Report a Recessive Contiguous Gene Deletion of Chromosome 2P16
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name mitochondrial translational initiation factor 2 Gene Symbol MTIF2 Organism Human Gene Summary During the initiation of protein biosynthesis initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt) an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s with the greatest degree of conservation in the G domains of the proteins. Two transcript variants encoding the same protein have been found for this gene. Gene Aliases Not Available RefSeq Accession No. NC_000002.11, NG_017017.1, NT_022184.15 UniGene ID Hs.149894 Ensembl Gene ID ENSG00000085760 Entrez Gene ID 4528 Assay Information Unique Assay ID qHsaCEP0058136 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000263629, ENST00000366137, ENST00000441307, ENST00000420637, ENST00000417363, ENST00000412530, ENST00000394600 Amplicon Context Sequence CCAAGCTCCTCATTTTACAGAAAAGGAAACGGAAATCCAGAAGGGTCAAAAAAG CTTCTCCAATGTCATACCGCTAGTTAATGGCAGTCAAGACTAGAACCCAGACG Amplicon Length (bp) 77 Chromosome Location 2:55495715-55495821 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9995 cDNA Cq 21.05 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79 gDNA Cq 24.56 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. -
Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach
Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds. -
Snapshot: the Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J
192 Cell SnapShot: The Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J. Blencowe 133 Banting and Best Department of Medical Research, University of Toronto, Toronto, ON M5S 3E1, Canada Expression in mouse , April4, 2008©2008Elsevier Inc. Low High Name Other Names Protein Domains Binding Sites Target Genes/Mouse Phenotypes/Disease Associations Amy Ceb Hip Hyp OB Eye SC BM Bo Ht SM Epd Kd Liv Lu Pan Pla Pro Sto Spl Thy Thd Te Ut Ov E6.5 E8.5 E10.5 SRp20 Sfrs3, X16 RRM, RS GCUCCUCUUC SRp20, CT/CGRP; −/− early embryonic lethal E3.5 9G8 Sfrs7 RRM, RS, C2HC Znf (GAC)n Tau, GnRH, 9G8 ASF/SF2 Sfrs1 RRM, RS RGAAGAAC HipK3, CaMKIIδ, HIV RNAs; −/− embryonic lethal, cond. KO cardiomyopathy SC35 Sfrs2 RRM, RS UGCUGUU AChE; −/− embryonic lethal, cond. KO deficient T-cell maturation, cardiomyopathy; LS SRp30c Sfrs9 RRM, RS CUGGAUU Glucocorticoid receptor SRp38 Fusip1, Nssr RRM, RS ACAAAGACAA CREB, type II and type XI collagens SRp40 Sfrs5, HRS RRM, RS AGGAGAAGGGA HipK3, PKCβ-II, Fibronectin SRp55 Sfrs6 RRM, RS GGCAGCACCUG cTnT, CD44 DOI 10.1016/j.cell.2008.03.010 SRp75 Sfrs4 RRM, RS GAAGGA FN1, E1A, CD45; overexpression enhances chondrogenic differentiation Tra2α Tra2a RRM, RS GAAARGARR GnRH; overexpression promotes RA-induced neural differentiation SR and SR-Related Proteins Tra2β Sfrs10 RRM, RS (GAA)n HipK3, SMN, Tau SRm160 Srrm1 RS, PWI AUGAAGAGGA CD44 SWAP Sfrs8 RS, SWAP ND SWAP, CD45, Tau; possible asthma susceptibility gene hnRNP A1 Hnrnpa1 RRM, RGG UAGGGA/U HipK3, SMN2, c-H-ras; rheumatoid arthritis, systemic lupus -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement. -
A Novel Resveratrol Analog: Its Cell Cycle Inhibitory, Pro-Apoptotic and Anti-Inflammatory Activities on Human Tumor Cells
A NOVEL RESVERATROL ANALOG : ITS CELL CYCLE INHIBITORY, PRO-APOPTOTIC AND ANTI-INFLAMMATORY ACTIVITIES ON HUMAN TUMOR CELLS A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Boren Lin May 2006 Dissertation written by Boren Lin B.S., Tunghai University, 1996 M.S., Kent State University, 2003 Ph. D., Kent State University, 2006 Approved by Dr. Chun-che Tsai , Chair, Doctoral Dissertation Committee Dr. Bryan R. G. Williams , Co-chair, Doctoral Dissertation Committee Dr. Johnnie W. Baker , Members, Doctoral Dissertation Committee Dr. James L. Blank , Dr. Bansidhar Datta , Dr. Gail C. Fraizer , Accepted by Dr. Robert V. Dorman , Director, School of Biomedical Sciences Dr. John R. Stalvey , Dean, College of Arts and Sciences ii TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………….………v LIST OF TABLES……………………………………………………………………….vii ACKNOWLEDGEMENTS….………………………………………………………….viii I INTRODUCTION….………………………………………………….1 Background and Significance……………………………………………………..1 Specific Aims………………………………………………………………………12 II MATERIALS AND METHODS.…………………………………………….16 Cell Culture and Compounds…….……………….…………………………….….16 MTT Cell Viability Assay………………………………………………………….16 Trypan Blue Exclusive Assay……………………………………………………...18 Flow Cytometry for Cell Cycle Analysis……………..……………....……………19 DNA Fragmentation Assay……………………………………………...…………23 Caspase-3 Activity Assay………………………………...……….….…….………24 Annexin V-FITC Staining Assay…………………………………..…...….………28 NF-kappa B p65 Activity Assay……………………………………..………….…29 -
