Mitochondrial Genetics

Home , ATPAF1, HUPRA syndrome, MTERF1, MTFMT, MTIF2, SDHAF2

Mitochondrial genetics

Patrick Francis Chinnery and Gavin Hudson* Institute of Genetic Medicine, International Centre for Life, Newcastle University, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK

Introduction: In the last 10 years the ﬁeld of mitochondrial genetics has widened, shifting the focus from rare sporadic, metabolic disease to the effects of mitochondrial DNA (mtDNA) variation in a growing spectrum of human disease. The aim of this review is to guide the reader through some key concepts regarding mitochondria before introducing both classic and emerging mitochondrial disorders. Sources of data: In this article, a review of the current mitochondrial genetics literature was conducted using PubMed (http://www.ncbi.nlm.nih.gov/pubmed/). In addition, this review makes use of a growing number of publically available databases including MITOMAP, a human mitochondrial genome database (www.mitomap.org), the Human DNA polymerase Gamma Mutation Database (http://tools.niehs.nih.gov/polg/) and PhyloTree.org (www.phylotree.org), a repository of global mtDNA variation. Areas of agreement: The disruption in cellular energy, resulting from defects in mtDNA or defects in the nuclear-encoded genes responsible for mitochondrial maintenance, manifests in a growing number of human diseases. Areas of controversy: The exact mechanisms which govern the inheritance of mtDNA are hotly debated. Growing points: Although still in the early stages, the development of in vitro genetic manipulation could see an end to the inheritance of the most severe mtDNA disease.

Keywords: mitochondria/genetics/mitochondrial DNA/mitochondrial disease/ mtDNA

Accepted: April 16, 2013

Mitochondria

*Correspondence address. The mitochondrion is a highly specialized organelle, present in almost all Institute of Genetic Medicine, International eukaryotic cells and principally charged with the production of cellular Centre for Life, Newcastle energy through oxidative phosphorylation (OXPHOS). In addition to University, Central energy production, mitochondria are also key components in calcium sig- Parkway, Newcastle upon Tyne NE1 3BZ, UK. E-mail: nalling, regulation of cellular metabolism, haem synthesis, steroid synthe- 1 [email protected] sis and, perhaps most importantly, programmed cell death (apoptosis).

British Medical Bulletin 2013; 106: 135–159 & The Author 2013. Published by Oxford University Press. DOI:10.1093/bmb/ldt017 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. P. F. Chinnery and G. Hudson

However, the simplistic elegance of biochemical ATP production belies a, complex, synergistic relationship between two genomes: the mitochondrial genome (mtDNA) and the nuclear genome (nDNA). The aim of this review is to introduce these two genomes and shed light on the clinical problems arising when communication breaks down. The emphasis is on the basic science underpinning mitochondrial diseases. Clinical aspects are not considered in detail because they have recently been reviewed – elsewhere in open-access publications.2 4

mtDNA

MtDNA is the only source of critical cellular proteins outside of the eukaryotic nucleus. In the majority of eukaryotes, mtDNA is organizsed as a circular, double-stranded DNA molecule (Fig. 1).5 The strands are distinguished by their nucleotide composition: heavy (H-strand) is guanine rich, compared with the cytosine-rich light strand (L-strand). The length varies between species (15 000–17 000 bp), but is fairly consistent in humans (∼16 569 bp).5 MtDNA is a multi-copy DNA, with cells containing between 100 and 10 000 copies of mtDNA (dependent upon cellular energy demand).

Fig. 1 Mitochondrial DNA. Schematic diagram of the 16.6-kb, circular, double-stranded mtDNA molecule, where the outer circle represents the heavy strand and the inner circle the light strand. Shown are the genes encoding the mitochondrial RC: MTND1–6, MTCOI–II, MTATP6 and 8 and MTCYB; the two ribosomal RNAs (green boxes) and each of the 22 tRNAs (red spheres).

136 British Medical Bulletin 2013;106 Mitochondrial genetics

Structure MtDNA contains 37 genes, 28 on the H-strand and 9 on the L-strand. Thirteen of the genes encode one polypeptide component of the mitochondrial respiratory chain (RC), the site of cellular energy production through OXPHOS. Twenty-four genes encode a mature RNA product: 22 mitochondrial tRNA molecules, a 16 s rRNA (large ribosomal subunit) and a 12 s rRNA (small ribosomal subunit).5 Unlike its nDNA counterpart, mtDNA is extremely efficient with ∼93% representing a coding region. Unlike nDNA, mtDNA genes lack intronic regions and some genes, notably MTATP6 and MTATP8, have overlapping regions. Most genes are contiguous, separated by one or two non-coding base pairs. mtDNA contains only one significant non-coding region, the dis- placement loop (D-loop).5 The D-loop contains the site of mtDNA replication initiation (origin of heavy strand synthesis, OH) and is also the site of both H-strand transcription promoters (HSP1 and HSP2). The mitochondrial genetic code differs slightly from nuclear DNA (nDNA). MtDNA uses only two stop codons: ‘AGA’ and ‘AGG’6 (compared with ‘UAA’, ‘UGA’ and ‘UAG’ in nDNA), conversely ‘UGA’ encodes tryptophan. To compensate UAA codons have to be introduced at the post-transcriptional level. In addition ‘AUA’, isoleucine in nDNA, encodes for methionine in mtDNA.

Inheritance Prevailing theory suggests that mtDNA is maternally inherited, with mtDNA nucleoids the unit of inheritance. During mammalian zygote formation, sperm mtDNA is removed by ubiquitination, likely occurring during transport through the male reproductive tract.7 Consequently, the mtDNA content of the zygote is determined exclusively by the previously unfertilized egg. To date only a single case of paternal transmission in humans has been recorded.8 However, paternal transmission in other animals is both common and recurring. Theory suggests that the lack of paternal inheritance is due to either (i) a dilution effect; sperm contain only 100 copies of mtDNA, compared with 100 000 in the unfertilized egg, (ii) selective ubiquitination of paternal mtDNA or (iii) the ‘mtDNA bottleneck’ excludes the ‘minor’ paternal alleles.7 The advent of deep, next generation sequencing, allowing mtDNA can be sequenced at great depths (>20 000 fold) may enable researchers to revisit this phenomenon.

Homoplasmy and heteroplasmy Cells contain thousands of molecules of mtDNA;9 and in the majority of cases their sequence is identical, known as homoplasmy. However, an

British Medical Bulletin 2013;106 137 P. F. Chinnery and G. Hudson

inefficient mtDNA repair, a localized oxidative environment and increased replication10 make mtDNA mutation frequent. The polyploid nature of mtDNA means that mutations often co-exist with their wild- type counterpart in various proportions (termed heteroplasmy). The proportion of mutant has important consequences in understanding mitochondrial disease (discussed later).11 nDNA and mitochondrial function

According to recent data the mitochondrial proteome is estimated at ∼1500 proteins.12 Mitochondria are dependent upon the nuclear genome for the majority of the OXPHOS system and also for maintaining and replicating mtDNA as well as organelle network proliferation and destruction (Fig. 2).

OXPHOS system To date, 92 structural OXPHOS subunit genes have been identified: 13 encoded by mtDNA (Fig. 1) and 79 encoded by the nuclear genome. Briefly, complex I (NADH:ubiquinone oxidoreductase), the largest of the RC components, consists of 44 subunits: 14 enzymatic ‘core subunits’ (7 from mtDNA and 7 from nDNA)13 and a further 30 nDNA accessory subunits thought to maintain complex stability.14 Complex II (succinate:

Fig. 2 Interaction between nDNA and mtDNA. Cartoon demonstrating the complex interaction between genes encoded by nDNA and the processes they control in the mitochondrion.

138 British Medical Bulletin 2013;106 Mitochondrial genetics

ubiquinone oxidoreductase) is encoded entirely by nDNA (four subunits). Complex III (ubiquinol:cytochrome c oxidoreductase) contains 11 subunits, 1 encoded by mtDNA (MTCYB) and 10 encoded by nDNA.15 Complex IV (cytochrome c oxidase) consists of three mtDNA-encoded subunits and a further 11 nDNA-encoded subunits. Finally, complex V (F0F1-ATP synthase) comprises 19 subunits, 2 encoded by mtDNA and the remaining 17 encoded by nDNA. In addition, nDNA encodes over 35 proteins required for the RC assembly: complex I = 11 nDNA assembly factors,16 complex III = 2,15 complex IV = 1817 and complex V = 4.18 mtDNA replication Unlike nDNA, mtDNA replication is not governed by the cell cycle (eukaryotic cell division) and is continuously recycled. MtDNA replication and integrity maintenance is handled entirely by the nDNA. In eukaryotes, mtDNA is replicated in a ‘replisome’ (a DNA/protein complex making up the replication machinery) by a trimeric protein complex composed of a catalytic subunit: polymerase gamma, a 140 kDa DNA polymerase encoded by POLG and two 55 kDa accessory subunits, encoded by POLG2.19 This enzyme complex performs three activities, DNA polymerase activity, 30-50 exonuclease/proofreading activity and a 50dRP lyase activity (required for enzymatic DNA repair). In addition, the replisome also includes the mitochondrial single- stranded binding protein (encoded by mtSSB), which is involved in stabilizing single-stranded regions of mtDNA at replication forks, enhancing polymerase gamma activity. Twinkle is a 50-30 DNA helicase, which unwinds double-stranded mtDNA, facilitating mtDNA synthesis, as well as acting as a mtDNA primase (an enzyme required to prime nucleotide synthesis).19 Several topoisomerases have been indentified in humans, including the mitochondrial topoisomerases 1 (encoded by TOP1mt) and IIIα (encoded by TOP3a). Finally, the synergy between mitochondrial transcription factor A (encoded by TFAM) and mtDNA copy number suggests that TFAM may act as an mtDNA chaperone (a protein that assists the function of another protein) protecting it against oxidative damage. mtDNA arrangement Like its nDNA counterpart, mtDNA is also packaged in protein–DNA complexes, known as nucleoids.20 MtDNA nucleoids are associated with the inner mitochondrial membrane, spaced evenly along the cristae. In addition to a single mtDNA molecule,21 mtDNA nucleoids contain a number of proteins.20 Principally the site of mtDNA replication, it is

British Medical Bulletin 2013;106 139 P. F. Chinnery and G. Hudson

unsurprising that mtDNA nucleoids contain the protein machinery required for DNA replication, transcription, repair and packaging, including the mtDNA polymerase POLG, its accessory subunit POLG2, the activator of mtDNA transcription (encoded by TFAM) as well as mtDNA helicases and binding proteins (twinkle and mtSSB, respectively).20 In addition, mtDNA nucleoids contain chaperone proteins (HSP90-β and HSP70) required for mtDNA stability.

Transcription and translation Transcription of mtDNA is ‘prokaryotic like’ and was thought of a two- component system involving a protein complex containing the mitochondrial RNA polymerase (POLRMT) and two transcription factors (TFB1M and 2M).22,23 However, recent research indicates that TFB1M does not modulate mtDNA transcription in the presence of TFB2M, rather it acts as a dimethyltransferase which stabilizes the small subunit of the mitochondrial ribosome. RNA transcription is regulated by mitochondrial transcription factor A (TFAM).24 Briefly, each strand is transcribed as a polycistronic precursor mRNA molecule (i.e. the mRNA contains all of the genes in one molecule). Light-strand transcription is initiated from the light-strand promoter; however, heavy-strand transcription initiates from two heavy strand promoters: HSP1 and HSP2 (Fig. 1).25 Transcript elongation is performed by POLRMT, enhanced by both ‘transcription elongation factor mitochondrial’ (TEFM) and termination of mature transcripts is carried out by mitochondrial termination factor 1 (MTERF1).25 Translation of the 13 mtDNA protein coding genes occurs in the mitochondria. The mitoribosomes are partly coded by mtDNA (MTRNR1 and MTRNR2, Fig. 1), but require a further 81 nDNA proteins. Translation is initiated by two mitochondrial initiation factors: mtIF1 and mtIF3.26,27 mtIF3 begins initiation by dissociating the ‘mitoribosome’ (the mitochondrial ribosomes) allowing assembly of the initiation complex.28 MRNA is then bound to the small subunit, aligning the start codon to the peptidyl site of the mitoribosome. Peptide elongation is controlled by a number of nuclear-encoded genes, including mitochondrial elongation factor Tu (mtEFTu),29,30 which binds the tRNA to the mitoribosome and mitochondrial elongation factor G1 (mtEFG1), required to move the newly added amino acid along one position and allowing amino acid inclusion.31 Translation termination is carried out solely by mitochondrial release factor 1a (mtRF1a),32 which recognizes the stop codons (UAA and UAG)33 and triggers hydrolysis of the bond between the terminal tRNA and the nascent peptide.

140 British Medical Bulletin 2013;106 Mitochondrial genetics

Controlling mitochondrial network dynamics Mitochondria are often depicted as distinct organelles; however, they actually form a complex reticulum that is undergoing continual fusion and fission (Fig. 2).34 It is likely that fusion has evolved as a mechanism to promote intermictochondrial cooperation—allowing the sharing and dis- semination of mtDNA and mitochondrial proteins. Fission promotes mitochondrial compartmentalization,34 a mechanism that is needed to distribute mitochondria during cell division. Mitochondrial network dynamics, much like mtDNA replication, is controlled completely by nDNA, although likely involves mtDNA–nDNA communication.34

Mitochondrial fusion The principle player in mitochondrial fusion is mitofusin (Mfn) and mammalian mitochondria contain two similar mitofusin proteins: Mfn1 and Mfn2 (Fig. 2),34 sharing 80% sequence homology. Studies indicate that both Mfn1 and Mfn2 uniformly localize to the mitochondrial outer membrane and overexpression leads to peri-nuclear clustering on mitochondria.34 Mitochondrial fusion is also dependent upon OPA1 expression (Fig. 2),34 where inhibition of gene expression causes an increase in mitochondrial fragmentation, conversely the overexpression of OPA1 breaks the network into spheres.

Mitochondrial fission DNM1L, dynamin 1 like, controls mitochondrial fission in mammalian cells (Fig. 2).34 DNM1L codes for a principally cytosolic protein; however, it also localizes to fission sites on the mitochondria. Similar to Mfn1, the overexpression of ‘mutant’ DNM1L results in a breakdown of mitochondrial networks. Due to its dynamin similarity, two different functions have been proposed for DNM1L. It has been hypothesized that DNM1L may mechanically mediate membrane fission through GTP hydrolysis; alternatively, it may act as a signalling molecule, conscripting and activating separate fission enzymes such as Dnm1: the yeast homologue of Drp1.

Areas of agreement

Mitochondrial disease An area where all mitochondrial researchers would agree is the capacity for mitochondrial dysfunction to manifest as disease. Mitochondrial disease is principally a chronic loss of cellular energy, where a failure to meet cellular energy demand results in a clinical phenotype. The clinical

British Medical Bulletin 2013;106 141 P. F. Chinnery and G. Hudson

spectrum of mitochondrial disease is diverse (Fig. 3); however, tissues where there is a high metabolic demand, such as the central nervous system (CNS) or heart, are typically affected. The broad clinical spectrum of mitochondrial dysfunction, coupled with the heterogeneity of mtDNA variation, makes the prevalence of mitochondrial DNA (mtDNA) difficult to calculate. Estimates, based on clinical observations, indicate that as many as 1 in 5000 people in the North East of England have manifested mitochondrial disease,35 with – similar figures reported in other parts of the world.36 38

Identifying and diagnosing mitochondrial genetic disease: general principles Mitochondrial dysfunction should be considered in the differential diagnosis of any progressive, multisystem, disorder. However, clinical diagnosis can be difficult if patients do not present with ‘classical mitochondrial’ disease (see later). A detailed family history is important; a clear maternal inheritance (without male transmission) indicates a primary mtDNA defect, whilst an autosomal inheritance pattern is indicative of nDNA interaction. In many

Fig. 3 Clinical spectrum of mitochondrial disease. Schematic diagram showing the organ and corresponding disease affected by mitochondrial dysfunction.

142 British Medical Bulletin 2013;106 Mitochondrial genetics

cases blood and/or CSF lactate concentration,39 neuroimaging,40,41 cardiac evaluation and muscle biopsy for histological or histochemical evidence can indicate mitochondrial disease. However, establishing a molecular genetic diagnosis is preferred. Molecular genetic testing can be carried out on DNA extracted from blood (useful for the identification of some mtDNA and nDNA mutations),42,43 but DNA extracted from the affected tissue is preferred (as pathogenic mtDNA mutations are often not detectable in blood).44 Southern blot analysis can be used to identify mtDNA rearrangements and ‘common’ mutations can be targeted by Sanger sequencing of either mtDNA or nDNA.

