A Regulator of Innate Immune Responses

Total Page:16

File Type:pdf, Size:1020Kb

A Regulator of Innate Immune Responses (19) TZZ ¥_T (11) EP 2 942 357 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 11.11.2015 Bulletin 2015/46 C07K 14/47 (2006.01) A61K 38/00 (2006.01) C12N 15/113 (2010.01) (21) Application number: 15169327.2 (22) Date of filing: 04.08.2009 (84) Designated Contracting States: (72) Inventor: Barber, Glen N. AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Palmetto Bay, FL 33157 (US) HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR (74) Representative: Inspicos A/S Kogle Allé 2 (30) Priority: 04.08.2008 US 129975 P P.O. Box 45 2970 Hørsholm (DK) (62) Document number(s) of the earlier application(s) in accordance with Art. 76 EPC: Remarks: 09805473.7 / 2 324 044 This application was filed on 27-05-2015 as a divisional application to the application mentioned (71) Applicant: Barber, Glen N. under INID code 62. Palmetto Bay, FL 33157 (US) (54) STING (STIMULATOR OF INTEFERON GENES), A REGULATOR OF INNATE IMMUNE RESPONSES (57) Novel molecules termed STING which include STING compositions are useful for the treatment of an nucleic acids, polynucleotides, oligonucleotides, pep- immune-related disorder, including treating and prevent- tides, mutants, variants and active fragments thereof, ing infection by modulating immunity. modulate innate and adaptive immunity in a subject. EP 2 942 357 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 942 357 A1 Description RELATED APPLICATIONS 5 [0001] This application claims priority under 35 USC § 119 to U.S. Provisional Patent Application No. 61/129,975 filed August 4, 2008, the disclosure of which is incorporated by reference in its entirety. FIELD OF THE INVENTION 10 [0002] Embodiments of the invention relate to compositions and methods for modulating innate and adaptive immunity in a subject and/or for the treatment of an immune-related disorder, cancer, autoimmunity, treating and preventing infections. BACKGROUND 15 [0003] Cellular host defense responses to pathogen invasion principally involves the detection of pathogen associated molecular patterns (PAMPs) such as viral nucleic acid or bacterial cell wall components including lipopolysaccharide or flagellar proteins that results in the induction of anti-pathogen genes. For example, viral RNA can be detected by mem- brane bound Toll-like receptors (TLR’s) present in the endoplasmic reticulum (ER) and/or endosomes (e.g. TLR 3 and 20 7/8) or by TLR-independent intracellular DExD/H box RNA helicases referred to as retinoic acid inducible gene 1 (RIG- I)or melanoma differentiation associated antigen 5 (MDA5,also referred to as IFIH1 andhelicard). Theseevents culminate in the activation of downstream signaling events, much of which remains unknown, leading to the transcription of NF- κB and IRF3/7- dependent genes, including type IIFN. 25 SUMMARY [0004] This Summary is provided to present a summary of the invention to briefly indicate the nature and substance of the invention. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims. 30 [0005] STING molecules (Stimulator of Interferon Genes) modulate the immune system, in particular the innate immune system. Compositions comprising STING and/or other agents which modulate STING expression, activity and/or func- tions treat diseases such as cancer, infections, autoimmune diseases or disorders, inflammation and the like are ad- ministered to patients at risk of developing or for the treatment of patients afflicted with such diseases. [0006] Embodiments of the invention are also directed to molecules and pathways which directly or indirectly interact 35 or associate with STING. [0007] Other aspects of the invention are described infra. BRIEF