By Submitted in Partial Satisfaction of the Requirements for Degree of in In
BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Eric Verdin Chair ______________________________________________________________________________Ajay Chawla ______________________________________________________________________________Ethan Weiss ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Vassily Kutyavin ii Dedicated to everyone who has supported me during my scientific education iii Acknowledgements I'm very grateful to my thesis adviser, Ajay Chawla, for his mentorship and support during my dissertation work over the past five years. Throughout my time in his lab, I was always able to rely on his guidance, and his enthusiasm for science was a great source of motivation. Even when he was traveling, he could easily be reached for advice by phone or e- mail. I am particularly grateful for his help with writing the manuscript, which was probably the most challenging aspect of graduate school for me. I am also very grateful to him for helping me find a postdoctoral fellowship position. Ajay's inquisitive and fearless approach to science have been a great inspiration to me. In contrast to the majority of scientists who focus narrowly on a specific topic, Ajay pursued fundamental questions across a broad range of topics and was able to make tremendous contributions. My experience in his lab instilled in me a deep appreciation for thinking about the entire organism from an evolutionary perspective and focusing on the key questions that escape the attention of the larger scientific community. As I move forward in my scientific career, there is no doubt that I will rely on him as a role model. -
Gene Expression During Normal and FSHD Myogenesis Tsumagari Et Al
Gene expression during normal and FSHD myogenesis Tsumagari et al. Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 (27 September 2011) Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 RESEARCHARTICLE Open Access Gene expression during normal and FSHD myogenesis Koji Tsumagari1, Shao-Chi Chang1, Michelle Lacey2,3, Carl Baribault2,3, Sridar V Chittur4, Janet Sowden5, Rabi Tawil5, Gregory E Crawford6 and Melanie Ehrlich1,3* Abstract Background: Facioscapulohumeral muscular dystrophy (FSHD) is a dominant disease linked to contraction of an array of tandem 3.3-kb repeats (D4Z4) at 4q35. Within each repeat unit is a gene, DUX4, that can encode a protein containing two homeodomains. A DUX4 transcript derived from the last repeat unit in a contracted array is associated with pathogenesis but it is unclear how. Methods: Using exon-based microarrays, the expression profiles of myogenic precursor cells were determined. Both undifferentiated myoblasts and myoblasts differentiated to myotubes derived from FSHD patients and controls were studied after immunocytochemical verification of the quality of the cultures. To further our understanding of FSHD and normal myogenesis, the expression profiles obtained were compared to those of 19 non-muscle cell types analyzed by identical methods. Results: Many of the ~17,000 examined genes were differentially expressed (> 2-fold, p < 0.01) in control myoblasts or myotubes vs. non-muscle cells (2185 and 3006, respectively) or in FSHD vs. control myoblasts or myotubes (295 and 797, respectively). Surprisingly, despite the morphologically normal differentiation of FSHD myoblasts to myotubes, most of the disease-related dysregulation was seen as dampening of normal myogenesis- specific expression changes, including in genes for muscle structure, mitochondrial function, stress responses, and signal transduction. -