The genetics of mitochondrial disease

The complex interaction between the two cellular genomes means mitochondrial disease can arise through either (i) a primary mtDNA defect or (ii) a defect in a nuclear-encoded mitochondrial protein. mtDNA and disease Understanding mtDNA variation mtDNA integrity is constantly attacked by mitochondrial reactive oxygen species (ROS) generated during cellular OXPHOS.45 ROS are potent genotoxic agents, which cause mutagenic and cytotoxic effects. The prox- imity of mtDNA to the site of mitochondrial ROS production (principally complexes I and III of the RC) is the major cause of oxidative lesions and mtDNA instability and is directly responsible for the higher nucleotide instability when compared with nDNA. Despite being packaged in mitochondrial nucleoids and possessing DNA repair pathways evolved to cope with oxidative damage, including base ex- cision repair mechanisms,46 mtDNA mutation rates are significantly higher than nDNA. Mutation creates two distinct classes of mtDNA variant: (i) single-base-pair variants and (ii) mtDNA rearrangements (deletions and insertions). Single-base-pair variants are typically inheritable and are either common in the populace (as proposed neutral variants) or enriched in individuals with disease (as mtDNA mutations). Understanding the complex nature of mtDNA variation is critical to understanding its affect on disease and there are a few key points that must be understood before assessing an mtDNA variant.

Consequences of mtDNA heteroplasmy MtDNA heteroplasmy (described earlier) has a complex relationship with disease. The clinical expression of a heteroplasmic pathogenic

British Medical Bulletin 2013;106 143 P. F. Chinnery and G. Hudson

mtDNA mutation is directly correlatable with the relative proportion of wild-type and mutant genomes.47 For common point mutations, a typical threshold of 80–90% mutant is required to manifest as disease at the cellular level,48,49 and tissue levels correlate loosely with the severity of the clinical phenotype. However, there is emerging evidence that mutation levels can change over time, increasing in post-mitotic tissues, such as brain and muscle and decreasing in mitotic tissues including blood. This can present a challenge when interpreting some clinical molecular genetic tests.44,50,51

Common mtDNA variation Evolutionarily, common inherited mtDNA mutations have created stable population subgroups separated by common sequence variation known as haplogroups. Many of the major sub-divisions occurred over 10 000 years ago, developing as humans migrated into new geographic areas. Over 95% of Europeans belong to 1 of 10 major haplogroups, H, J, T, U, K (a subgroup of U), M, I, V, W and X, with each haplogroup defined by specific sequence variants within the population.52 These common, inherited, mtDNA variants are usually not heteroplasmic, and due to their selection neutrality have become fixed in the population. However, different haplogroups have been associated with a variety of human diseases, including primary mitochondrial disorders such as Leber’s hereditary optic neuropathy (LHON, an age-related loss of vision), where background mitochondrial haplogroup has a direct, functional, effect on the RC protein complex assembly;53 but has expanded to include age-related neurodegenerative disorders such as Parkinson’s disease (PD)54 Alzheimer’s disease55,56 and age-related macular degeneration.57

Rare mtDNA variation Rare, inherited, point mutations are a major cause of disease in humans, with an estimated incidence of 1 in 5000.58 They primarily occur in protein coding and tRNA genes and ultimately result in a reduction of cellular energy, through either a reduction in mitochondrial RC enzyme activity or an impairment of mitochondrial protein synthesis.59 Unlike common inherited variants, rare point mutations are often heteroplasmic. In contrast to point mutations, primary mitochondrial rearrangements of mtDNA are not inheritable; they are primarily, sporadic, large-scale deletions, typically heteroplasmic and usually result in disease. To date around 120 different mtDNA deletions have been identified in patients with mitochondrial disease.60 Similarly to mtDNA point mutations, the ratio of deleted versus ‘wild-type’ molecules is critical to disease aetiology, with mtDNA deletions manifesting disease at a lower heteroplasmic threshold (∼50–60%).61 The exact mechanism of deletion formation is under debate and current research indicates two likely

144 British Medical Bulletin 2013;106 Mitochondrial genetics

models of deletion formation: (i) replication error and (ii) mtDNA repair inefficiency.62,63

‘Classical’ mtDNA diseases LHON is a common cause of inherited blindness that typically presents with bilateral, painless, sub-acute visual failure in young adult males. LHON was the first maternally inherited disease to be associated with an mtDNA point mutation.64 Today, clinical diagnosis is usually confirmed by molecular genetic analysis for one of three ‘common’ mtDNA mutations, which all affect genes coding for complex I subunits of the RC: m.3460G>A, m.11778G>A and m14484T>C.65 Mitochondrial dysfunction causes a specific loss of retinal ganglion cells,66 whilst preserving the remaining retinal layers. The optic nerve also shows characteristic degeneration and an accumulation of mitochondria suggesting an impairment of axoplasmic transport. LHON mutations are typically homoplasmic; however, not all patients harbouring a pathogenic LHON mtDNA mutation develop visual failure. Studies of LHON have identified common mtDNA variants that may modulate LHON expression;67,68 additionally environmental factors, such as cigarette smoke69 and oestrogen levels may play a role.70 However, the majority of research has focused on the – identification of a nuclear-encoded susceptibility allele.67,71 74 Non-syndromic and aminoglycoside-induced sensorineuronal hearing loss is associated with m.1555A>G, a homoplasmic point mutation in the 12sRNA gene.75 The variant alters a highly conserved region of 12sRNA, mutating the molecule to more closely resemble its bacterial homologue. In vitro experiments on m.1555A>G mutant cell lines demonstrated that exposure to aminoglycoside would impair growth; however, not all symptomatic individuals have been exposed to aminoglycoside.75 Surprisingly, given that they make up only 5% of mtDNA, the vast majority of pathogenic mtDNA point mutations occur in the tRNA genes (Fig. 1).76,77 In addition, pathogenic tRNA mutations are typically heteroplasmic. Mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS) is typically a childhood, multisystem disorder. Patients commonly manifest with generalized tonic-clonic seizures, recurrent headaches, anorexia with recurrent vomiting and postlingual hearing – loss,78 80 but can manifest with impaired: motor ability, vision and mental acuity due to the cumulative effect of multiple stroke-like episodes. MELAS is commonly (80% of cases) caused by a A>G transition at m.3243 in MTTL1,81 but is also associated with variants in MTND5.82 Biochemically, MELAS manifests as defects of complex I and IV activity; however, care must be taken when interpreting the findings as biochemical results can often appear normal.

British Medical Bulletin 2013;106 145 P. F. Chinnery and G. Hudson

Myoclonus epilepsy with ragged red fibres (MERRF) is a neuromuscular disorder primarily caused by m.8344A>G in MTTK.83 Clinically, patients with m.8344A>G present with myoclonus, epilepsy, muscle weakness, cerebellar ataxia and dementia, although neurological symptoms can develop with age.83 Clinical severity is correlated with patient heteroplasmy with high levels of mutant mtDNA often causing, severe complex I or IV deficiency and occasionally a combined complex I and IV deficiency. Much like MELAS, the genotype–phenotype correlation of m.8344A>G can be extended beyond MERRF. M.8344A>G has been identified is diverse mitochondrial phenotypes such as Leigh’s syndrome. m.7472insC, affecting MTTS (Fig. 1), was first identified in a large Italian family presenting with hearing loss, ataxia and myoclonus. This mutation was later found in several unrelated families, all showing a wide clinical spectrum, including isolated hearing loss, ataxia and MERRF. This mutation has been found at increasing frequencies in families presenting with maternally inherited hearing loss. Pathogenic rearrangements of mtDNA are typically large-scale deletions and to date over 120 different pathogenic mtDNA deletions have been identified.60 As described previously, mtDNA deletions are typically sporadic and not inheritable. Clinical severity is directly correlatable with the level and tissue distribution of the rearrangement and mitochondrial dysfunction is simply a result of the removal of key mitochondrial genes. Homoplasmic tRNA gene loss is particularly detrimental as mitochondria cannot synthesize a functional OXPHOS system. mtDNA deletions are associated with three main clinical phenotypes: Kearns–Sayre syndrome (KSS),84 sporadic progressive external ophthalmoplegia (PEO)85 and Pearson’s syndrome.86 KSS is an early onset, sporadic, disorder characterized by PEO and pigmentary retinopathy; however, cases can also present with cerebellar syndrome, heart block, diabetes and shortness of stature. Mitochondrial dysfunction manifests as ragged red fibres (RRFs), an accumulation of dysfunctional mitochondria in the sub-sarcolemmal region of a muscle fibre (detectable when a muscle section is stained with Gomori trichrome stain).85 Large-scale deletions and duplications of mtDNA are a known cause of Pearson’s bone-marrow–pancreas syndrome, a rare infant disorder characterized by infantile sideroblastic anaemia and occasionally including severe exocrine pancreatic insufficiency.86

nDNA variation and mitochondrial disease Nuclear–mitochondrial disease can be classified into four distinct groups: (i) disorders resulting from a reduction in mtDNA stability; (ii) disorders

146 British Medical Bulletin 2013;106 Mitochondrial genetics

resulting from mutations in nuclear-encoded components or assembly factors of the OXPHOS system; (iii) disorders resulting from mutations affecting mitochondrial translation and (iv) disorders due to defects in genes controlling mitochondrial network dynamics.

Disorders resulting from a reduction in mtDNA stability A growing number of disorders have become associated with mtDNA instability, primarily a result of impaired mtDNA replication. Mutations in POLG, the gene encoding the only mtDNA polymerase, are by far the commonest cause of mtDNA stability disorders. Mutations in the POLG gene can cause either point mutations (through impaired mtDNA proofreading) or deletions (through impaired polymerase activity) in mtDNA.19 The first pathogenic mutations in POLG were identified in families with autosomal dominant PEO (adPEO); however, the spectrum of disease associated with POLG mutations has been expanded to include autosomal recessive PEO, adult onset ataxia, Alpers’ syndrome, parkinsonism and premature ovarian failure.87 adPEO, characterized by multiple mtDNA deletions, is caused by mutations in PEO1, which encodes ‘twinkle’ the putative mitochondrial helicase.88 It is thought that twinkle mutations result in an accumulation of replication intermediates, causing replication stalling and eventually depletion. adPEO is also associated with mutations in ANT1,89 the gene coding adenine nucleotide translocase. Mutations in ANT1 impair ADP– ATP exchange through the mitochondrial membrane, causing a nucleotide imbalance (affecting replication) and a severe reduction in cellular energy. In addition to structurally altering mtDNA, several disorders have been identified that are caused by a reduction in mtDNA copy number.19 Alpers syndrome, characterized by diffuse and progressive cerebral atrophy,90 has been associated with mutations in POLG,91,92 which cause impairment of the replicative machinery.93 Recessive mutations in thymidine phosphorylase cause mitochondrial neurogastrointestinal encephalopathy, characterized by mtDNA depletion, multiple deletions and point mutations. mtDNA depletion has also been identified in early onset hypotonia with myopathy and hepatic involvement, caused by mutations in either thymidine kinase (TK2)or deoxyguanosine kinase (DGUOK).94 Mutations in both of these genes cause a reduction in the mtDNA nucleotide pooling, reducing replication efficiency.

Disorders resulting from mutations in nuclear-encoded components or assembly factors of the OXPHOS system Isolated complex I deficiency is by far the commonest biochemical defect found in mitochondrial disorders; however, it is also the most complex

British Medical Bulletin 2013;106 147 P. F. Chinnery and G. Hudson

aetiology and clinical spectrum.95 Complex I deficiency is associated with a broad range of clinical phenotypes ranging from lethal neonatal disease to adult onset neurodegenerative disorders.96,97 A high level of genetic heterogeneity, coupled with weak genotype–phenotype correlations, makes it difficult to predict the genetic basis on pure clinical grounds.95 This is important because of the different inheritance patterns and different natural histories of the different genetic causes. However, some patterns are starting to emerge. There are at least 46 nuclear-encoded subunits of complex I (compared with 7 mtDNA encoded subunits) and so it is unsurprising that nDNA mutations have been identified in 14 of the structural subunits. Pathogenic mutations in NDUFS1,98 NDUFS3,95,99 NDUFS4,100 NDUFS7,101 NDUFS8,102 NDUFV1,98,103 NDUFA10,104 NDUFB395 and NDUFA2105 typically manifest as Leigh or Leigh-like syndromes.60,106 Conversely, mutations in NDUFS2,107 NDUFS6,108 NDUFV2,109 NDUFA1, NDUFA11110 and ACAD9111 are typically associated with hypertrophic cardiomyopathy and encephalopathy. In addition, mutations in complex I assembly proteins can manifest as disease: Leigh syndrome (NDUFAF2 and NDUFAF5),112,113 encephalopathy (NDUFAF4)114 and cardioencephalomyopathy (NDUFAF1).115 Complex II is completely encoded by nDNA and is composed of four polypeptide subunits: SHD-A,-B,-C and -D. Mutations in SHD-A are rare, but are associated with Leigh’s syndrome. Surprisingly, mutations in SHD-B,-C and -D appear to be a common cause of inherited paragaglio- mas and phaeochromocytomas.116 Complex III deficiency typically causes a severe multisystem early onset disorder, which is recessively inherited and rare.117,118 identified mutations in BCS1l, a complex III assembly protein, presenting with neonatal proximal tubulopathy, hepatic involvement and encephalopathy. Subsequently, a deletion in human ubiquinone–cytochrome c reductase binding protein of complex III (UQCRB) was identified in a consanguineous family presenting with hypoglycaemia and lactic acidosis;119 and a missense mutation was identified in UQCRC, a ubiquinone-binding protein, in a large consanguineous Israeli-Bedoiun kindred.120 More recently, a mutation in TTC19 (a complex III structural subunit gene) was identified in individuals with a progressive neurodegenerative disorder in late infancy,121 expanding the phenotype of complex mutations beyond early infant disorders. Mutations in complex IV result in severe, typically fatal, infantile disease and to date mutations in four complex IV structural subunits have been identified. A homozygous mutation in COX6BI, identified in brothers from a consanguineous Saudi Arabian family, presented with gait instabil- ities visual disturbances, progressive neurological deterioration and leuko- dystrophic brain changes.122 Mutations in COX10,ahomologueofyeast haem A:farneslytransferase, are associated with Leigh syndrome123,124 and

148 British Medical Bulletin 2013;106 Mitochondrial genetics

a multisystem disorder.123 Atypically, mutations in COX7B125 are associated with facial dysmorphisms and congenital abnormalities,126 and a single mutation in the structural subunit gene, COX4I2, was identified in adult Arab Muslim patients with exocrine pancreatic insufficiency, dysery- thropoietic anaemia and calvarial hyperostosis.127 In contrast, a number of mutations have been identified in complex IV assembly factors. Complex IV assembly gene disorders include SURF1 (Surfeit locus protein 1), associated with Leigh Syndrome;128,129 C12ORF62 (chromosome 12 open reading frame 62), associated with fatal, neonatal, mitochondrial IV deficiency;130 COA5 (cytochrome c oxidase assembly factor 5), associated with neonatal hypertrophic cardio- myopathy131 and FASTKD2, associated with cytochrome c oxidase- defective encephalomyopathy.132 Mutations in nDNA-encoded complex V subunit genes also appear very rare. A mutation in ATP5E (ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit) was identified in an Austrian woman with complex V deficiency,133 and a single gene defect has been identified in the complex V assembly factor gene ATPAF2, resulting in impaired complex V activity.134

Disorders resulting from mutations affecting mitochondrial translation Several nDNA mutations have been identified which influence the efficiency of mitochondrial translation. Mitochondrial ribosomal protein S16 (MRPS16) and mitochondrial ribosomal protein S22 (MRPS22)are components of the mitoribosome. Mutations in these genes are known to cause severe, infantile, lactic acidosis, developmental defects in the brain, and facial dysmorphisms (MRPS16) and fatal neonatal hypertrophic cardiomyopathy and kidney tubulopathy (MRPS22).135 Mutations in PUS1, peudorine synthase 1, have been shown to cause myopathy, lactic acidosis and sideroblastic anaemia.136 The mutation, in the catalytic core of the protein, is thought to disrupt the conversion of uridine to pseudouridine, required for tRNA synthesis.