DESCRIPTION OF THE DRAWINGS 40 [0008] Figure 1A shows the amino acid sequence of human and mouse STING (SEQ ID NOS: 1 and 2 respectively). Figure 1B shows a schematic representation of hSTING indicating TM and leucine rich regions. Figure 1C shows a Northern blot analysis of human STING. Figure 1D shows an immunoblot analysis of STING in HEK 293 cells. RNAi to STING 45 (hSTING) or control RNAi (NS) was used to confirm specificity of the antibody. Figure 1E shows a confocal analysis of HEK 293 cells transfected with hSTING tagged at the carboxyl end with HA. Transfected cells were also analyzed using ER-dsRed, Mitotracker or Golgi-dsRed. Figure 1F shows that fractionation experiments confirm that STING resides in the ER. Control antibodies indicate accuracy of fractionation (Calreticulin- ER, COX IV-mitochondria, beta actin- cytosol). 50 Figure 2A: 293T cells were transfected with 50ng p110-Luc plasmid and 10ng pRL-TK normalization plasmid with increasing amounts of (50ng, 150ng, 250ng) human hSTING, murine mSTING or control ΔRIG-I. Luciferase assays indicating IFNβ promoter activity were taken 36 hours post-transfection. 293T cells transfected as in (Figure 2A) with either PRDIII-I-Luc (Figure 2B), NF-κB-Luc (Figure 2C) or ISRE-Luc (Figure 2D) responsive plasmids were analyzed similarly. Figure 2E: 293T cells were transfected with 250 ng of vector alone or STING, IPS-1 or TBK-1 55 expressing plasmids for 24hrs and lysed cells analyzed by native gel electrophoresis and by subsequent immunoblot using antibody to detect IRF3 dimerization. Figure 2F: MEF’s were transfected with vector alone or hSTING or mSTING or IPS-1 expressing plasmid (500 ng) and mRNA retrieved after 24hrs post-transfection. IFN β mRNA was analyzed by qRT-PCR. Figure 2G: Medium from transfected MEFs was analyzed for IFN β protein by ELISA. Figure 2 EP 2 942 357 A1 2H: 293T cells were transfected with 250ng of control or hSTING expressing plasmid and mRNA retrieved after 36 hrs for analysis by DNA microarray. Figure 2I: MEF’s were transfected with vector alone or hSTING or mSTING or ΔRIG-I or IPS-1 expressing plasmid (500 ng) and after 36 hrs post-transfection were infected at an MOI of 1 with VSV-GFP. Figure 2J: Viral replication from experiment(Figure 2H) was measured by plaque assay. Figure 2K: 5 Normal or TBK-1 deficient MEFs were transfected with vector alone, hSTING, mSTING or TBK-1 expressing plasmids (500ng) and 100 ng murine IFN β-Luc reporter plasmid with 10ng PRL-TK for 24 hrs and luciferase measured. Figure 2L: Normal or FADD -/- MEFs were treated as in (Figure 2K) and luciferase measured. Figure 2M: Schematic of hSTING variants. Figure 2N: 293T cells were transfected as in (Figure 2A) with hSTING full-length or variants and luciferase measured. Figure 2O: 293T cells were transfected with 100ng full length STING and increasing amounts 10 of hSTING-Full, hSTING-N or hSTING-C (0ng, 150ng, 250ng) with luciferase plasmids as in (Figure 2A). Luciferase was measured after 36 hrs. Asterisks indicate significant difference (P < 0.05) as determined by Student’s t-test. Figure 3A: MEFs (C57/BL6) were treated with RNAi to mSTING and knockdown confirmed after 72 hours by im- munoblot using anti-STING rabbit antiserum. Figure 3B: Fluorescence microscopy (GFP) of MEFs treated with RNAi to mSTING following 24 hrs infection with VSV-GFP (MOI 1). Figure 3C: RNAi treated cells were infected with 15 VSVGFP (MOI 1) for 16 hrs and IFNβ mRNA measured using quantitative RT-PCR. Figure 3D: Viral titers taken from RNAi treated or untreated MEFs after 24 hours. Figure 3E schematic diagram depicting targeted homologous recombination strategy of STING in ES cells. Figure 3F: quantitative RT-PCR analysis of STING mRNA in STING -/-or control litter mate MEFs. Figure 3G: Immunoblot of STING -/- cells or control MEFs using antiserum as in (Figure 3A). Figure 3H: Fluorescence microscopy (GFP) of STING -/-or control MEFs following 12 hrs infection with 20 VSV-GFP (MOI 0.1). Figure 3I: Viral titers taken from STING -/- or control MEFs following infection with VSV-GFP after 24 hours. Figure 3J: Viral titers taken from STING -/- or control MEFs following infection with VSV ΔM after 24 hours. Figure 3K: Endogenous IFN β levels measured from STING -/- or control MEFs infected with VSV-GFP (MOI 1) or Sendai Virus (SeV MOI 1) after 24 hours. Figure 3L: STING-/- MEF’s or controls were treated with transfected (Lipo 2000 [3ml/ml]) poly dA-dT for 24 hrs and IFN β measured by ELISA. Figure 3M: Time course analysis of DNA 25 transfected MEFs. Figure 3N: BMDM were treated with exogenous poly I:C (10 mg/ml) or LPS (10 mg/ml)or transfected poly dA-dT (as in Figure 3L; 10mg/ml) and IFNβ after 24 hours by ELISA. Figure 3O: GM-DC’s were treated as in Figure 3N. Asterisks indicate significant difference (P < 0.05) as determined by Student’s t-test. Figure 4A: 293T cells were co-transfected with HA-tagged STING and FLAG-tagged RIG-I or MDA5 for 24 hours. Cells were infected with SeV (MOI 1) for 12 hours. Cells were lysed and co-immunoprecipitated with anti-FLAG 30 antibody and after immunoblotting analyzed using antibody to HA. Figure 4B: HUVECs were lysed and immuno- precipitated using an antibody to endogenous hSTING. Washed precipitates were immunoblotted using an antibody to endogenous RIG-I. Figure 4C: 293T cells were co-transfected with HA-tagged STING and FLAG-tagged RIG-I, ΔRIG-I (aa1-284) or RIG-I-C (aa218-925) for 24 hours. Cells were lysed and co-immunoprecipitated with anti-FLAG antibody and after immunoblotting analyzed using antibody to HA. Figure 4D: 293T cells were co-transfected with 35 control vector (-) or increasing amounts of full-length, amino (aa1-230) or carboxyl (aa173-379) STING (0, 150ng and 250 ng) together with 150ng of ΔRIG-I.
Recommended publications
  • Genetic Analysis of Retinopathy in Type 1 Diabetes
    Genetic Analysis of Retinopathy in Type 1 Diabetes by Sayed Mohsen Hosseini A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto © Copyright by S. Mohsen Hosseini 2014 Genetic Analysis of Retinopathy in Type 1 Diabetes Sayed Mohsen Hosseini Doctor of Philosophy Institute of Medical Science University of Toronto 2014 Abstract Diabetic retinopathy (DR) is a leading cause of blindness worldwide. Several lines of evidence suggest a genetic contribution to the risk of DR; however, no genetic variant has shown convincing association with DR in genome-wide association studies (GWAS). To identify common polymorphisms associated with DR, meta-GWAS were performed in three type 1 diabetes cohorts of White subjects: Diabetes Complications and Control Trial (DCCT, n=1304), Wisconsin Epidemiologic Study of Diabetic Retinopathy (WESDR, n=603) and Renin-Angiotensin System Study (RASS, n=239). Severe (SDR) and mild (MDR) retinopathy outcomes were defined based on repeated fundus photographs in each study graded for retinopathy severity on the Early Treatment Diabetic Retinopathy Study (ETDRS) scale. Multivariable models accounted for glycemia (measured by A1C), diabetes duration and other relevant covariates in the association analyses of additive genotypes with SDR and MDR. Fixed-effects meta- analysis was used to combine the results of GWAS performed separately in WESDR, ii RASS and subgroups of DCCT, defined by cohort and treatment group. Top association signals were prioritized for replication, based on previous supporting knowledge from the literature, followed by replication in three independent white T1D studies: Genesis-GeneDiab (n=502), Steno (n=936) and FinnDiane (n=2194).