Identification of Differentially Expressed Genes in Human Bladder Cancer Through Genome-Wide Gene Expression Profiling
521-531 24/7/06 18:28 Page 521 ONCOLOGY REPORTS 16: 521-531, 2006 521 Identification of differentially expressed genes in human bladder cancer through genome-wide gene expression profiling KAZUMORI KAWAKAMI1,3, HIDEKI ENOKIDA1, TOKUSHI TACHIWADA1, TAKENARI GOTANDA1, KENGO TSUNEYOSHI1, HIROYUKI KUBO1, KENRYU NISHIYAMA1, MASAKI TAKIGUCHI2, MASAYUKI NAKAGAWA1 and NAOHIKO SEKI3 1Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8520; Departments of 2Biochemistry and Genetics, and 3Functional Genomics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan Received February 15, 2006; Accepted April 27, 2006 Abstract. Large-scale gene expression profiling is an effective CKS2 gene not only as a potential biomarker for diagnosing, strategy for understanding the progression of bladder cancer but also for staging human BC. This is the first report (BC). The aim of this study was to identify genes that are demonstrating that CKS2 expression is strongly correlated expressed differently in the course of BC progression and to with the progression of human BC. establish new biomarkers for BC. Specimens from 21 patients with pathologically confirmed superficial (n=10) or Introduction invasive (n=11) BC and 4 normal bladder samples were studied; samples from 14 of the 21 BC samples were subjected Bladder cancer (BC) is among the 5 most common to microarray analysis. The validity of the microarray results malignancies worldwide, and the 2nd most common tumor of was verified by real-time RT-PCR. Of the 136 up-regulated the genitourinary tract and the 2nd most common cause of genes we detected, 21 were present in all 14 BCs examined death in patients with cancer of the urinary tract (1-7). -
Stroke Genetics and Genomics
Faculdade de Medicina da Universidade de Lisboa Unidade Neurológica de Investigação Clínica PhD Thesis Stroke Genetics and Genomics Tiago Krug Coelho Host Institution: Instituto Gulbenkian de Ciência Supervisor at Instituto Gulbenkian de Ciência: Doctor Sofia Oliveira Supervisor at Faculdade de Medicina da Universidade de Lisboa: Professor José Ferro PhD in Biomedical Sciences Specialization in Neurosciences 2010 Stroke Genetics and Genomics A ciência tem, de facto, um único objectivo: a verdade. Não esgota perfeitamente a sua tarefa se não descobre a causa do todo. Chiara Lubich i Stroke Genetics and Genomics ii Stroke Genetics and Genomics A impressão desta dissertação foi aprovada pela Comissão Coordenadora do Conselho Científico da Faculdade de Medicina de Lisboa em reunião de 28 de Setembro de 2010. iii Stroke Genetics and Genomics iv Stroke Genetics and Genomics As opiniões expressas são da exclusiva responsabilidade do seu autor. v Stroke Genetics and Genomics vi Stroke Genetics and Genomics Abstract ABSTRACT This project presents a comprehensive approach to the identification of new genes that influence the risk for developing stroke. Stroke is the leading cause of death in Portugal and the third leading cause of death in the developed world. It is even more disabling than lethal, and the persistent neurological impairment and physical disability caused by stroke have a very high socioeconomic cost. Moreover, the number of affected individuals is expected to increase with the current aging of the population. Stroke is a “brain attack” cutting off vital blood and oxygen to the brain cells and it is a complex disease resulting from environmental and genetic factors. -
Mouse Srsf7 Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Srsf7 Knockout Project (CRISPR/Cas9) Objective: To create a Srsf7 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Srsf7 gene (NCBI Reference Sequence: NM_146083.2 ; Ensembl: ENSMUSG00000024097 ) is located on Mouse chromosome 17. 8 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 8 (Transcript: ENSMUST00000063417). Exon 3~8 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 3 starts from about 29.41% of the coding region. Exon 3~8 covers 70.73% of the coding region. The size of effective KO region: ~3889 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 8 Legends Exon of mouse Srsf7 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats. -