Disorders due to defects in genes controlling mitochondrial network dynamics Mutations in OPA1 are primarily a cause of optic atrophy,66 but additional phenotypes, such as deafness and neuromuscular disease, have also been seen. Interestingly, mutations in OPA1 also appear to cause the formation of mtDNA deletions, indicating that Opa1 is also important to mtDNA maintenance. Much like OPA1, defects in MFN2 cause a disturbance of mtDNA maintenance through impairment of mitochondrial network dynamics.66 Mutations in MFN2 are typically associated with Charcot-Marie-Tooth

British Medical Bulletin 2013;106 149 P. F. Chinnery and G. Hudson

disease (CMT2A) and hereditary motor and sensory neuropathy (CMT with HMSN type VI).66 DNM1L (dynamin 1-like), another GTPase, is required for fission of mitochondria.137 To date, only a single DNM1L has been identified in an infant presenting with both defective mitochondrial and peroxisomal fission.138 The patient presented in the first days of life with severe microcephaly, abnormal brain development, optic atrophy with hyperplasia and lactic acidemia.138

Areas of controversy?

The mitochondrial bottleneck Mutations in mtDNA are often heteroplasmic, with severity correlating with increasing percentage of mutant. Observations indicate that the amount of a variant inherited from a heteroplasmic mother varies between offspring.139,140 This is important when investigating disease aetiology, as an asymptomatic mother, with a sub-clinical heteroplasmy level, can give birth to children with significantly higher levels of an mtDNA mutation. The ‘mitochondrial bottleneck theory’ attempts to explain this phenomenon.140 Briefly, the reduction of mtDNA during early development ‘redistributes’ mtDNA to daughter cells (effectively sharing mtDNA content amongst daughter cells). Oocyte maturation is associated with the rapid replication of mtDNA. This reduction-amplification leads to a purportedly random shift in mtDNA mutational load between cells. Researchers agree that the bottleneck is due to a rapid reduction in mtDNA levels during embryonic development; however, the exact mechanism of segregation is hotly debated. There are currently three leading theories of the mtDNA bottleneck mechanism:140 (i) variation in heteroplasmy is due to an unequal segregation of mtDNA during cell division, (ii) variation in heteroplasmy is due to an unequal segregation of mtDNA nucleoids during cell division and (iii) variation in heteroplasmy is due to the selective replication of a specific sub-population of mtDNA.

Growing points

Assigning variant causality Optimal mitochondrial function requires the synergistic cooperation of both mtDNA and nDNA; hence, the investigation of dysfunction requires the interrogation of both genomes. Correctly determining the pathogenicity of potential mutants (in either genome) is critical to understanding

150 British Medical Bulletin 2013;106 Mitochondrial genetics

mitochondrial disease. This underpins the genetic counselling and subsequent prenatal diagnosis of mitochondrial disorders. Despite the complexity of both mtDNA point mutations and deletions, as well as the potential for heteroplasmy, assigning pathogenicity to mtDNA variants is analogous to nDNA mutations and is comprehensive- ly described by DiMauro and Schon.141 Briefly, the mutation must be present in cases significantly more than asymptomatic controls; if heteroplasmic, the proportion of mutated mtDNA must be higher in patients compared with controls (and subsequently higher in clinically affected tissues compared with unaffected tissues). More importantly, the mutated mtDNA must segregate with defined clinical outcome (described previously). Other criteria, such as evolutionary conservation must be inter- preted with care, as very rare neutral variants (so-called ‘private polymorphisms’) or homoplasmic changes (such as in LHON) may be wrongly miss-classified using this approach.141 Assigning pathogenicity to tRNA mutations is slightly more challenging; tRNA variants are common; however, a small number of tRNA mutations are responsible for a disproportionate majority of mitochondrial disease.77 McFarland et al.77 provide a comprehensive scoring system which can be used to accurately determine tRNA mutation pathogenicity. Whole-exome sequencing (WES)142 has emerged as the preferred method for identifying Mendelian disease genes, and is proving valuable in the diagnostic evaluation of phenotypically and genetically heterogeneous disorders such as mitochondrial disease.95,143 Initially, candidate mutations can be identified by prioritizing known mitochondrial genes, such as the 1500 proposed in ‘MitoCarta’144 or Mitop2.145 Secondly, WES can drive the discovery of novel mitochondrial disease genes or provide a link to previous disease genes that demonstrate an overlapping – clinical phenotype.146 151 However, as with all new technologies, care must be taken when interpreting WES data in novel disease genes. Variants identified in poorly characterized genes will require extensive biochemical and functional laboratory analysis to assign causality. Additionally, WES is not wholly comprehensive, not capturing non- coding or regulatory regions and often failing to sequence large portions of the exome.142,152 However, as technology improves and bioinformatic analysis becomes streamlined, WES is likely to become a major facet in indentifying nuclear genes that affect mitochondrial function.

Managing mitochondrial disease There are limited treatment options for patients with mitochondrial diseases. The main emphasis is on disease prevention and the management of complications. Effective genetic counselling, especially given a

British Medical Bulletin 2013;106 151 P. F. Chinnery and G. Hudson

family history of mitochondrial disease, is crucial. However, the clinical variability, coupled with the unpredictable inheritance of a heteroplasmic ‘mutant dose’ (through the bottleneck), makes a definite diagnosis difficult.153,154 Empiric recurrence risks are available for common homoplasmic mutations (i.e. for LHON), but genetic counselling for heteroplasmic mutations is difficult because of the genetic bottleneck (described earlier). Increased knowledge of the natural history of specific mitochondrial disorders has informed clinical practice. Particular attention to cardiac, ophthalmological and endocrine complications (especially diabetes), can lead to prompt supportive management.155 However, there are no specific disease- modifying treatments at present, although some drugs show promise.156 An area that has had some in vitro and pre-clinical success is the development of ‘gene therapies’.157 There are currently three strategies for applying gene therapy to mitochondrial disease: (i) the rescue of an RC defect by expression of a ‘replacement’ gene product from the nucleus (so-called allotopic and xenotpoic expression,158,159 (ii) the rescue of a primary mitochondrial defect by importing ‘wild-type’ mtDNA into mitochondria (so-called mtDNA transfection) and (iii) manipulation of the heteroplasmic mtDNA balance (i.e. adjusting the wild-type:mutant type ratio), which can be achieved by improving a patients exercise regime.160 More recently, and although in very early stages, allogenic haematopoietic stem cell therapy has been successfully used to treat mitochondrial neurogastrointestinal encephalomyopathy, but associated with high mor- tality.161 Similarly, liver transplants in patients (typically children) suffering from MPV17-associated hepatocerebral mitochondrial depletion syndrome have a poor prognosis.162 Pre-implantation genetic diagnosis can assist female heteroplasmic mtDNA mutation carriers in determining the risk to their offspring, assisting by preventing transmission of deleterious mtDNA.163,164 Briefly, embryos obtained after in vitro fertilization are analysed and only those with very low-level mutant levels are transferred to the uterus. However, these techniques are of little help to woman harbouring intermediate-level heteroplasmic mtDNA mutations, where uncertainty regarding the clinical mutation threshold remains.163 Advances, harnessing ‘pro-nuclear transfer’, have made significant steps towards treating primary mitochondrial disease at a mtDNA level.165 Briefly, the technique involves the transfer of nDNA from a donor zygote (from the mtDNA mutation carrier mother) to an enucleated recipient zygote via fusion. The new ‘reconstructed zygote’ retains the nDNA from the mother, but the mtDNA from a donor. More recently, a competing group has attempted a similar technique, utilizing ‘spindle transfer’ of nDNA to an enucleated donor.166 Unlike pro-nuclear transfer, nDNA isolation occurs pre-fertilization, meaning once the technique is approved it

152 British Medical Bulletin 2013;106 Mitochondrial genetics

can be integrated into established in vitro fertilization techniques. However, caution is advised, as both pro-nuclear transfer and spindle transfer would only benefit a minority of female mtDNA mutation carriers, whereas prenatal diagnostic testing can be utilized for both all Mendelian mitochondrial disorders and the majority of mtDNA mutations.163,167

Funding

Funding to pay the Open Access publication charges for this article was provided by The Wellcome Trust.

References

1 van der Giezen M, Tovar J. Degenerate mitochondria. EMBO Rep 2005;6:525–30. 2 Schon EA, DiMauro S, Hirano M. Human mitochondrial DNA: roles of inherited and somatic mutations. Nat Rev Genet 2012;13:878–90. 3 Schapira AH. Mitochondrial diseases. Lancet 2012;379:1825–34. 4 Koopman WJ, Distelmaier F, Smeitink JA et al. OXPHOS mutations and neurodegeneration. EMBO J 2013;32:9–29. 5 Andrews RM, Kubacka I, Chinnery PF et al. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet 1999;23:147. 6 Temperley R, Richter R, Dennerlein S et al. Hungry codons promote frameshifting in human mitochondrial ribosomes. Science 2010;327:301. 7 Sutovsky P. Ubiquitin-dependent proteolysis in mammalian spermatogenesis, fertilization, and sperm quality control: killing three birds with one stone. Microsc Res Tech 2003;61:88–102. 8 Vissing JSaM. Paternal Inheritance if mitochondrial DNA. N Engl J Med 2002;2081–2. 9 Miller FJ, Rosenfeldt FL, Zhang C et al. Precise determination of mitochondrial DNA copy number in human skeletal and cardiac muscle by a PCR-based assay: lack of change of copy number with age. Nucleic Acids Res 2003;31:e61. 10 Birky CW Jr. The inheritance of genes in mitochondria and chloroplasts: laws, mechanisms, and models. Annu Rev Genet 2001;35:125–48. 11 Payne BA, Wilson IJ, Yu-Wai-Man P et al. Universal heteroplasmy of human mitochondrial DNA. Hum Mol Genet 2013;22:384–90. 12 Calvo S, Jain M, Xie X et al. Systematic identification of human mitochondrial disease genes through integrative genomics. Nat Genet 2006;38:576–82. 13 Hirst J. Why does mitochondrial complex I have so many subunits? Biochem J 2011;437:e1–3. 14 Angerer H, Zwicker K, Wumaier Z et al. A scaffold of accessory subunits links the peripheral arm and the distal proton-pumping module of mitochondrial complex I. Biochem J 2011;437:279–88. 15 Smith PM, Fox JL, Winge DR. Biogenesis of the cytochrome bc(1) complex and role of assembly factors. Biochim Biophys Acta 2012;1817:276–86. 16 Vogel RO, Smeitink JA, Nijtmans LG. Human mitochondrial complex I assembly: a dynamic and versatile process. Biochim Biophys Acta 2007;1767:1215–27. 17 Mick DU, Fox TD, Rehling P. Inventory control: cytochrome c oxidase assembly regulates mitochondrial translation. Nat Rev Mol Cell Biol 2011;12:14–20. 18 Wang ZG, White PS, Ackerman SH. Atp11p and Atp12p are assembly factors for the F (1)-ATPase in human mitochondria. J Biol Chem 2001;276:30773–8. 19 Copeland WC. Defects in mitochondrial DNA replication and human disease. Crit Rev Biochem Mol Biol 2012;47:64–74. 20 Bogenhagen DF. Mitochondrial DNA nucleoid structure. Biochim Biophys Acta 2012;1819:914–20.

British Medical Bulletin 2013;106 153 P. F. Chinnery and G. Hudson

21 Kukat C, Wurm CA, Spahr H et al. Super-resolution microscopy reveals that mammalian mitochondrial nucleoids have a uniform size and frequently contain a single copy of mtDNA. Proc Natl Acad Sci USA 2011;108:13534–9. 22 McCulloch V, Seidel-Rogol BL, Shadel GS. A human mitochondrial transcription factor is related to RNA adenine methyltransferases and binds S-adenosylmethionine. Mol Cell Biol 2002;22:1116–25. 23 McCulloch V, Shadel GS. Human mitochondrial transcription factor B1 interacts with the C-terminal activation region of h-mtTFA and stimulates transcription independently of its RNA methyltransferase activity. Mol Cell Biol 2003;23:5816–24. 24 Metodiev MD, Lesko N, Park CB et al. Methylation of 12S rRNA is necessary for in vivo stability of the small subunit of the mammalian mitochondrial ribosome. Cell Metab 2009;9:386–97. 25 Gaspari M, Larsson NG, Gustafsson CM. The transcription machinery in mammalian mitochondria. Biochim Biophys Acta 2004;1659:148–52. 26 Ma J, Farwell MA, Burkhart WA et al. Cloning and sequence analysis of the cDNA for bovine mitochondrial translational initiation factor 2. Biochim Biophys Acta 1995;1261:321–4. 27 Koc EC, Spremulli LL. Identification of mammalian mitochondrial translational initiation factor 3 and examination of its role in initiation complex formation with natural mRNAs. J Biol Chem 2002;277:35541–9. 28 Christian B, Haque E, Spremulli L. Ribosome shifting or splitting: it is all up to the EF-G. Mol Cell 2009;35:400–2. 29 Hammarsund M, Wilson W, Corcoran M et al. Identification and characterization of two novel human mitochondrial elongation factor genes, hEFG2 and hEFG1, phylogenetically conserved through evolution. Hum Genet 2001;109:542–50. 30 Ling M, Merante F, Chen HS et al. The human mitochondrial elongation factor tu (EF-Tu) gene: cDNA sequence, genomic localization, genomic structure, and identification of a pseudo- gene. Gene 1997;197:325–36. 31 Smits P, Smeitink J, van den Heuvel L. Mitochondrial translation and beyond: processes implicated in combined oxidative phosphorylation deficiencies. J Biomed Biotechnol 2010;2010:737385. 32 Zhang Y, Spremulli LL. Identification and cloning of human mitochondrial translational release factor 1 and the ribosome recycling factor. Biochim Biophys Acta 1998;1443:245–50. 33 Soleimanpour-Lichaei HR, Kuhl I, Gaisne M et al. mtRF1a is a human mitochondrial translation release factor decoding the major termination codons UAA and UAG. Mol Cell 2007;27:745–57. 34 Youle RJ, van der Bliek AM. Mitochondrial fission, fusion, and stress. Science 2012;337:1062–5. 35 Schaefer AM, McFarland R, Blakely EL et al. Prevalence of mitochondrial DNA disease in adults. Ann Neurol 2008;63:35–9. 36 Skladal D, Halliday J, Thorburn DR. Minimum birth prevalence of mitochondrial respiratory chain disorders in children. Brain 2003;126(Pt 8):1905–12. 37 Majamaa K, Moilanen JS, Uimonen S et al. Epidemiology of A3243G, the mutation for mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes: prevalence of the mutation in an adult population. Am J Hum Genet 1998;63:447–54. 38 Darin N, Oldfors A, Moslemi AR et al. The incidence of mitochondrial encephalomyopathies in childhood: clinical features and morphological, biochemical, and DNA anbormalities. Ann Neurol 2001;49:377–83. 39 Magner M, Szentivanyi K, Svandova I et al. Elevated CSF-lactate is a reliable marker of mitochondrial disorders in children even after brief seizures. Eur J Paediatr Neurol 2011;15:101–8. 40 Barkovich AJ, Good WV, Koch TK et al. Mitochondrial disorders: analysis of their clinical and imaging characteristics. AJNR Am J Neuroradiol 1993;14:1119–37. 41 Lin DD, Crawford TO, Barker PB. Proton MR spectroscopy in the diagnostic evaluation of suspected mitochondrial disease. AJNR Am J Neuroradiol 2003;24:33–41. 42 Leonard JV, Schapira AH. Mitochondrial respiratory chain disorders I: mitochondrial DNA defects. Lancet 2000;355:299–304. 43 Leonard JV, Schapira AH. Mitochondrial respiratory chain disorders II: neurodegenerative disorders and nuclear gene defects. Lancet 2000;355:389–94.