    [Show full text]
  • Download on 20
    bioRxiv preprint doi: https://doi.org/10.1101/850776; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Intramembrane protease RHBDL4 cleaves oligosaccharyltransferase subunits to target them for ER-associated degradation Julia D. Knopf1, Nina Landscheidt1, Cassandra L. Pegg2, Benjamin L. Schulz2, Nathalie Kühnle1, Chao-Wei Chao1, Simon Huck1 and Marius K. Lemberg1, # 1Centre for Molecular Biology of Heidelberg University (ZMBH), DKFZ-ZMBH Alliance, 69120 Heidelberg, Germany. 2School of Chemistry and Molecular Biosciences, ARC Training Centre for Biopharmaceutical Innovation, The University of Queensland, St Lucia QLD 4072, Australia. #Corresponding author: [email protected] Running title: RHBDL4 triggers ERAD of OST subunits Key words: Rhomboid serine protease, Rhbdd1, ubiquitin-dependent proteolysis, post- translational protein abundance control, N-linked glycosylation. Abbreviations ERAD, ER-associated degradation; OST, oligosacharyltransferase; TM, transmembrane; UIM, ubiquitin-interacting motif. Abstract The Endoplasmic Reticulum (ER)-resident intramembrane rhomboid protease RHBDL4 generates metastable protein fragments and together with the ER-associated degradation (ERAD) machinery provides a clearance mechanism for aberrant and surplus proteins. However, the endogenous substrate spectrum and with that the role of RHBDL4 in physiological ERAD is mainly unknown. Here, we use a substrate trapping approach in combination with quantitative proteomics to identify physiological RHBDL4 substrates. This revealed oligosacharyltransferase (OST) complex subunits such as the catalytic active subunit STT3A as substrates for the RHBDL4-dependent ERAD pathway. RHBDL4-catalyzed cleavage inactivates OST subunits by triggering dislocation into the cytoplasm and subsequent proteasomal degradation.
    [Show full text]
  • Protein Expression Analysis of an in Vitro Murine Model of Prostate Cancer Progression: Towards Identification of High-Potential Therapeutic Targets
    Journal of Personalized Medicine Article Protein Expression Analysis of an In Vitro Murine Model of Prostate Cancer Progression: Towards Identification of High-Potential Therapeutic Targets Hisham F. Bahmad 1,2,3 , Wenjing Peng 4, Rui Zhu 4, Farah Ballout 1, Alissar Monzer 1, 1,5 6, , 1, , 4, , Mohamad K. Elajami , Firas Kobeissy * y , Wassim Abou-Kheir * y and Yehia Mechref * y 1 Department of Anatomy, Cell Biology and Physiological Sciences, Faculty of Medicine, American University of Beirut, Beirut 1107-2020, Lebanon; [email protected] (H.F.B.); [email protected] (F.B.); [email protected] (A.M.); [email protected] (M.K.E.) 2 Arkadi M. Rywlin M.D. Department of Pathology and Laboratory Medicine, Mount Sinai Medical Center, Miami Beach, FL 33140, USA 3 Herbert Wertheim College of Medicine, Florida International University, Miami, FL 33199, USA 4 Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, TX 79409, USA; [email protected] (W.P.); [email protected] (R.Z.) 5 Department of Internal Medicine, Mount Sinai Medical Center, Miami Beach, FL 33140, USA 6 Department of Biochemistry and Molecular Genetics, Faculty of Medicine, American University of Beirut, Beirut 1107-2020, Lebanon * Correspondence: [email protected] (F.K.); [email protected] (W.A.-K.); [email protected] (Y.M.); Tel.: +961-1-350000 (ext. 4805) (F.K.); +961-1-350000 (ext. 4778) (W.A.K.); +1-806-834-8246 (Y.M.); Fax: +1-806-742-1289 (Y.M.); 961-1-744464 (W.A.K.) These authors have contributed equally to this work as joint senior authors.