Mitochondrial Genetics
Mitochondrial genetics Patrick Francis Chinnery and Gavin Hudson* Institute of Genetic Medicine, International Centre for Life, Newcastle University, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK Introduction: In the last 10 years the field of mitochondrial genetics has widened, shifting the focus from rare sporadic, metabolic disease to the effects of mitochondrial DNA (mtDNA) variation in a growing spectrum of human disease. The aim of this review is to guide the reader through some key concepts regarding mitochondria before introducing both classic and emerging mitochondrial disorders. Sources of data: In this article, a review of the current mitochondrial genetics literature was conducted using PubMed (http://www.ncbi.nlm.nih.gov/pubmed/). In addition, this review makes use of a growing number of publically available databases including MITOMAP, a human mitochondrial genome database (www.mitomap.org), the Human DNA polymerase Gamma Mutation Database (http://tools.niehs.nih.gov/polg/) and PhyloTree.org (www.phylotree.org), a repository of global mtDNA variation. Areas of agreement: The disruption in cellular energy, resulting from defects in mtDNA or defects in the nuclear-encoded genes responsible for mitochondrial maintenance, manifests in a growing number of human diseases. Areas of controversy: The exact mechanisms which govern the inheritance of mtDNA are hotly debated. Growing points: Although still in the early stages, the development of in vitro genetic manipulation could see an end to the inheritance of the most severe mtDNA disease. Keywords: mitochondria/genetics/mitochondrial DNA/mitochondrial disease/ mtDNA Accepted: April 16, 2013 Mitochondria *Correspondence address. The mitochondrion is a highly specialized organelle, present in almost all Institute of Genetic Medicine, International eukaryotic cells and principally charged with the production of cellular Centre for Life, Newcastle energy through oxidative phosphorylation (OXPHOS). -
Ultraconserved Elements Are Associated with Homeostatic Control of Splicing Regulators by Alternative Splicing and Nonsense-Mediated Decay
Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay Julie Z. Ni,1 Leslie Grate,1 John Paul Donohue,1 Christine Preston,2 Naomi Nobida,2 Georgeann O’Brien,2 Lily Shiue,1 Tyson A. Clark,3 John E. Blume,3 and Manuel Ares Jr.1,2,4 1Center for Molecular Biology of RNA and Department of Molecular, Cell, and Developmental Biology, University of California at Santa Cruz, Santa Cruz, California 95064, USA; 2Hughes Undergraduate Research Laboratory, University of California at Santa Cruz, Santa Cruz, California 95064, USA; 3Affymetrix, Inc., Santa Clara, California 95051, USA Many alternative splicing events create RNAs with premature stop codons, suggesting that alternative splicing coupled with nonsense-mediated decay (AS-NMD) may regulate gene expression post-transcriptionally. We tested this idea in mice by blocking NMD and measuring changes in isoform representation using splicing-sensitive microarrays. We found a striking class of highly conserved stop codon-containing exons whose inclusion renders the transcript sensitive to NMD. A genomic search for additional examples identified >50 such exons in genes with a variety of functions. These exons are unusually frequent in genes that encode splicing activators and are unexpectedly enriched in the so-called “ultraconserved” elements in the mammalian lineage. Further analysis show that NMD of mRNAs for splicing activators such as SR proteins is triggered by splicing activation events, whereas NMD of the mRNAs for negatively acting hnRNP proteins is triggered by splicing repression, a polarity consistent with widespread homeostatic control of splicing regulator gene expression.