154 British Medical Bulletin 2013;106 Mitochondrial genetics

44 Rahman S, Poulton J, Marchington D et al. Decrease of 3243 A–>G mtDNA mutation from blood in MELAS syndrome: a longitudinal study. Am J Hum Genet 2001;68:238–40. 45 Harman D. The biologic clock: the mitochondria? J Am Geriatr Soc 1972;20:145–7. 46 Hegde ML, Mantha AK, Hazra TK et al. Oxidative genome damage and its repair: implications in aging and neurodegenerative diseases. Mech Ageing Dev 2012;133:157–68. 47 Howell N. Origin, cellular expression, and cybrid transmission of mitochondrial CAP-R, PYR-IND, and OLI-R mutant phenotypes. Somat Cell Genet 1983;9:1–24. 48 Chinnery PF, Howell N, Lightowlers RN et al. Molecular pathology of MELAS and MERRF. The relationship between mutation load and clinical phenotypes. Brain 1997;120: 1713–21. 49 White SL, Collins VR, Wolfe R et al. Genetic counseling and prenatal diagnosis for the mitochondrial DNA mutations at nucleotide 8993. Am J Hum Genet 1999;65:474–82. 50 Weber K, Wilson JN, Taylor L et al. A new mtDNA mutation showing accumulation with time and restriction to skeletal muscle. Am J Hum Genet 1997;60:373–80. 51 Poulton J, O’Rahilly S, Morten KJ et al. Mitochondrial DNA, diabetes and pancreatic pathology in Kearns-Sayre syndrome. Diabetologia 1995;38:868–71. 52 Torroni A, Huoponen K, Francalacci P et al. Classification of European mtDNAs from an analysis of three European populations. Genetics 1996;144:1835–50. 53 Pello R, Martin MA, Carelli V et al. Mitochondrial DNA background modulates the assembly kinetics of OXPHOS complexes in a cellular model of mitochondrial disease. Hum Mol Genet 2008;17:4001–11. 54 Pyle A, Foltynie T, Tiangyou W et al. Mitochondrial DNA haplogroup cluster UKJT reduces the risk of PD. Ann Neurol 2005;57:564–7. 55 Santoro A, Balbi V, Balducci E et al. Evidence for sub-haplogroup h5 of mitochondrial DNA as a risk factor for late onset Alzheimer’s disease. PLoS One 2010;5:e12037. 56 Ridge PG, Maxwell TJ, Corcoran CD et al. Mitochondrial genomic analysis of late onset Alzheimer’s disease reveals protective haplogroups H6A1A/H6A1B: the Cache County Study on Memory in Aging. PLoS One 2012;7:e45134. 57 Udar N, Atilano SR, Memarzadeh M et al. Mitochondrial DNA haplogroups associated with age-related macular degeneration. Invest Ophthalmol Vis Sci 2009;50:2966–74. 58 Chinnery PF, Elliott HR, Hudson G et al. Epigenetics, epidemiology and mitochondrial DNA diseases. Int J Epidemiol 2012;41:177–87. 59 Ghezzi D, Zeviani M. Assembly factors of human mitochondrial respiratory chain complexes: physiology and pathophysiology. Adv Exp Med Biol 2012;748:65–106. 60 MITOMAP. A human mitochondrial genome database, 2000. http://www.gen.emory.edu/ mitomap.html. 61 Rossignol R, Faustin B, Rocher C et al. Mitochondrial threshold effects. Biochem J 2003;370 (Pt 3):751–62. 62 Schon EA, Rizzuto R, Moraes CT et al. A direct repeat is a hotspot for large-scale deletion of human mitochondrial DNA. Science 1989;244:346–9. 63 Krishnan KJ, Reeve AK, Samuels DC et al. What causes mitochondrial DNA deletions in human cells? Nat Genet 2008;40:275–9. 64 Wallace DC, Singh G, Lott MT et al. Mitochondrial DNA mutation associated with Leber’s hereditary optic neuropathy. Science 1988;242:1427–30. 65 Carelli V, Ghelli A, Ratta M et al. Leber’s hereditary optic neuropathy: biochemical effect of 11778/ND4 and 3460/ND1 mutations and correlation with the mitochondrial genotype. Neurology 1997;48:1623–32. 66 Carelli V, La Morgia C, Valentino ML et al. Retinal ganglion cell neurodegeneration in mitochondrial inherited disorders. Biochim Biophys Acta 2009;1787:518–28. 67 Hudson G, Keers S, Yu Wai Man P et al. Identification of an X-chromosomal locus and haplotype modulating the phenotype of a mitochondrial DNA disorder. Am J Hum Genet 2005;77:1086–91. 68 Achilli A, Iommarini L, Olivieri A et al. Rare primary mitochondrial DNA mutations and probable synergistic variants in Leber’s hereditary optic neuropathy. PLoS One 2012;7: e42242. 69 Kirkman MA, Yu-Wai-Man P, Korsten A et al. Gene-environment interactions in Leber hereditary optic neuropathy. Brain 2009;132(Pt 9):2317–26.

British Medical Bulletin 2013;106 155 P. F. Chinnery and G. Hudson

70 Hudson G, Carelli V, Spruijt L et al. Clinical expression of Leber hereditary optic neuropathy is affected by the mitochondrial DNA-haplogroup background. Am J Hum Genet 2007;81:228–33. 71 Carvalho MR, Muller B, Rotzer E et al. Leber’s hereditary optic neuroretinopathy and the X-chromosomal susceptability factor: no linkage to DXS7. Hum Hered 1992;42:316–20. 72 Chen JD, Cox I, Denton MJ. Prelimanary exclusion of an X-linked gene in Leber optic atrophy by linkage analysis. Hum Genet 1989;82:302–7. 73 Abu-Amero K, Jaber M, Hellani A et al. Genome-wide expression profile of LHON patients with the 11778 mutation. Br J Ophthalmol (2009/09/04 ed), 2009. 74 Phasukkijwatana N, Kunhapan B, Stankovich J et al. Genome-wide linkage scan and association study of PARL to the expression of LHON families in Thailand. Hum Genet (2010/04/ 22 ed). 75 Prezant TR, Agapian JV, Bohlman MC et al. Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and non-syndromic deafness. Nat Genet 1993;4: 289–94. 76 Zifa E, Giannouli S, Theotokis P et al. Mitochondrial tRNA mutations: clinical and functional perturbations. RNA Biol 2007;4:38–66. 77 McFarland R, Elson JL, Taylor RW et al. Assigning pathogenicity to mitochondrial tRNA mutations: when ‘definitely maybe’ is not good enough. Trends Genet 2004;20:591–6. 78 Pavlakis SG, Phillips PC, DiMauro S et al. Mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes: a distinctive clinical syndrome. Ann Neurol 1984;16:481–8. 79 Hirano M, Ricci E, Koenigsberger MR et al. Melas: an original case and clinical criteria for diagnosis. Neuromuscul Disord 1992;2:125–35. 80 Manwaring N, Jones MM, Wang JJ et al. Population prevalence of the MELAS A3243G mutation. Mitochondrion 2007;7:230–3. 81 Goto Y, Nonaka I, Horai S. A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990;348:651–3. 82 Santorelli FM, Tanji K, Kulikova R et al. Identification of a novel mutation in the mtDNA ND5 gene associated with MELAS. Biochem Biophys Res Commun 1997;238:326–8. 83 Shoffner JM, Lott MT, Lezza AM et al. Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNA(Lys) mutation. Cell 1990;61:931–7. 84 Zeviani M, Moraes CT, DiMauro S et al. Deletions of mitochondrial DNA in Kearns-Sayre syndorme. Neurology 1988;38:1339–46. 85 Moraes CT, DiMauro S, Zeviani M et al. Mitochondrial DNA deletions in progressive external ophthalmoplegia and Kearns-Sayre syndrome. N Engl J Med 1989;320:1293–9. 86 Rotig A, Cormier V, Blanche S et al. Pearson’s marrow-pancreas syndrome. A multisystem mitochondrial disorder in infancy. J Clin Invest 1990;86:1601–8. 87 Horvath R, Hudson G, Ferrari G et al. Phenotypic spectrum associated with mutations of the mitochondrial polymerase gamma gene. Brain 2006;129(Pt 7):1674–84. 88 Spelbrink JN, Li FY, Tiranti V et al. Human mitochondrial DNA deletios associated with mutations in the gene encoding Twinkle, a phage T7 gene4-like protein localized in mitochondria. Nat Genet 2001;28:223–31. 89 Agostino A, Valletta L, Chinnery PF et al. Mutations of ANT1, Twinkle, and POLG1 in sporadic progressive external ophthalmoplegia (PEO). Neurology 2003;60:1354–6. 90 Wolf A, Cowen D. The cerebral atrophies and encephalomalacias of infancy and childhood. Res Publ Assoc Res Nerv Ment Dis 1955;34:199–330. 91 Kollberg G, Moslemi AR, Darin N et al. POLG1 mutations associated with progressive encephalopathy in childhood. J Neuropathol Exp Neurol 2006;65:758–68. 92 Naviaux RK, Nguyen KV. POLG mutations associated with Alpers’ syndrome and mitochondrial DNA depletion. Ann Neurol 2004;55:706–12. 93 Clayton DA. Replication of animal mitochondrial DNA. Cell 1982;28:693–705. 94 Spinazzola A, Zeviani M. Disorders of nuclear-mitochondrial intergenomic communication. Biosci Rep 2007;27:39–51. 95 Haack TB, Haberberger B, Frisch EM et al. Molecular diagnosis in mitochondrial complex I deficiency using exome sequencing. J Med Genet 2012;49:277–83. 96 Loeffen JL, Smeitink JA, Trijbels JM et al. Isolated complex I deficiency in children: clinical, biochemical and genetic aspects. Hum Mutat 2000;15:123–34.

156 British Medical Bulletin 2013;106 Mitochondrial genetics

97 Lebre AS, Rio M, Faivre d’Arcier L et al. A common pattern of brain MRI imaging in mitochondrial diseases with complex I deficiency. J Med Genet 2011;48:16–23. 98 Benit P, Chretien D, Kadhom N et al. Large-scale deletion and point mutations of the nuclear NDUFV1 and NDUFS1 genes in mitochondrial complex I deficiency. Am J Hum Genet 2001;68:1344–52. 99 Benit P, Slama A, Cartault F et al. Mutant NDUFS3 subunit of mitochondrial complex I causes Leigh syndrome. J Med Genet 2004;41:14–7. 100 van den Heuvel L, Ruitenbeek W, Smeets R et al. Demonstration of a new pathogenic mutation in human complex I deficiency: a 5-bp duplication in the nuclear gene encoding the 18-kD (AQDQ) subunit. Am J Hum Genet 1998;62:262–8. 101 Smeitink J, van den Heuvel L. Human mitochondrial complex I in health and disease. Am J Hum Genet 1999;64:1505–10. 102 Loeffen J, Smeitink J, Triepels R et al. The first nuclear-encoded complex I mutation in a patient with Leigh syndrome. Am J Hum Genet 1998;63:1598–608. 103 Schuelke M, Smeitink J, Mariman E et al. Mutant NDUFV1 subunit of mitochondrial complex I causes leukodystrophy and myoclonic epilepsy. Nat Genet 1999;21:260–1. 104 Hoefs SJ, van Spronsen FJ, Lenssen EW et al. NDUFA10 mutations cause complex I deficiency in a patient with Leigh disease. Eur J Hum Genet 2011;19:270–4. 105 Hoefs SJ, Dieteren CE, Distelmaier F et al. NDUFA2 complex I mutation leads to Leigh disease. Am J Hum Genet 2008;82:1306–15. 106 Shoubridge EA. Nuclear genetic defects of oxidative phosphorylation. Hum Mol Genet 2001;10:2277–84. 107 Loeffen J, Elpeleg O, Smeitink J et al. Mutations in the complex I NDUFS2 gene of patients with cardiomyopathy and encephalomyopathy. Ann Neurol 2001;49:195–201. 108 Kirby DM, Salemi R, Sugiana C et al. NDUFS6 mutations are a novel cause of lethal neonatal mitochondrial complex I deficiency. J Clin Invest 2004;114:837–45. 109 Benit P, Beugnot R, Chretien D et al. Mutant NDUFV2 subunit of mitochondrial complex I causes early onset hypertrophic cardiomyopathy and encephalopathy. Hum Mutat 2003;21:582–6. 110 Berger I, Hershkovitz E, Shaag A et al. Mitochondrial complex I deficiency caused by a deleterious NDUFA11 mutation. Ann Neurol 2008;63:405–8. 111 Haack TB, Danhauser K, Haberberger B et al. Exome sequencing identifies ACAD9 mutations as a cause of complex I deficiency. Nat Genet 2010;42:1131–4. 112 Calvo SE, Tucker EJ, Compton AG et al. High-throughput, pooled sequencing identifies mutations in NUBPL and FOXRED1 in human complex I deficiency. Nat Genet 2010;42: 851–8. 113 Gerards M, Sluiter W, van den Bosch BJ et al. Defective complex I assembly due to C20orf7 mutations as a new cause of Leigh syndrome. J Med Genet 2010;47:507–12. 114 Saada A, Edvardson S, Rapoport M et al. C6ORF66 is an assembly factor of mitochondrial complex I. Am J Hum Genet 2008;82:32–8. 115 Dunning CJ, McKenzie M, Sugiana C et al. Human CIA30 is involved in the early assembly of mitochondrial complex I and mutations in its gene cause disease. EMBO J 2007;26: 3227–37. 116 Baysal BE. Hereditary paraganglioma targets diverse paraganglia. J Med Genet 2002;39: 617–22. 117 Petruzzella V, Tiranti V, Fernandez P et al. Identification and characterization of human cDNAs specific to BCS1, PET112, SCO1, COX15, and COX11, five genes involved in the formation and function of the mitochondrial respiratory chain. Genomics 1998;54:494–504. 118 de Lonlay P, Valnot I, Barrientos A et al. A mutant mitochondrial respiratory chain assembly protein causes complex III deficiency in patients with tubulopathy, encephalopathy and liver failure. Nat Genet 2001;29:57–60. 119 Haut S, Brivet M, Touati G et al. A deletion in the human QP-C gene causes a complex III deficiency resulting in hypoglycaemia and lactic acidosis. Hum Genet 2003;113:118–22. 120 Barel O, Shorer Z, Flusser H et al. Mitochondrial complex III deficiency associated with a homozygous mutation in UQCRQ. Am J Hum Genet 2008;82:1211–6. 121 Ghezzi D, Arzuffi P, Zordan M et al. Mutations in TTC19 cause mitochondrial complex III deficiency and neurological impairment in humans and flies. Nat Genet 2011;43:259–63.

British Medical Bulletin 2013;106 157 P. F. Chinnery and G. Hudson

122 Massa V, Fernandez-Vizarra E, Alshahwan S et al. Severe infantile encephalomyopathy caused by a mutation in COX6B1, a nucleus-encoded subunit of cytochrome c oxidase. Am J Hum Genet 2008;82:1281–9. 123 Antonicka H, Leary SC, Guercin GH et al. Mutations in COX10 result in a defect in mitochondrial heme A biosynthesis and account for multiple, early-onset clinical phenotypes associated with isolated COX deficiency. Hum Mol Genet 2003;12:2693–702. 124 Coenen MJ, van den Heuvel LP, Ugalde C et al. Cytochrome c oxidase biogenesis in a patient with a mutation in COX10 gene. Ann Neurol 2004;56:560–4. 125 Indrieri A, van Rahden VA, Tiranti V et al. Mutations in COX7B cause microphthalmia with linear skin lesions, an unconventional mitochondrial disease. Am J Hum Genet 2012;91:942–9. 126 Zvulunov A, Kachko L, Manor E et al. Reticulolinear aplasia cutis congenita of the face and neck: a distinctive cutaneous manifestation in several syndromes linked to Xp22. Br J Dermatol 1998;138:1046–52. 127 Shteyer E, Saada A, Shaag A et al. Exocrine pancreatic insufficiency, dyserythropoeitic anemia, and calvarial hyperostosis are caused by a mutation in the COX4I2 gene. Am J Hum Genet 2009;84:412–7. 128 Zhu Z, Yao J, Johns T et al. SURF1, encoding a factor involved in the biogenesis of cytochrome c oxidase, is mutated in Leigh syndrome. Nat Genet 1998;20:337–43. 129 Tiranti V, Jaksch M, Hofmann S et al. Loss-of-function mutations of SURF-1 are specifically associated with Leigh syndrome with cytochrome c oxidase deficiency. Ann Neurol 1999;46:161–6. 130 Weraarpachai W, Sasarman F, Nishimura T et al. Mutations in C12orf62, a factor that couples COX I synthesis with cytochrome c oxidase assembly, cause fatal neonatal lactic acidosis. Am J Hum Genet 2012;90:142–51. 131 Huigsloot M, Nijtmans LG, Szklarczyk R et al. A mutation in C2orf64 causes impaired cytochrome c oxidase assembly and mitochondrial cardiomyopathy. Am J Hum Genet 2011;88:488–93. 132 Ghezzi D, Saada A, D’Adamo P et al. FASTKD2 nonsense mutation in an infantile mitochondrial encephalomyopathy associated with cytochrome c oxidase deficiency. Am J Hum Genet 2008;83:415–23. 133 Mayr JA, Havlickova V, Zimmermann F et al. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 epsilon subunit. Hum Mol Genet 2010;19:3430–9. 134 De Meirleir L, Seneca S, Lissens W et al. Respiratory chain complex V deficiency due to a mutation in the assembly gene ATP12. J Med Genet 2004;41:120–4. 135 Saada A, Shaag A, Arnon S et al. Antenatal mitochondrial disease caused by mitochondrial ribosomal protein (MRPS22) mutation. J Med Genet 2007;44:784–6. 136 Zeharia A, Fischel-Ghodsian N, Casas K et al. Mitochondrial myopathy, sideroblastic anemia, and lactic acidosis: an autosomal recessive syndrome in Persian Jews caused by a mutation in the PUS1 gene. J Child Neurol 2005;20:449–52. 137 Smirnova E, Shurland DL, Ryazantsev SN et al. A human dynamin-related protein controls the distribution of mitochondria. J Cell Biol 1998;143:351–8. 138 Waterham HR, Koster J, van Roermund CW et al. A lethal defect of mitochondrial and peroxisomal fission. N Engl J Med 2007;356:1736–41. 139 Cree LM, Samuels DC, de Sousa Lopes SC et al. A reduction of mitochondrial DNA molecules during embryogenesis explains the rapid segregation of genotypes. Nat Genet 2008;40:249–54. 140 Carling PJ, Cree LM, Chinnery PF. The implications of mitochondrial DNA copy number regulation during embryogenesis. Mitochondrion 2011;11:686–92. 141 DiMauro S, Schon EA. Mitochondrial DNA mutations in human disease. Am J Med Genet 2001;106:18–26. 142 Clark MJ, Chen R, Lam HY et al. Performance comparison of exome DNA sequencing technologies. Nat Biotechnol 2011;29:908–14. 143 McCormick E, Place E, Falk MJ. Molecular Genetic Testing for Mitochondrial Disease: From One Generation to the Next. Neurotherapeutics 2013;10:251–61. 144 Pagliarini DJ, Calvo SE, Chang B et al. A mitochondrial protein compendium elucidates complex I disease biology. Cell 2008;134:112–23.