    [Show full text]
  • EFA6A, an Exchange Factor for Arf6, Regulates Early Steps in Ciliogenesis
    EFA6A, an exchange factor for Arf6, regulates early steps in ciliogenesis Mariagrazia Partisani, Carole Baron, Rania Ghossoub, Racha Fayad, Sophie Pagnotta, Sophie Abélanet, Eric Macia, Frédéric Brau, Sandra Lacas-Gervais, Alexandre Benmerah, et al. To cite this version: Mariagrazia Partisani, Carole Baron, Rania Ghossoub, Racha Fayad, Sophie Pagnotta, et al.. EFA6A, an exchange factor for Arf6, regulates early steps in ciliogenesis. Journal of Cell Science, Company of Biologists, 2021, 134 (2), pp.jcs249565. 10.1242/jcs.249565. hal-03120586 HAL Id: hal-03120586 https://hal.archives-ouvertes.fr/hal-03120586 Submitted on 19 Apr 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. © 2021. Published by The Company of Biologists Ltd | Journal of Cell Science (2021) 134, jcs249565. doi:10.1242/jcs.249565 RESEARCH ARTICLE EFA6A, an exchange factor for Arf6, regulates early steps in ciliogenesis Mariagrazia Partisani1, Carole L. Baron1, Rania Ghossoub2, Racha Fayad1, Sophie Pagnotta3, Sophie Abélanet1, Eric Macia1,Frédéric Brau1, Sandra Lacas-Gervais3, Alexandre Benmerah4,Frédéric Luton1 and Michel Franco1,* ABSTRACT localized to the PC and which play an important role in its assembly Ciliogenesis is a coordinated process initiated by the recruitment and and/or function.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name signal sequence receptor, beta (translocon-associated protein beta) Gene Symbol SSR2 Organism Human Gene Summary The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. Gene Aliases DKFZp686F19123, TLAP, TRAP-BETA, TRAPB RefSeq Accession No. NC_000001.10, NT_004487.19 UniGene ID Hs.74564 Ensembl Gene ID ENSG00000163479 Entrez Gene ID 6746 Assay Information Unique Assay ID qHsaCID0014663 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000295702, ENST00000529008, ENST00000480567, ENST00000531917, ENST00000526212 Amplicon Context Sequence GGGGCAATCCGGTCCCATTTGACATTGAGCATTCCAGACACAATGCCAAAGTCT TCTGGAGGGAAGGAATCATCAGATAGTTCCACGTCTAATGCAGCACTTGAGCCA ACATTGTAGATGTTGTACTGCAAGGTCAGGTCTCGTCCC Amplicon Length (bp) 117 Chromosome Location 1:155988061-155989851 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9998 cDNA Cq 17.45 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SSR2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
    [Show full text]
  • Stranded DNA and Sensitizes Human Kidney Renal Clear Cell Carcinoma
    RESEARCH ARTICLE Exosome component 1 cleaves single- stranded DNA and sensitizes human kidney renal clear cell carcinoma cells to poly(ADP-ribose) polymerase inhibitor Qiaoling Liu1†, Qi Xiao1†, Zhen Sun1†, Bo Wang2†, Lina Wang1, Na Wang1, Kai Wang1, Chengli Song1*, Qingkai Yang1* 1Institute of Cancer Stem Cell, DaLian Medical University, Dalian, China; 2Department of General Surgery, Second Affiliated Hospital, DaLian Medical University, Dalian, China Abstract Targeting DNA repair pathway offers an important therapeutic strategy for Homo sapiens (human) cancers. However, the failure of DNA repair inhibitors to markedly benefit patients necessitates the development of new strategies. Here, we show that exosome component 1 (EXOSC1) promotes DNA damages and sensitizes human kidney renal clear cell carcinoma (KIRC) cells to DNA repair inhibitor. Considering that endogenous source of mutation (ESM) constantly assaults genomic DNA and likely sensitizes human cancer cells to the inhibitor, we first analyzed the statistical relationship between the expression of individual genes and the mutations for KIRC. Among the candidates, EXOSC1 most notably promoted DNA damages and subsequent mutations via preferentially cleaving C site(s) in single-stranded DNA. Consistently, EXOSC1 was more *For correspondence: significantly correlated with C>A transversions in coding strands than these in template strands in [email protected] human KIRC. Notably, KIRC patients with high EXOSC1 showed a poor prognosis, and EXOSC1 (CS); sensitized human cancer cells to poly(ADP-ribose) polymerase inhibitors. These results show that [email protected] (QY) EXOSC1 acts as an ESM in KIRC, and targeting EXOSC1 might be a potential therapeutic strategy. †These authors contributed equally to this work Competing interests: The Introduction authors declare that no DNA damages and subsequent mutations are central to development, progression, and treatment competing interests exist.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • A Compendium of Co-Regulated Protein Complexes in Breast Cancer Reveals Collateral Loss Events
