails. -
Essential Genes and Their Role in Autism Spectrum Disorder
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality. -
CRISPR Activation Screening of Circulating Tumor Cells Identifies Enhancers of Blood-Based Metastasis
CRISPR Activation Screening of Circulating Tumor Cells Identifies Enhancers of Blood-Based Metastasis The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Ebright, Richard Yon. 2020. CRISPR Activation Screening of Circulating Tumor Cells Identifies Enhancers of Blood-Based Metastasis. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link https://nrs.harvard.edu/URN-3:HUL.INSTREPOS:37365157 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA CRISPR activation screening of circulating tumor cells identifies enhancers of blood-based metastasis A dissertation presented by Richard Yon Ebright to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts September 2019 © 2019 Richard Yon Ebright All rights reserved. Dissertation Advisors: Daniel A. Haber & Shyamala Maheswaran Richard Yon Ebright CRISPR activation screening of circulating tumor cells identifies enhancers of blood-based metastasis Abstract Over ninety percent of cancer mortality is attributable to metastasis, most commonly due to the blood-borne dissemination of cancer cells from a primary tumor to secondary tissues. However, the vast majority of these cancer cells in the circulation, known as circulating tumor cells (CTCs), never go on to form clinically relevant metastases, instead dying or senescing in the circulation or at distant sites. -
Download Author Version (PDF)
Molecular BioSystems Accepted Manuscript This is an Accepted Manuscript, which has been through the Royal Society of Chemistry peer review process and has been accepted for publication. Accepted Manuscripts are published online shortly after acceptance, before technical editing, formatting and proof reading. Using this free service, authors can make their results available to the community, in citable form, before we publish the edited article. We will replace this Accepted Manuscript with the edited and formatted Advance Article as soon as it is available. You can find more information about Accepted Manuscripts in the Information for Authors. Please note that technical editing may introduce minor changes to the text and/or graphics, which may alter content. The journal’s standard Terms & Conditions and the Ethical guidelines still apply. In no event shall the Royal Society of Chemistry be held responsible for any errors or omissions in this Accepted Manuscript or any consequences arising from the use of any information it contains. www.rsc.org/molecularbiosystems Page 1 of 29 Molecular BioSystems Mutated Genes and Driver Pathways Involved in Myelodysplastic Syndromes—A Transcriptome Sequencing Based Approach Liang Liu1*, Hongyan Wang1*, Jianguo Wen2*, Chih-En Tseng2,3*, Youli Zu2, Chung-che Chang4§, Xiaobo Zhou1§ 1 Center for Bioinformatics and Systems Biology, Division of Radiologic Sciences, Wake Forest University Baptist Medical Center, Winston-Salem, NC 27157, USA. 2 Department of Pathology, the Methodist Hospital Research Institute,