158 British Medical Bulletin 2013;106 Mitochondrial genetics

145 Prokisch H, Andreoli C, Ahting U et al. MitoP2: the mitochondrial proteome database–now including mouse data. Nucleic Acids Res 2006;34(database issue):D705–11. 146 Pierson TM, Adams D, Bonn F et al. Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases. PLoS Genet 2011;7:e1002325. 147 Vedrenne V, Gowher A, De Lonlay P et al. Mutation in PNPT1, which encodes a polyribonu- cleotide nucleotidyltransferase, impairs RNA import into mitochondria and causes respiratory- chain deficiency. Am J Hum Genet 2012;91:912–8. 148 Janer A, Antonicka H, Lalonde E et al. An RMND1 Mutation causes encephalopathy associated with multiple oxidative phosphorylation complex deficiencies and a mitochondrial translation defect. Am J Hum Genet 2012;91:737–43. 149 Casey JP, McGettigan P, Lynam-Lennon N et al. Identification of a mutation in LARS as a novel cause of infantile hepatopathy. Mol Genet Metab 2012;106:351–8. 150 Galmiche L, Serre V, Beinat M et al. Exome sequencing identifies MRPL3 mutation in mitochondrial cardiomyopathy. Hum Mutat 2011;32:1225–31. 151 Gotz A, Tyynismaa H, Euro L et al. Exome sequencing identifies mitochondrial alanyl-tRNA synthetase mutations in infantile mitochondrial cardiomyopathy. Am J Hum Genet 2011;88:635–42. 152 Pfeffer G, Elliott HR, Griffin H et al. Titin mutation segregates with hereditary myopathy with early respiratory failure. Brain 2012;135(Pt 6):1695–713. 153 Chinnery PF, Thorburn DR, Samuels DC et al. The inheritance of mitochondrial DNA heteroplasmy: random drift, selection or both? Trends Genet 2000;16:500–5. 154 Monnot S, Gigarel N, Samuels DC et al. Segregation of mtDNA throughout human embryofe- tal development: m.3243A>G as a model system. Hum Mutat 2011;32:116–25. 155 Pfeffer G, Majamaa K, Turnbull DM et al. Treatment for mitochondrial disorders. Cochrane Database Syst Rev 2012;4:CD004426. 156 Klopstock T, Yu-Wai-Man P, Dimitriadis K et al. A randomized placebo-controlled trial of idebenone in Leber’s hereditary optic neuropathy. Brain 2011;134:2677–86. 157 Kyriakouli DS, Boesch P, Taylor RW et al. Progress and prospects: gene therapy for mitochondrial DNA disease. Gene Ther 2008;15:1017–23. 158 Nagley P, Farrell LB, Gearing DP et al. Assembly of functional proton-translocating ATPase complex in yeast mitochondria with cytoplasmically synthesized subunit 8, a polypeptide normally encoded within the organelle. Proc Natl Acad Sci USA 1988;85:2091–5. 159 Bonnet C, Kaltimbacher V, Ellouze S et al. Allotopic mRNA localization to the mitochondrial surface rescues respiratory chain defects in fibroblasts harboring mitochondrial DNA mutations affecting complex I or v subunits. Rejuvenation Res 2007;10:127–44. 160 Taivassalo T, Gardner JL, Taylor RW et al. Endurance training and detraining in mitochondrial myopathies due to single large-scale mtDNA deletions. Brain 2006;129(Pt 12): 3391–401. 161 Halter J, Schupbach WM, Casali C et al. Allogeneic hematopoietic SCT as treatment option for patients with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE): a consensus conference proposal for a standardized approach. Bone Marrow Transplant 2011;46:330–7. 162 Wong LJ, Brunetti-Pierri N, Zhang Q et al. Mutations in the MPV17 gene are responsible for rapidly progressive liver failure in infancy. Hepatology 2007;46:1218–27. 163 Hellebrekers DM, Wolfe R, Hendrickx AT et al. PGD and heteroplasmic mitochondrial DNA point mutations: a systematic review estimating the chance of healthy offspring. Hum Reprod Update 2012;18:341–9. 164 Thorburn D, Wilton L, Stock-Myer S. Healthy baby girl born following pre-implantation Genetic diagnosis for mitochondrial DNA m.8993t>g Mutation. Mol Genet Metab 2009;98:5–6. 165 Craven L, Tuppen HA, Greggains GD et al. Pronuclear transfer in human embryos to prevent transmission of mitochondrial DNA disease. Nature 2010;465:82–5. 166 Tachibana M, Amato P, Sparman M et al. Towards germline gene therapy of inherited mitochondrial diseases. Nature 2013;493:627–31. 167 Poulton J, Oakeshott P. Nuclear transfer to prevent maternal transmission of mitochondrial DNA disease. BMJ 2012;345:e6651.

British Medical Bulletin 2013;106 159 NIH Public Access Author Manuscript Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Semin Fetal Neonatal Med. 2011 August ; 16(4): 197±204. doi:10.1016/j.siny.2011.05.004.

Mitochondrial disorders caused by mutations in respiratory chain assembly factors

Francisca Diaza,*, Heike Kotarskyb, Vineta Fellmanb,c, and Carlos T. Moraesa

aDepartment of Neurology, University of Miami Miller School of Medicine, Miami, Florida, USA bDepartment of Pediatrics, Clinical Sciences, Lund, Lund University, Lund, Sweden cDepartment of Pediatrics, University of Helsinki, Helsinki, Finland

Summary Mitochondrial diseases involve the dysfunction of the oxidative phosphorylation (OXPHOS) system. This group of diseases presents with heterogeneous clinical symptoms affecting mainly organs with high energy demands. Defects in the multimeric complexes comprising the OXPHOS system have a dual genetic origin, mitochondrial or nuclear DNA. Although many nuclear DNA mutations involve genes coding for subunits of the respiratory complexes, the majority of mutations found to date affect factors that do not form part of the final complexes. These assembly factors or chaperones have multiple functions ranging from cofactor insertion to proper assembly/ stability of the complexes. Although significant progress has been made in the last few years in the discovery of new assembly factors, the function of many remains elusive. Here, we describe assembly factors or chaperones that are required for respiratory chain complex assembly and their clinical relevance.

Keywords Chaperones; Mitochondrial diseases; Newborn infant; Oxidative phosphorylation; Perinatal disorder; Respiratory chain deficiency

Introduction Mitochondrial diseases are usually referred to as disorders with defects in the oxidative phosphorylation (OXPHOS) system. They can be caused by mutations in the nuclear or in the mitochondrial genome and therefore have distinct patterns of inheritance depending on the genetic origin. The incidence of mitochondrial DNA (mtDNA) mutations causing disease has been estimated to be 1 in 5000 children.1 This large number is accompanied by the recent estimate that 1 in 200 people are carriers of pathogenic mtDNA mutations.2

© 2011 Elsevier Ltd. All rights reserved. *Corresponding author. Addresses: 1420 NW 9th Ave., TSL Building, Room 228, Miami, FL 33136, USA. Tel.: +1 305 243 7489; fax: +1 305 243 6955. [email protected] (F. Diaz). Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Conflict of interest statement Nothing to declare. Diaz et al. Page 2

Mitochondrial diseases, being heterogeneous in nature and affecting single or multiple organs, pose a challenge to develop effective treatments. In the last few years new strategies 3–4

NIH-PA Author Manuscript NIH-PA Author Manuscripthave NIH-PA Author Manuscript emerged and some are currently being tested in clinical trials. In this review, we focus on mitochondrial diseases caused by mutations in the proteins with chaperone function that are essential for proper assembly and function but which do not form part of the final complex. Mutations causing disease in the neonatal period are summarized in Table 1.

Complex I Complex I (CI), NADH:ubiquinone oxidoreductase or NADH dehydrogenase is the largest of the mitochondrial respiratory complexes comprising 45 subunits. Seven of its subunits are encoded by the mtDNA and the remaining by the nuclear DNA. CI catalyzes the transfer of electrons from NADH produced during the tricarboxylic acid cycle to coenzyme Q. Three- dimensional electron microscopy studies revealed that the structure of the complex resembles an ‘L’ with the presence of a peripheral hydrophilic arm (matrix arm) and a highly hydrophobic membrane arm.5 The assembly of this enzyme is very elaborate, and although many steps have been elucidated by studies in mutants of Neurospora crassa and by studies of patients with CI defects, the complete sequence of events remains unknown. Several models have been proposed for the assembly of the holoenzyme that differ in the details but agree in inasmuch as the complex is assembled in several modules that go on to form the peripheral and the membrane arms.6,7 Patients with mutations of nuclear origin leading to CI defects have severe manifestations during infancy and early childhood, frequently resulting in premature death.8 Numerous mutations in CI nuclear-and mtDNA- encoded subunits have been reported but only a fraction of the CI deficiency cases are caused by mutations in the structural subunits.9 CI defects are also caused by mutations in auxiliary proteins that do not form part of the final holoenzyme but which assist in the assembly process. Here we describe recently discovered CI chaperones and the clinical phenotypes associated with their mutations.

Complex I chaperones NDUFAF1/CIA30—Studies in N. crassa led to the identification of two proteins associated with CI assembly intermediates CIA30 and CIA84 that were proposed to have chaperone function.10 The CIA30 human homolog NDUFAF1 gene located in chromosome 15q13.3 is ubiquitously expressed with slightly increased levels in heart, lung, kidney and liver.11 Knockdown of NDUFAF1 by RNA interference (RNAi) resulted in decreased levels of the fully assembled complex and activity in HEK293 cells. Although NDUFAF1 was found to be associated with two assembly intermediates of 600 and 700 kDa its exact function has not been elucidated.12

The first patient described with a mutation in NDUFAF1 had only 10% of control levels of this chaperone as well as a significant reduction of the levels of fully assembled CI. This patient was a compound heterozygote with c.1001A→C and c.1140A→G mutations predicted to cause T207P and K253R amino acid substitutions in highly conserved residues.13 This patient presented with failure to thrive, hypotonia, growth delay, lactic acidosis and cardiomyopathy after 11 months of age. At 3 years he was diagnosed with Wolff–Parkinson–White syndrome and subsequently had visual cortex dysfunction and pigmentary retinopathy at 11 years of age. He developed osteoporosis and kyphoscoliosis at age 16 years and presented mild-to-moderate intellectual disability. At the time of the report the patient was 20 years old.13

Ecsit—Tandem affinity purification experiments identified Ecsit (evolutionary conserved signaling intermediate in Toll pathway) as a binding partner of CIA30 in HEK293 cells.14 A portion of Ecsit, previously described as a cytosolic protein required for embryonic

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 3

development and inflammatory signaling, was located in the mitochondria. This mitochondrial isoform associated with CIA30 and it was found in assembly intermediates of

NIH-PA Author Manuscript NIH-PA Author Manuscriptabout NIH-PA Author Manuscript 460 and 830 kDa. Moreover, knockdown of Ecsit by RNAi caused a substantial reduction in the levels of NDUFAF1 and disturbed CI assembly, whereas knockdown of NDUFAF1 slightly altered Ecsit levels.14 Although Ecsit and NDUFAF1 are found in the same assembly intermediates and their function is unknown, previous results imply that the two proteins have independent functions and mitochondrial Ecsit might be required for NDUFAF1 stability.14

B17.2L/NDUFAF2—By whole genome comparison of fermentative and aerobic yeast, a putative CI assembly factor, B17.2L(NDUFAF2 or NDUFA12L),15 was identified. In Yarrowia lipolytica B17.2 is a structural subunit located in the matrix arm of complex I whereas its human paralogue B17.2L is a putative assembly factor. The first patient described was homozygous for the mutation (C182T) in B17.2L leading to a premature stop codon (R45X).15 This infant presented with a progressive leukoencephalopathy with vanishing white matter and cortical and vermian atrophy. At 12 months, the patient presented horizontal nystagmus, dysconjugated gaze and pale optic disc that eventually resulted in severe optic atrophy. She had myopathic facies, lethargy and acute ataxia. Brain lesions in the substantia nigra, mamillo and spinothalamic tracts were observed by magnetic resonance imaging (MRI) at 3 years of age but did not affect her intellect. She suffered a respiratory failure at 8 years, remaining comatose and immobile, dying at 13 years of age. Analysis of brain tissue revealed extensive degeneration of white matter accompanied by glia scaring. Muscle biopsy obtained at 3 years of age did not reveal any histological abnormality, albeit the biochemical analysis of OXPHOS enzymes revealed a moderate CI defect in muscle and a more severe defect in fibroblasts. The CI deficiency and the assembly defect was rescued when B17.2L was expressed in the patient’s fibroblasts.15

B17.2L was associated mainly with a subassembly intermediate of 830 kDa in several CI patients, in particular in patients with mutations in NDUFV1 and NDUFS4.15,16

Two other patients homozygous for a codon change of methionine (ATG) to leucine (TTG) in position 1 were described.17 The mutation in the first methionine caused the complete absence of the chaperone and CI activity ranged from 24% to 36% of control in muscle mitochondria and 53% in fibroblast.17 Hypotonia, nystagmus and optic atrophy at 8 months of age were the initial findings in a boy who later had apneic spells and died at 21 months of age. MRI studies revealed lesions in the mamillothalamic and spinothalamic tracts, medial lemniscus and substantia nigra whereas cerebellum was only slightly affected and cortex and subcortical regions were spared. The second patient presented first symptoms at 20 months of age with apnea and ophthalmoplegia followed by myoclonic seizures and encountered a fatal apnea episode at 2 years of age. MRI studies revealed the same affected areas as in the first patient. Plasma and cerebrospinal fluid (CSF) lactate levels were normal in both patients.