    bioRxiv preprint doi: https://doi.org/10.1101/155333; this version posted June 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A compendium of co-regulated protein complexes in breast cancer reveals collateral loss events Colm J. Ryan*1, Susan Kennedy1, Ilirjana Bajrami2, David Matallanas1, Christopher J. Lord2 1Systems Biology Ireland, School of Medicine, University College Dublin, Dublin 4, Ireland 2The Breast Cancer Now Toby Robins Breast Cancer Research Centre and CRUK Gene Function Laboratory, The Institute of Cancer Research, London, SW3 6JB, United Kingdom. * Correspondence: [email protected] Summary Protein complexes are responsible for the bulk of activities within the cell, but how their behavior and composition varies across tumors remains poorly understood. By combining proteomic profiles of breast tumors with a large-scale protein-protein interaction network, we have identified a set of 258 high-confidence protein complexes whose subunits have highly correlated protein abundance across tumor samples. We used this set to identify complexes that are reproducibly under- or over- expressed in specific breast cancer subtypes. We found that mutation or deletion of one subunit of a complex was often associated with a collateral reduction in protein expression of additional complex members. This collateral loss phenomenon was evident from proteomic, but not transcriptomic, profiles suggesting post- transcriptional control. Mutation of the tumor suppressor E-cadherin (CDH1) was associated with a collateral loss of members of the adherens junction complex, an effect we validated using an engineered model of E-cadherin loss.
    [Show full text]
  • A Crosstalk Between the RNA Binding Protein Smaug and the Hedgehog Pathway Links Cell Signaling to Mrna Regulation in Drosophila Lucía Bruzzone
    A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila Lucía Bruzzone To cite this version: Lucía Bruzzone. A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila. Cellular Biology. Université Sorbonne Paris Cité, 2018. English. NNT : 2018USPCC234. tel-02899776 HAL Id: tel-02899776 https://tel.archives-ouvertes.fr/tel-02899776 Submitted on 15 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Thèse de doctorat de l’Université Sorbonne Paris Cité Préparée à l’Université Paris Diderot Ecole doctorale HOB n° 561 Institut Jacques Monod / Equipe Développement, Signalisation et Trafic A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in Drosophila Lucía Bruzzone Thèse de doctorat de Biologie Dirigée par Anne Plessis Présentée et soutenue publiquement à Paris le 19 mars 2018 Président du jury: Alain Zider / Professeur Université Paris Diderot
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • 4 Understanding the Role of GNA13 Deregulation in Lymphomagenesis
    Integrative Genomics Reveals a Role for GNA13 in Lymphomagenesis by Adrienne Greenough University Program in Genetics and Genomics Duke University Approved: ___________________________ Sandeep Dave, Supervisor ___________________________ Fred Dietrich ___________________________ Jack Keene ___________________________ Yuan Zhuang Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University 2014 i v ABSTRACT Integrative Genomics Reveals a Role for GNA13 in Lymphomagenesis by Adrienne Greenough University Program in Genetics and Genomics Duke University Approved: ___________________________ Sandeep Dave, Supervisor ___________________________ Fred Dietrich ___________________________ Jack Keene ___________________________ Yuan Zhuang An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University 2014 Copyright by Adrienne Greenough 2014 Abstract Lymphomas comprise a diverse group of malignancies derived from immune cells. High throughput sequencing has recently emerged as a powerful and versatile method for analysis of the cancer genome and transcriptome. As these data continue to emerge, the crucial work lies in sorting through the wealth of information to hone in on the critical aspects that will give us a better understanding of biology and new insight for how to treat disease. Finding the important signals within these large data sets is one of the major challenges of next generation sequencing. In this dissertation, I have developed several complementary strategies to describe the genetic underpinnings of lymphomas. I begin with developing a better method for RNA sequencing that enables strand-specific total RNA sequencing and alternative splicing profiling in the same analysis.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]