More recently, Janssen et al.18 reported a patient with a chromosome 5 microdeletion that encompassed three genes: NDUFAF2, ERCC8 and ELOVL7. ERCC8 encodes the CS-A protein that is required for DNA repair whereas ELOVL7 gene encodes an enzyme that participates in the synthesis of the very long chain fatty acid pathway. Fibroblasts from the patient with the microdeletion had 45% of control CI activity, and expression of NDUFAF2 restored the activity to control levels. In the absence of this chaperone, fully assembled CI was not completely absent and 380 and 480 kDa intermediates were accumulated. Furthermore, some of the levels of CI subunits (NDUFS3, NDUFA9 and NDUFB6) as well as the chaperone NDUFAF1 were significantly reduced whereas the levels of NDUFAS2 were only slightly decreased.18

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 4

Thus, although the function of NDUFAF2/ B17.2L is still obscure, studies suggest that this chaperone might participate in late assembly steps, perhaps by stabilizing assembly

NIH-PA Author Manuscript NIH-PA Author Manuscriptintermediates. NIH-PA Author Manuscript

C20orf7—A lethal neonatal CI defect was mapped to the C20orf7 gene.19 The patient was homozygous for a missense mutation causing exchange of a conserved amino acid (L229P). The clinical findings were intrauterine growth restriction, ventricular septation, agenesis of the corpus callosum, lactic acidosis, and death by day 7.19

C20orf7 is a matrix protein associated with the inner mitochondrial membrane and its knockdown resulted in a decrease in CI activity. Fibroblasts from this patient showed CI assembly intermediates of ~400 kDa that contained ND1 but not ND2 subunit, indicating that this chaperone is involved in early assembly steps.19

Another investigation of members of a consanguineous family with 11 children revealed that three of them presented with a very similar Leigh syndrome (LS) and progressive spasticity with an onset at 3 years of age.20 At 5 years, increased lactate in CSF and slight atrophy and hypodensity in caudate nuclei and putamen were observed. A year later, extrapyramidal movement disorder and delay of mental development were evident. At 23 years of age lesions in basal ganglia and brain stem were discovered. CI activity in both peripheral blood lymphocytes and muscle was decreased to 36–48% and 6–33% respectively in two of the patients. The cause of the disease was attributed to a mutation in the C20orf7 gene although the patients also presented a mutation in the CRLS1 (cardiolipin synthase 1) gene.20

C6orf66/NDUFAF4—Five patients of a consanguineous family of Arab-Muslim origin with infantile encephalopathy and isolated CI deficiency were homozygous for a mutation in the C6orf66 gene, later named NDUFAF4.21 The mutation was a T→C substitution at nucleotide 194 predicted to change a leucine for a proline at amino acid 65. The healthy family members were heterozygous for this mutation.21 The affected infants suffered metabolic acidosis soon after birth, and three of them died between 2 and 5 days of age. One had a severe cardiomyopathy. The other children survived for 18 months and 7 years of age (at the time of the report). They developed a severe encephalopathy with lactic acidosis in addition to kyphosis and spastic contractures. MRI studies revealed severe atrophy of white and gray matter as well as demyelination. CI deficiency was evident in both muscle and fibroblast (5.5–17% and 32–67% of controls respectively) and introduction of wild-type C6orf66 into patients’ fibroblasts restored CI defect.21 Although the exact function of NDUFAF4 remains obscure, an interdependence of NDUFAF4 (C6orf66) and NDUFAF3 (C3orf60) was discovered.21

C3orf60/NDUFAF3—Three families with different mutations in the C3orf60 (NDUFAF3) gene were recently reported.22 A homozygous c.229 G→C mutation that caused a G77R change was found in three siblings with heterozygous parents. In the second family, the infant was homozygous for a c.365 G→C causing an R122P change. In the last family, the infant was a compound heterozygous with a c.2 T→C and a c.365 G→C that resulted in a disruption of the starting codon (M1T) and a R122T change respectively. The patients from the first family presented with lactic acidemia and increased muscle tone. Their brain MRI was normal as well as EEG and echocardiogram. They died at 3 months of age. The infant from the second family suffered from macrocephaly with wide anterior fontanelle and hypotonia. He also presented with elevated lactate and died aged 4 months. The third family patient suffered from myoclonic seizures, had diffuse brain leukomalacia in MRI, and died at 6 months of age. Muscle and fibroblast from the patients showed decreased CI activity. Analysis of CI assembly in the patient from the second family did not reveal any assembly

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 5

intermediates when probed for either ND1 or NDUFS2. The patient’s fibroblast CI defect was complemented when expressing NDUFAF3-GFP protein.22 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript Experiments on RNAi of NDUFAF3 in HeLa cells showed decreased CI protein and activity as well as a significant reduction in the levels of the assembly factor NDUFAF4. Likewise, interference of NDUFAF4 resulted in decreased levels of NDUFAF3 protein. NDUFAF3 and NDUFAF4 comigrate with the same CI assembly intermediates and interact with CI subunits (NDUFS2, NDUFS3, NDUFA5 and NDUFS8).22

C8orf38—Using phylogenetic profiling, 19 other candidate genes were identified as CI- associated proteins.23 All these candidate genes were investigated as causes of CI deficiency in two siblings presenting with lactic acidosis, ataxia, decreased muscle strength and rigidity. MRI revealed abnormalities consistent with LS. One sibling died at 34 months of age and the other was 22 months at the time of the study. The defect was associated with a mutation in the C8orf38 gene (c.296A→G) in a conserved residue.23 Further studies are required to validate the role of C8orf38 as a CI assembly factor, albeit knockdown of C8orf38 resulted in reduced levels and activity of CI.23

Ind1/HuInd1—Studies in the Yarrowia lipolytica identified Ind1 as an iron–sulfur cluster binding protein. Deletion of the Ind1 gene resulted in a marked decrease of CI levels and activity in the aerobic yeast.24 Likewise, knockdown of the human version (HULND1) in HeLa cells showed that this protein is required for CI assembly and activity. Moreover, huInd1 appears to be specific for CI. Analysis of 55Fe incorporation into the OXPHOS complexes showed a marked decrease in the iron content of CI but not in complex II or complex III in cells depleted of huInd1.25 The knockdown of huInd1 resulted in an intermediate of about 450 kDa that does not contain subunits forming the peripheral arm of the complex (NDUFS1, NDUFV1, NDUFA13 or NDUFA9) but contained one of the subunits of the membrane arm (NDUFB6).25

Taken together, these results suggest that huInd1 is involved in the delivery of iron–sulfur clusters to CI subunits and in the absence of this protein, the prosthetic group cannot be delivered and the subunits are unstable and degraded causing impairment in the assembly of the peripheral arm and accumulation of an assembly intermediate. To date, defects in this gene have not been found in patients with CI deficiency.

ACAD9—Using tandem affinity purification ACAD9 was pulled down as a binding candidate for NDUFAF1 and Ecsit.26 ACAD9 belongs to the acyl-CoA dehydrogenase family and co-migrated with CI assembly intermediates of 500 and 800 kDa that also contained Ecsit and NDUFAF1. Knockdown of ACAD9 in HEK293 cells decreased the levels and activity of CI as well as the levels of the two other chaperones. Likewise, the levels of ACAD9 were decreased when knocking down Ecsit or NDUFAF1.26

The first published ACAD9 patient was homozygous for the mutation c.1553 G→A that resulted in the change of a highly conserved residue (R518H). This infant suffered from hypertrophic cardiomyopathy at 8 months of age with elevated lactate in blood and CSF. Disease progressed and the patient was 18 years old at the time of the study, when exercise intolerance, mild hearing loss, and hypertrophic cardiomyopathy were noted. The second patient was a compound heterozygote affecting two highly conserved amino acids, and had moderate metabolic acidosis, anemia, progressive encephalopathy, and hypertrophic cardiomyopathy. The disease developed into multiple organ failure and death at 6 months of age.

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 6

Analysis of the levels of CI in both patients showed reduced levels of this complex as well as low levels of the chaperones Ecsit and NDUFAF1, albeit ACAD9 was only detected in 26

NIH-PA Author Manuscript NIH-PA Author Manuscriptpatient NIH-PA Author Manuscript 1. Expression of ACAD9 in the fibroblasts restored the defect.

Other ACAD9 (R532W change) patients with later onset of disease were reported from a double consanguineous family. Fatigue, vomiting, exercise intolerance, and lactic acidosis appeared at about 4 years age.27 The muscles were predominantly affected and showed mitochondrial proliferation in the subsarcolema. For the most part, brain appeared spared with the exception of a single stroke-like episode in two of the patients. Another patient with similar phenotype was a compound heterozygote (R127Q and R469W). The patients had a reduction of CI enzymatic activity but not of protein levels. Interestingly, these patients responded to riboflavin treatment which improved their CI deficiency.27

Since none of the ACAD9 patients showed any evidence of β-oxidation, the function of the chaperone appears to be related to CI assembly. Haack et al. confirmed this by identifying other mutations in the ACAD9 gene in five new patients with CI deficiency.28 The patients suffered from hypertrophic cardiomyopathy, encephalopathy and lactic acidosis with fatal outcome varying from 45 days to 12 years of age. CI activity ranged from 13% to 26% in muscle and from 32% to 38% in fibroblasts of control samples.28

Other factors—There remain CI defects of unknown cause, suggesting the existence of other proteins involved in the assembly process. One of these is the apoptosis-inducing factor AIF. Knockdown of AIF resulted in a reduction of the levels of certain CI subunits (NDUFA9, NDUFB6 and NDUFS7) and the fully assembled complex in vitro in HeLa cells or in vivo in the Harlequine mouse suggesting a role as CI chaperone.29 A mutation-causing deletion of an arginine (R201Δ) in the N-terminal FAD binding domain of AIF has been identified in X-linked mitochondrial encephalopathy.30 Analysis of patient fibroblasts revealed CIII and CIV deficiencies whereas CI was only slightly influenced; analysis in muscle revealed that CI, III and IV were affected. However, this was shown to be due to severe mitochondrial DNA deficiency.30 Taken together, the role of AIF in mitochondrial function needs further investigation. Another newly discovered factor is FOXRED1. Mutations in this gene caused a severe CI deficiency in an infant leading to progressive encephalomyopathy. The CI defect from fibroblast derived from the patient was rescued by lentiviral expression of the protein. Silencing the gene expression decreased the steady state levels of CI in control fibroblasts. Although the exact function of FOXRED1 as a CI chaperone is unknown, its FAD-oxidoreductase domain suggests a functional role in electrons transfer reactions.88

Complex II Complex II (CII) or succinate dehydrogenase (SDH) is located in the inner membrane facing the mitochondrial matrix where it links the respiratory chain with the Krebs cycle. SDH catalyses the oxidation of succinate to fumarate, resulting in reduction of the FAD cofactor bound to SDH from which electrons are passed through three FeS centres to ubiquinone.31 CII is composed of four nuclear-encoded subunits (SDHA–D) of which subunits A and B form the enzyme complex whereas subunits C and D anchor the complex to the inner mitochondrial membrane.32 Mutations in either CII proteins or chaperones may cause LS (SDAH), infantile leukencephalopathy (SDAHF1) or familial paraganglioma syndrome (SDHB, C, D, SDHAF2). Several proteins assisting assembly of CII have been described,33 but only the two recently discovered factors SDHAF134 and SDHAF235 directly and specifically aid CII assembly.

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 7

Complex II chaperones SDHAF1—SDHAF1 was first described in 2009 by Ghezzi et al. in two affected families

NIH-PA Author Manuscript NIH-PA Author Manuscriptwith NIH-PA Author Manuscript infantile leukencephalopathy with severe CII deficiency.34,36 By genome-wide linkage analysis, two homozygous missense mutations were identified in an evolutionarily highly conserved gene coding for a mitochondrial matrix protein. Transfection of patient fibroblasts with wild-type SDHAF1 resulted in full or partial recovery of structural and functional assembled CII.34

SDHAF2—By investigation of uncharacterized but evolutionarily conserved mitochondrial proteins in yeast, Hao et al. identified a protein that co-purified with yeast SDH1 and named it SDHAF2 (SDH5 in yeast).35 Deletion of yeast SDH5 resulted in loss of the SDH complex and activity, probably due to unstable assembly of SDH. Incorporation of the FAD cofactor was impaired in the mutant. A human mutation in SDHAF2 was identified in a Dutch family with hereditary paraganglioma.35,37

Other factors—In yeast, two additional factors indirectly modifying CII assembly have been described.

In respiratory-deficient yeast mutants, Flx1 was identified as FAD transporter necessary for FAD incorporation into CII.38 Later a more general role of Flx1 on post-transcriptional expression of Sdh1 was suggested.33,35,39

Tcm62 was initially shown to be required for yeast CII assembly40 but later experiments indicate that it influences CII assembly more generally by affecting mitochondrial protein stability under stress41 or protein-folding capacity within mitochondria.42

Complex III Complex III (CIII, or cytochrome bc1 complex; ubiquinol cytochrome c reductase) is located in the mitochondrial inner membrane where it facilitates electron transfer from reduced coenzyme Q to cytochrome c, a process coupled to simultaneous pumping of protons across the inner mitochondrial membrane. In mammals, CIII forms a homodimer that can also be found in association with CI and CIV,43 forming supercomplexes that may be stabilized by cardiolipin.44 Monomeric CIII is composed of three catalytic and eight structural subunits that are encoded by 10 nuclear and one mitochondrial genes. The respiratory subunits contain redox centres and include the nuclear-encoded cytochrome c1 (CYC1), the Rieske iron–sulfur protein (RISP, UQCRFS1) and the mitochondrial-encoded cytochrome b (MT-CYB). The nuclear-encoded structural proteins are the core proteins 1 and 2 (UQCRC1 and 2) and subunit 6 (UQCRH) involved in complex formation, subunits 7 (UQCRB) and 8 (UQCRQ) involved in ubiquinone binding, subunit 9 (UQCR10) that interacts with cytochrome c1 and subunit 10 that may function as RISP protein-binding factor. In mammals, assembly of CIII is assisted by BCS1L45 and TTC19.46

CIII deficiencies are rare, but they cause a broad spectrum of symptoms and display tissue specificity in humans.47 They are caused by mutations in catalytic and structural subunits as well as in assembly factors. Mutations in the mitochondrial-encoded catalytic subunit, cytochrome b, have mainly been associated with myopathy;48 however, cytochrome b mutations are also the cause of Leber’s hereditary optic neuropathy (LHON),49 encephalomyopathy,50 encephalopathy51 cardiomyopathy47 and severe neonatal polyvisceral failure.52 Structural genes as cause of CIII deficiency include UQCRB and UQCRQ. In one patient with hypoglycemia and lactic acidosis, re-arrangement of the UQCRB gene was identified.53 In another patient suffering from severe psychomotor

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 8

retardation with mildly elevated lactate levels, a single missense mutation was identified in UQCRQ.54 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript Complex III chaperones BCS1L—CIII assembly has been extensively investigated in yeast where bcs1 was identified as a factor necessary for the expression of functional CIII.55 The protein Bcs1 acts as molecular chaperone assisting the incorporation of Rieske protein and Qcr10p into CIII.56 Bcs1 shares 50% amino acid identity with its human ortholog, BCS1L.57 In the BCS1L protein, three different domains, the N-terminal import domain, the BCS1L-specific domain and the C-terminal AAA ATPase domain can be identified. In humans, BCS1L mutations have been found in all three domains, thereby causing CIII deficiency, resulting in a variety of phenotypes. They range from the least severe Björnstad syndrome with neurosensory hearing loss and pili torti,58,59 a neurologic disease with muscle weakness and optic atrophy60 to manifestations with encephalopathy, liver failure or tubulopathy, or combinations thereof.45,61–65 Manifestations with neonatal onset usually present with hepatopathy (V. Fellman and H. Kotarsky, in this issue), the most severe being the GRACILE (growth restriction, aminoaciduria, cholestasis, iron overload, lactic acidosis and early death) syndrome, caused by a homozygous missense mutation (S78G).66 The phenotype is strikingly consistent,67 presenting with severe fetal growth restriction, lactacidosis and early death, further described in this issue (V. Fellman). Different BCS1L mutations known to date are summarized in Figure 1.

TTC19—An additional CIII assembly factor has recently been identified in patients with CIII deficiency and a slowly progressive encephalopathy presenting with subtle motility changes, involuntary movements and regurgitations with an onset during the first months of life.46 In these individuals, homozygous nonsense mutations were identified in the gene encoding tetratricopeptide 19 (TTC19) resulting in reduced expression of TTC19 mRNA and lack of TTC19 protein. TTC19 protein was localized to the inner mitochondrial membrane where it is part of two high molecular weight complexes of which at least one contains CIII intermediates. Accumulation of CIII assembly intermediates in affected patients suggests that TTC19 is important in early assembly. Knockout of TTC19 in Drosophila melanogaster results in low fertility and neurological abnormalities associated with CIII deficiency.

Complex IV Complex IV (CIV) or cytochrome c oxidase is the terminal enzyme of the electron transport chain that transfers electrons from cytochrome c to oxygen while it translocates protons from the matrix into the intermembrane space. CIV is a homodimer of about 230 kDa constituted by 13 subunits. Three of its subunits form the catalytic core and are encoded by the mtDNA whereas the rest of the subunits are encoded by the nuclear genome. Due to its dual origin the assembly process of this complex is also very complicated and highly regulated. Most of what is known about CIV assembly has been elucidated from systematic studies in mutants from the yeast Saccharomyces cerevisiae. Studies in yeast have revealed the presence of about 40 assembly factors that aid numerous aspects of CIV biogenesis.68 Of the large number of assembly factors found in yeast, only some have human homologs. Below we focus on those factors with clinical relevance.

Complex IV chaperones Surf1—Mutations in the Surf1 gene cause LS characterized by subacute neurodegeneration encompassing bilateral necrotic lesions in brain stem, thalamus and basal ganglia. These lesions consist of neuronal loss, vascularization and demyelination and cause an early onset

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 9

of symptoms typically including ataxia, nystagmus, dystonia, ophthalmoparesis and optic atrophy. Affected individuals die between 6 months to 12 years. The majority of the

NIH-PA Author Manuscript NIH-PA Author Manuscriptmutations NIH-PA Author Manuscript reported in Surf1 create premature termination codons whereas fewer mutations are missense mutations.69 The latter mutations have been associated with milder phenotypes.70 The CIV activity in patients with LS ranged from 10% to 25% of control values. One puzzling fact is that not all mutations in Surf1 cause LS. The clinical symptoms of LS have also been associated with mutations in other genes located in the mtDNA, with COX10, and with certain defects in pyruvate dehydrogenase, CI and CV activities.71 The actual function of Surf1 remains obscure but it participates in early assembly of CIV. Recent studies in bacteria point the function of two Surf1 homologs Surf1c and Surf1q as heme a binding proteins.72

LRPPRC—A less severe form of LS found exclusively in a region of Quebec (Charlevoix and Saguenay-Lac-St Jean) is the French-Canadian Leigh syndrome (FCLS) caused by mutations in the LRPPRC gene.73 In FCLS death also occurs early in life, between 3 and 10 years and clinical presentations include mild psychomotor regression and lactic acidosis. The tissues with severe CIV deficiency in this disorder are brain and liver, whereas muscle, heart and kidney are relatively unaffected. The LRPPRC (leucine-rich pentatricopeptide repeat cassette) protein homolog in yeast (Pet309) is required for stability and translation of COX1 mRNA (CIV catalytic subunit 1 encoded by the mtDNA) by presumably binding to its 5′UTR. The exact function of the mammalian LRPPRC is still unknown since there are no significant 5′UTR in mitochondrial mRNA, suggesting that the protein acts through a different mechanism. The levels of this chaperone as well as the levels of most of the mitochondrial transcripts excluding the rRNA and tRNA were significantly decreased in LRPPRC patients.74 This decrease of mitochondrial mRNA was not proportional and the levels of CIV transcripts were the most reduced. When decreasing the LRPPRC levels even further, a severe decrease in all mitochondrial transcripts was observed with a generalized defect in all mitochondrially encoded OXPHOS complexes. LRPPRC was found to interact with SLIRP and to bind mRNA. Although further studies are required, the authors propose that these two proteins are post-transcriptional regulators of mitochondrial genes.74

TACO1—In a patient with late onset of LS, a mutation in the CCD44 gene was identified resulting in impaired COX1 protein synthesis.75 The gene was renamed TACO1 since it encodes a protein that serves as ‘translational activator of COX1’.75 In other patients with late onset of LS and CIV deficiency, no mutations in TACO1 were found, suggesting that mutations in this factor are rare or perhaps incompatible with life.76

SCO1 and SCO2—Complex IV requires copper in two catalytic centers, CuA and CuB, located in COX2 and COX1 subunits respectively. Several assembly factors (COX17, SCO1, SCO2 and COX11) are implicated in the delivery of this metal.77 Mutations in SCO1 were described first in two neonate siblings suffering from severe metabolic acidosis and hepatic failure (microvesicular steatosis and hepatomegaly) and from metabolic acidosis and encephalopathy respectively. The first patient died at 2 months and the second at 5 days of age; they were compound heterozygous for a 2 bp deletion in nucleotide 363–364 resulting in frame shift and stop codon, and for a C→T transition at nucleotide 520 resulting in an amino acid change of a conserved residue (P174L). The severe COX defect (less than 1% of control values) was observed in liver and muscle tissues in the first patient.78 Another SCO1 case presented with hypertrophic cardiomyopathy, encephalopathy and hepatomegaly with a fatal outcome at 6 months. The patient was homozygous for the missense mutation c. 394G→A resulting in a G132s change.79

SCO2 mutations were first detected in three patients suffering from hypertrophic cardiomyopathy accompanied by encephalopathy manifested early in life.80 The brain

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 10

lesions differed from the typical LS. SCO2 brain abnormalities included spongiform neurodegeneration (midbrain, pons and medulla) and microglia proliferation (thalamus). 80

NIH-PA Author Manuscript NIH-PA Author ManuscriptThey NIH-PA Author Manuscript were all compound heterozygotes with different combinations. Since then, numerous cases of SCO2 mutations (at least 26 including deletions, insertions and premature stop codons) have been reported with the most common mutation being the E140K mutation. Interestingly, patients that were homozygous for the E140K mutation presented with a milder phenotype and delayed onset of disease (2–4 months of age versus neonate onset for compound heterozygous).81

COX10 and COX15—Another prosthetic group unique to CIV is heme a, which is associated with the COX1 subunit. COX10 and COX15 functions are related to biosynthesis of heme a. COX10, a farnesyl transferase, catalyzes the first step of the heme a biosynthesis by incorporating a farnesyl group and converting heme b into heme o. Subsequently, heme o is converted to heme a by the action of COX15 and a monooxygenase (not characterized in humans). Defects in this pathway result in clinical symptoms with early onset and fatal outcome from 2 months to 4 years of age. The first case of a COX10 mutation was a newborn infant with severe lactic acidemia, hypotonia, ataxia and pyramidal symptoms in addition to leukodystrophy, and tubulopathy.82 A sibling presented with lactic acidosis after birth and died aged 5 days. Few other patients have been described suffering from anemia, sensorineural deafness and hypertrophic cardiomyopathy,83 anemia and LS83 and Leigh-like syndrome.84,85 A newborn infant with hypotonia, seizures, lactic acidosis and cardiomyopathy leading to death at 1 month of age was the first case reported with a COX15 mutation.83 Another infant had a similar but less dramatic clinical picture with hypotonia, motor regression, nystagmus, retinopathy, lactic acidosis and microcephaly by 7 months and LS by 1 year.86 A third case with a very slowly progressing LS survived at least 16 years.87 The CIV deficiency was 42% and 22% of control values in muscle and fibroblast, respectively, perhaps accounting for a milder phenotype.

Practice points • Most individuals affected by complex I and complex IV deficiencies have an uneventful prenatal period and deficiencies are evident postnatally. • Perinatal manifestations of BCS1L mutations present often with fetal growth restriction and lactacidosis. • Neonatal genetic screening of complex I, complex III, and complex IV deficiencies should include genes coding for specific chaperones in addition to structural subunits. • Early diagnosis of origin of OXPHOS defect could aid in treatment. • Treatments for OXPHOS defects address solely the symptoms. Research directions • Further studies are required to elucidate of the complete sequence of assembly steps of complex I, complex III and complex IV and its regulation. • A better understanding of the specific function of assembly chaperones and their interaction partners is required. • Research focusing on understanding the genotype–clinical phenotype and the influence of genetic background and environmental factors is necessary for effective treatments.

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 11

Acknowledgments

Funding sources NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

The research group of C.T. Moraes was funded by The James and Esther King Biomedical Research Program, Florida Department of Health (FD) and PHS grants NS041777, AG AG036871, CA085700 and EY10804 (CTM). The research group of V. Fellman was funded by Lund University funds, Swedish Royal Physiografic Society, Swedish Research Council 2008–2898, and Regional ALF funds.

References 1. Schaefer AM, Taylor RW, Turnbull DM, et al. The epidemiology of mitochondrial disorders – past, present and future. Biochim Biophys Acta. 2004; 1659:115–120. [PubMed: 15576042] 2. Cree LM, Samuels DC, Chinnery PF. The inheritance of pathogenic mitochondrial DNA mutations. Biochim Biophys Acta. 2009; 1792:1097–1092. [PubMed: 19303927] 3. Kerr DS. Treatment of mitochondrial electron transport chain disorders: a review of clinical trials over the past decade. Molec Genet Metab. 2010; 99:246–255. [PubMed: 20060349] 4. Wenz T, Williams SL, Bacman SR, et al. Emerging therapeutic approaches to mitochondrial diseases. Dev Disabil Res Rev. 2010; 16:219–229. [PubMed: 20818736] 5. Clason T, Ruiz T, Schagger H, et al. The structure of eukaryotic and prokaryotic complex I. J Struct Biol. 2010; 169:81–88. [PubMed: 19732833] 6. McKenzie M, Ryan MT. Assembly factors of human mitochondrial complex I and their defects in disease. IUBMB Life. 2010; 62:497–502. [PubMed: 20552642] 7. Perales-Clemente E, Fernandez-Vizarra E, Acin-Perez R, et al. Five entry points of the mitochondrially encoded subunits in mammalian complex I assembly. Molec Cell Biol. 2010; 30:3038–3047. [PubMed: 20385768] 8. Kirby DM, Crawford M, Cleary MA, et al. Respiratory chain complex I deficiency: an underdiagnosed energy generation disorder. Neurology. 1999; 52:1255–1264. [PubMed: 10214753] 9. Distelmaier F, Koopman WJ, van den Heuvel LP, et al. Mitochondrial complex I deficiency: from organelle dysfunction to clinical disease. Brain. 2009; 132:833–842. [PubMed: 19336460] 10. Kuffner R, Rohr A, Schmiede A, et al. Involvement of two novel chaperones in the assembly of mitochondrial NADH:Ubiquinone oxidoreductase (complex I). J Mol Biol. 1998; 283:409–417. [PubMed: 9769214] 11. Janssen R, Smeitink J, Smeets R, et al. CIA30 complex I assembly factor: a candidate for human complex I deficiency? Hum Genet. 2002; 110:264–270. [PubMed: 11935339] 12. Vogel RO, Janssen RJ, Ugalde C, et al. Human mitochondrial complex I assembly is mediated by NDUFAF1. FEBS J. 2005; 272:5317–5326. [PubMed: 16218961] 13. Dunning CR, McKenzie M, Sugiana C, et al. Human CIA30 is involved in the early assembly of mitochondrial complex I and mutations in its gene cause disease. 2007; 26:3227–3237. 14. Vogel RO, Janssen RJ, van den Brand MA, et al. Cytosolic signaling protein Ecsit also localizes to mitochondria where it interacts with chaperone NDUFAF1 and functions in complex I assembly. Genes Dev. 2007; 21:615–624. [PubMed: 17344420] 15. Ogilvie I, Kennaway NG, Shoubridge EA. A molecular chaperone for mitochondrial complex I assembly is mutated in a progressive encephalopathy. J Clin Invest. 2005; 115:2784–2792. [PubMed: 16200211] 16. Vogel RO, van den Brand MA, Rodenburg RJ, et al. Investigation of the complex I assembly chaperones B17.2L and NDUFAF1 in a cohort of CI deficient patients. Molec Genet Metab. 2007; 91:176–182. [PubMed: 17383918] 17. Barghuti F, Elian K, Gomori JM, et al. The unique neuroradiology of complex I deficiency due to NDUFA12L defect. Molec Genet Metab. 2008; 94:78–82. [PubMed: 18180188] 18. Janssen RJ, Distelmaier F, Smeets R, et al. Contiguous gene deletion of ELOVL7, ERCC8 and NDUFAF2 in a patient with a fatal multisystem disorder. Hum Molec Genet. 2009; 18:3365–3374. [PubMed: 19525295]

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 12

19. Sugiana C, Pagliarini DJ, McKenzie M, et al. Mutation of C20orf7 disrupts complex I assembly and causes lethal neonatal mitochondrial disease. Am J Hum Genet. 2008; 83:468–478. [PubMed: 18940309] NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript 20. Gerards M, Sluiter W, van den Bosch BJ, et al. Defective complex I assembly due to C20orf7 mutations as a new cause of Leigh syndrome. J Med Genet. 2010; 47:507–512. [PubMed: 19542079] 21. Saada A, Edvardson S, Rapoport M, et al. C6ORF66 is an assembly factor of mitochondrial complex I. Am J Hum Genet. 2008; 82:32–38. [PubMed: 18179882] 22. Saada A, Vogel RO, Hoefs SJ, et al. Mutations in NDUFAF3 (C3ORF60), encoding an NDUFAF4 (C6ORF66)-interacting complex I assembly protein, cause fatal neonatal mitochondrial disease. Am J Hum Genet. 2009; 84:718–727. [PubMed: 19463981] 23. Pagliarini DJ, Calvo SE, Chang B, et al. A mitochondrial protein compendium elucidates complex I disease biology. Cell. 2008; 134:112–123. [PubMed: 18614015] 24. Bych K, Kerscher S, Netz DJ, et al. The iron-sulphur protein Ind1 is required for effective complex I assembly. EMBO J. 2008; 27:1736–1746. [PubMed: 18497740] 25. Sheftel AD, Stehling O, Pierik AJ, et al. Human ind1, an iron-sulfur cluster assembly factor for respiratory complex I. Molec Cell Biol. 2009; 29:6059–6073. [PubMed: 19752196] 26. Nouws J, Nijtmans L, Houten SM, et al. Acyl-CoA dehydrogenase 9 is required for the biogenesis of oxidative phosphorylation complex I. Cell Metab. 2010; 12:283–294. [PubMed: 20816094] 27. Gerards M, van den Bosch BJ, Danhauser K, et al. Riboflavin-responsive oxidative phosphorylation complex I deficiency caused by defective ACAD9: new function for an old gene. Brain. 2011; 134:210–219. [PubMed: 20929961] 28. Haack TB, Danhauser K, Haberberger B, et al. Exome sequencing identifies ACAD9 mutations as a cause of complex I deficiency. Nat Genet. 2010; 42:1131–1134. [PubMed: 21057504] 29. Vahsen N, Cande C, Briere JJ, et al. AIF deficiency compromises oxidative phosphorylation. EMBO J. 2004; 23:4679–4689. [PubMed: 15526035] 30. Ghezzi D, Sevrioukova I, Invernizzi F, et al. Severe X-linked mitochondrial encephalomyopathy associated with a mutation in apoptosis-inducing factor. Am J Hum Genet. 2010; 86:639–649. [PubMed: 20362274] 31. Hagerhall C. Succinate: quinone oxidoreductases. Variations on a conserved theme. Biochim Biophys Acta. 1997; 1320:107–141. [PubMed: 9210286] 32. Sun F, Huo X, Zhai Y, et al. Crystal structure of mitochondrial respiratory membrane protein complex II. Cell. 2005; 121:1043–1057. [PubMed: 15989954] 33. Rutter J, Winge DR, Schiffman JD. Succinate dehydrogenase – assembly, regulation and role in human disease. Mitochondrion. 2010; 10:393–401. [PubMed: 20226277] 34. Ghezzi D, Goffrini P, Uziel G, et al. SDHAF1, encoding a LYR complex-II specific assembly factor, is mutated in SDH-defective infantile leukoencephalopathy. Nat Genet. 2009; 41:654–656. [PubMed: 19465911] 35. Hao HX, Khalimonchuk O, Schraders M, et al. SDH5, a gene required for flavination of succinate dehydrogenase, is mutated in paraganglioma. Science. 2009; 325:1139–1142. [PubMed: 19628817] 36. Bugiani M, Lamantea E, Invernizzi F, et al. Effects of riboflavin in children with complex II deficiency. Brain Dev. 2006; 28:576–581. [PubMed: 16737791] 37. van Baars F, Cremers C, van den Broek P, et al. Genetic aspects of nonchromaffin paraganglioma. Hum Genet. 1982; 60:305–309. [PubMed: 6286462] 38. Tzagoloff A, Jang J, Glerum DM, et al. FLX1 codes for a carrier protein involved in maintaining a proper balance of flavin nucleotides in yeast mitochondria. J Biol Chem. 1996; 271:7392–7397. [PubMed: 8631763] 39. Bafunno V, Giancaspero TA, Brizio C, et al. Riboflavin uptake and FAD synthesis in Saccharomyces cerevisiae mitochondria: involvement of the Flx1p carrier in FAD export. J Biol Chem. 2004; 279:95–102. [PubMed: 14555654] 40. Dibrov E, Fu S, Lemire BD. The Saccharomyces cerevisiae TCM62 gene encodes a chaperone necessary for the assembly of the mitochondrial succinate dehydrogenase (complex II). J Biol Chem. 1998; 273:32042–32048. [PubMed: 9822678]

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 13

41. Klanner C, Neupert W, Langer T. The chaperonin-related protein Tcm62p ensures mitochondrial gene expression under heat stress. FEBS Lett. 2000; 470:365–369. [PubMed: 10745098]

NIH-PA Author Manuscript NIH-PA Author Manuscript42. Vander NIH-PA Author Manuscript Heiden MG, Choy JS, VanderWeele DJ, et al. Bcl-x(L) complements Saccharomyces cerevisiae genes that facilitate the switch from glycolytic to oxidative metabolism. J Biol Chem. 2002; 277:44870–44876. [PubMed: 12244097] 43. Schagger H. Respiratory chain supercomplexes of mitochondria and bacteria. Biochim Biophys Acta. 2002; 1555:154–159. [PubMed: 12206908] 44. McKenzie M, Lazarou M, Thorburn DR, et al. Mitochondrial respiratory chain supercomplexes are destabilized in Barth syndrome patients. J Molec Biol. 2006; 361:462–469. [PubMed: 16857210] 45. de Lonlay P, Valnot I, Barrientos A, et al. A mutant mitochondrial respiratory chain assembly protein causes complex III deficiency in patients with tubulopathy, encephalopathy and liver failure. Nat Genet. 2001; 29:57–60. [PubMed: 11528392] 46. Ghezzi D, Arzuffi P, Zordan M, et al. Mutations in TTC19 cause mitochondrial complex III deficiency and neurological impairment in humans and flies. Nat Genet. 2011; 43:259–263. [PubMed: 21278747] 47. Benit P, Lebon S, Rustin P. Respiratory-chain diseases related to complex III deficiency. Biochim Biophys Acta. 2009; 1793:181–185. [PubMed: 18601960] 48. Andreu AL, Hanna MG, Reichmann H, et al. Exercise intolerance due to mutations in the cytochrome b gene of mitochondrial DNA. N Engl J Med. 1999; 341:1037–1044. [PubMed: 10502593] 49. Johns DR, Neufeld MJ. Cytochrome b mutations in Leber hereditary optic neuropathy. Biochem Biophys Res Commun. 1991; 181:1358–1364. [PubMed: 1764087] 50. Blakely EL, Mitchell AL, Fisher N, et al. A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast. FEBS J. 2005; 272:3583–3592. [PubMed: 16008558] 51. Keightley JA, Anitori R, Burton MD, et al. Mitochondrial encephalomyopathy and complex III deficiency associated with a stop-codon mutation in the cytochrome b gene. Am J Hum Genet. 2000; 67:1400–1410. [PubMed: 11047755] 52. Fragaki K, Procaccio V, Bannwarth S, et al. A neonatal polyvisceral failure linked to a de novo homoplasmic mutation in the mitochondrially encoded cytochrome b gene. Mitochondrion. 2009; 9:346–352. [PubMed: 19563916] 53. Haut S, Brivet M, Touati G, et al. A deletion in the human QP-C gene causes a complex III deficiency resulting in hypoglycaemia and lactic acidosis. Hum Genet. 2003; 113:118–122. [PubMed: 12709789] 54. Barel O, Shorer Z, Flusser H, et al. Mitochondrial complex III deficiency associated with a homozygous mutation in UQCRQ. Am J Hum Genet. 2008; 82:1211–1216. [PubMed: 18439546] 55. Nobrega FG, Nobrega MP, Tzagoloff A. BCS1, a novel gene required for the expression of functional Rieske iron-sulfur protein in Saccharomyces cerevisiae. EMBO J. 1992; 11:3821–3829. [PubMed: 1327750] 56. Cruciat CM, Hell K, Folsch H, et al. Bcs1p, an AAA-family member, is a chaperone for the assembly of the cytochrome bc(1) complex. EMBO J. 1999; 18:5226–5233. [PubMed: 10508156] 57. Petruzzella V, Tiranti V, Fernandez P, et al. Identification and characterization of human cDNAs specific to BCS1, PET112, SCO1, COX15, and COX11, five genes involved in the formation and function of the mitochondrial respiratory chain. Genomics. 1998; 54:494–404. [PubMed: 9878253] 58. Hinson JT, Fantin VR, Schonberger J, et al. Missense mutations in the BCS1L gene as a cause of the Björnstad syndrome. N Engl J Med. 2007; 356:809–819. [PubMed: 17314340] 59. Selvaag E. Pili torti and sensorineural hearing loss. A follow-up of Björnstad’s original patients and a review of the literature. Eur J Dermatol. 2000; 10:91–97. [PubMed: 10694305] 60. Tuppen HA, Fehmi J, Czermin B, et al. Long-term survival of neonatal mitochondrial complex III deficiency associated with a novel BCS1L gene mutation. Molec Genet Metab. 2010; 100:345– 348. [PubMed: 20472482]

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 14

61. Blazquez A, Gil-Borlado MC, Moran M, et al. Infantile mitochondrial encephalomyopathy with unusual phenotype caused by a novel BCS1L mutation in an isolated complex III-deficient patient. Neuromuscul Disord. 2009; 19:143–146. [PubMed: 19162478] NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript 62. De Meirleir L, Seneca S, Damis E, et al. Clinical and diagnostic characteristics of complex III deficiency due to mutations in the BCS1L gene. Am J Med Genet A. 2003; 121:126–131. [PubMed: 12910490] 63. Fernandez-Vizarra E, Bugiani M, Goffrini P, et al. Impaired complex III assembly associated with BCS1L gene mutations in isolated mitochondrial encephalopathy. Hum Mol Genet. 2007; 16:1241–1252. [PubMed: 17403714] 64. Gil-Borlado MC, Gonzalez-Hoyuela M, Blazquez A, et al. Pathogenic mutations in the 5′ untranslated region of BCS1L mRNA in mitochondrial complex III deficiency. Mitochondrion. 2009; 9:299–305. [PubMed: 19389488] 65. Morris AA, Taylor RW, Birch-Machin MA, et al. Neonatal Fanconi syndrome due to deficiency of complex III of the respiratory chain. Pediatr Nephrol. 1995; 9:407–411. [PubMed: 7577396] 66. Visapaa I, Fellman V, Vesa J, et al. GRACILE syndrome, a lethal metabolic disorder with iron overload, is caused by a point mutation in BCS1L. Am J Hum Genet. 2002; 71:863–876. [PubMed: 12215968] 67. Fellman V, Lemmela S, Sajantila A, et al. Screening of BCS1L mutations in severe neonatal disorders suspicious for mitochondrial cause. J Hum Genet. 2008; 53:554–558. [PubMed: 18386115] 68. Barrientos A, Gouget K, Horn D, et al. Suppression mechanisms of COX assembly defects in yeast and human: insights into the COX assembly process. Biochim Biophys Acta. 2009; 1793:97–107. [PubMed: 18522805] 69. Pecina P, Houstkova H, Hansikova H, et al. Genetic defects of cytochrome c oxidase assembly. Physiol Res. 2004; 53:S213–S223. [PubMed: 15119951] 70. Piekutowska-Abramczuk D, Magner M, Popowska E, et al. SURF1 missense mutations promote a mild Leigh phenotype. Clin Genet. 2009; 76:195–204. [PubMed: 19780766] 71. Rahman S, Blok RB, Dahl HH, et al. Leigh syndrome: clinical features and biochemical and DNA abnormalities. Ann Neurol. 1996; 39:343–351. [PubMed: 8602753] 72. Bundschuh FA, Hannappel A, Anderka O, et al. Surf1, associated with Leigh syndrome in humans, is a heme-binding protein in bacterial oxidase biogenesis. J Biol Chem. 2009; 284:25735–25741. [PubMed: 19625251] 73. Mootha VK, Lepage P, Miller K, et al. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics. Proc Natl Acad Sci USA. 2003; 100:605–610. [PubMed: 12529507] 74. Sasarman F, Brunel-Guitton C, Antonicka H, et al. LRPPRC and SLIRP interact in a ribonucleoprotein complex that regulates posttranscriptional gene expression in mitochondria. Molec Biol Cell. 2010; 21:1315–1323. [PubMed: 20200222] 75. Weraarpachai W, Antonicka H, Sasarman F, et al. Mutation in TACO1, encoding a translational activator of COX I, results in cytochrome c oxidase deficiency and late-onset Leigh syndrome. Nat Genet. 2009; 41:833–837. [PubMed: 19503089] 76. Seeger J, Schrank B, Pyle A, et al. Clinical and neuropathological findings in patients with TACO1 mutations. Neuromuscul Disord. 2010; 20:720–724. [PubMed: 20727754] 77. Leary SC. Redox regulation of SCO protein function: controlling copper at a mitochondrial crossroad. Antioxid Redox Signal. 2010; 13:1403–1416. [PubMed: 20136502] 78. Valnot I, Osmond S, Gigarel N, et al. Mutations of the SCO1 gene in mitochondrial cytochrome c oxidase deficiency with neonatal-onset hepatic failure and encephalopathy. Am J Hum Genet. 2000; 67:1104–1109. [PubMed: 11013136] 79. Stiburek L, Vesela K, Hansikova H, et al. Loss of function of Sco1 and its interaction with cytochrome c oxidase. Am J Physiol Cell Physiol. 2009; 296:C1218–C1226. [PubMed: 19295170] 80. Papadopoulou LC, Sue CM, Davidson MM, et al. Fatal infantile cardioencephalomyopathy with COX deficiency and mutations in SCO2, a COX assembly gene. Nat Genet. 1999; 23:333–337. [PubMed: 10545952]

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 15

81. Joost K, Rodenburg R, Piirsoo A, et al. A novel mutation in the SCO2 gene in a neonate with early-onset cardioencephalomyopathy. Pediatr Neurol. 2010; 42:227–230. [PubMed: 20159436]

NIH-PA Author Manuscript NIH-PA Author Manuscript82. Valnot NIH-PA Author Manuscript I, von Kleist-Retzow JC, Barrientos A, et al. A mutation in the human heme A:farnesyltransferase gene (COX10) causes cytochrome c oxidase deficiency. Hum Molec Genet. 2000; 9:1245–1249. [PubMed: 10767350] 83. Antonicka H, Leary SC, Guercin GH, et al. Mutations in COX10 result in a defect in mitochondrial heme A biosynthesis and account for multiple, early-onset clinical phenotypes associated with isolated COX deficiency. Hum Molec Genet. 2003; 12:2693–2702. [PubMed: 12928484] 84. Coenen MJ, Smeitink JA, Pots JM, et al. Sequence analysis of the structural nuclear encoded subunits and assembly genes of cytochrome c oxidase in a cohort of 10 isolated complex IVdeficient patients revealed five mutations. J Child Neurol. 2006; 21:508–511. [PubMed: 16948936] 85. Coenen MJ, van den Heuvel LP, Ugalde C, et al. Cytochrome c oxidase biogenesis in a patient with a mutation in COX10 gene. Ann Neurol. 2004; 56:560–564. [PubMed: 15455402] 86. Oquendo CE, Antonicka H, Shoubridge EA, et al. Functional and genetic studies demonstrate that mutation in the COX15 gene can cause Leigh syndrome. J Med Genet. 2004; 41:540–544. [PubMed: 15235026] 87. Bugiani M, Tiranti V, Farina L, et al. Novel mutations in COX15 in a long surviving Leigh syndrome patient with cytochrome c oxidase deficiency. J Med Genet. 2005; 42:28. 88. Fassone E, Duncan AJ, Taanman JW, et al. FOXRED1, encoding an FAD-dependent oxidoreductase complex-I-specific molecular chaperone, is mutated in infantileonset mitochondrial encephalopathy. Hum Molec Genet. 2010; 19:4837e47. [PubMed: 20858599]

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 16 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Figure 1. BCS1L is encoded by eight exons with the start codon in exon 2 and the stop codon in exon 8. Mutations in the 5′UTR region causing complex III deficiency are shown. In the BCS1L protein three functional domains, the import domain, the BCS1L_N-specific domain and the AAA_ATPase domain can be identfied. BCS1L mutations are indicated by their respective amino acid exchange. Mutations occur in all domains of the protein but cause a wide spectrum of symptoms ranging from mild complex III deficiency and Björnstad syndrome (shown above the BCS1L protein) to mutations causing mainly hepatopathy (bold, italic), mainly encephalopathy (underlined) or hepatopathy and encephalopathy (bold, italic and underlined) (shown below the BCS1L protein). BCS1L mutations are indicated by their respective amino acid exchange. Patients identified so far are either homozygous for mutations (P99L, S277N, S78G, T50A, G129R) or compound heterozygotes (R45C/R56ter, V327A/R56ter, G35R/184C, S78G/144Q, R73C/F368I, R155P/V353M).

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Diaz et al. Page 17 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript 15 22 21 69 83 78,79 80,81 Ref. 19–20 26–28 82,83,85 45,48,60–66 Table 1 Other Weak muscle Weak muscle Weak muscle + + Liver disease + + + + + + + + thy myopa Cardio + + + + + + + + Leigh syndrome + + + + + + + + + + Lactic acidosis + + IUGR Stop Exon2 ML1 159F L65P R45X G77R S344P L229P P174L P225L R122P R122T G132S T204K T196K H152X R217W Various Various Various Various Δ Mutation SCO1 SCO2 factor BCS1L SURF1 COX10 COX15 C20orf7 C3orf60 C6orf66 ACAD9 NDUFA2 Assembly NDUFAF3 NDUFAF4 Mutations in assembly factors as cause of neonatal mitochondrial disorder IUGR, intrauterine growth restriction.

Semin Fetal Neonatal Med. Author manuscript; available in PMC 2012 August 1. Annals of Medicine. 2005; 37: 222–232

Mitochondrial DNA and disease

SALVATORE DIMAURO & GUIDO DAVIDZON

Department of Neurology, Columbia University Medical Center, New York, NY, U S A

Abstract The small circle of mitochondrial DNA (mtDNA) present in all human cells has proven to be a veritable Pandora’s box of pathogenic mutations and rearrangements. In this review, we summarize the distinctive rules of mitochondrial genetics (maternal inheritance, mitotic segregation, heteroplasmy and threshold effect), stress the relatively high prevalence of mtDNA-related diseases, and consider recent additions to the already long list of pathogenic mutations (especially mutations affecting protein-coding genes). We then discuss more controversial issues, including the functional or pathological role of mtDNA haplotypes, the pathogenicity of homoplasmic mutations and the still largely obscure pathophysiology of mtDNA mutations.

Key words: Haplotypes, heteroplasmy, homoplasmy, maternal inheritance, mitochondrial DNA, mtDNA

Introduction synthase), a tiny rotary machine that generates ATP as protons flow back into the matrix through its Mitochondrial DNA (mtDNA) is a fossil molecule membrane-embedded F portion, the rotor of the proving that endosymbiosis did occur, when – about 0 turbine (3). 1.5 billion years ago – protobacteria populated primordial eukaryotic cells and took permanent Starting in 1988, when mutations in mtDNA were residence in the new environment (1). Unlike a first associated with human disease (4,5), the circle of mtDNA has become crowded with pathogenic

For personal use only. fossil, however, mtDNA has lost its independence but not its life and it keeps functioning (sometimes mutations, and three principles of mitochondrial malfunctioning, which is the reason for this article) genetics should, therefore, be familiar to the practi- under the overarching control of the nuclear cing physician. genome. Human mtDNA (Figure 1) is a 16,569-kb circu- 1. Heteroplasmy and threshold effect. Each cell lar, double-stranded molecule, which contains 37 contains hundreds or thousands of mtDNA copies, genes: 2 rRNA genes, 22 tRNA genes, and 13 which, at cell division, distribute randomly among structural genes encoding subunits of the mitochon- daughter cells. In normal tissues, all mtDNA drial respiratory chain, which is the ‘business end’ of molecules are identical (homoplasmy). Deleterious oxidative metabolism, where ATP is generated (2). mutations of mtDNA usually affect some but not all Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 Reducing equivalents produced in the Krebs cycle mtDNAs within a cell, a tissue, an individual and in the ß-oxidation spirals are passed along a (heteroplasmy), and the clinical expression of a series of protein complexes embedded in the inner pathogenic mtDNA mutation is largely determined mitochondrial membrane (the electron transport by the relative proportion of normal and mutant chain), which consists of four multimeric complexes genomes in different tissues. A minimum critical (I to IV) plus two small electron carriers, coenzyme number of mutant mtDNAs is required to cause Q (or ubiquinone) and cytochrome c (Figure 2). mitochondrial dysfunction in a particular organ or The energy generated by the reactions of the tissue and mitochondrial disease in an individual electron transport chain is used to pump protons (threshold effect). from the mitochondrial matrix into the space between the inner and outer mitochondrial mem- 2. Mitotic segregation. At cell division, the proportion branes. This creates an electrochemical proton of mutant mtDNAs in daughter cells may shift and gradient, which is utilized by complex V (or ATP the phenotype may change accordingly. This

Correspondence: Salvatore DiMauro, MD, 4-420 College of Physicians & Surgeons, 630 West 168th Street, New York, NY 10032, U S A. Fax: 212-305- 3986. E-mail: [email protected] ISSN 0785-3890 print/ISSN 1365-2060 online # 2005 Taylor & Francis Ltd DOI: 10.1080/07853890510007368 Mitochondrial DNA and disease 223

Abbreviations Key messages ATP adenosine triphosphate N Mitochondrial DNA (mtDNA) is a CK creatine kinase Pandora’s box of pathogenic mutations COX cytochrome c oxidase potentially affecting every organ of the cyt b cytochrome b body. mtDNA-related diseases are usually KSS Kearns-Sayre syndrome transmitted by non-Mendelian, maternal LHON Leber hereditary optic inheritance. neuropathy N Pathogenic mutations of mtDNA can be LS Leigh syndrome divided into two main groups, those affecting MELAS mitochondrial mitochondrial protein synthesis in toto, and encephalomyopathy, lactic those affecting individual proteins of the acidosis, stroke-like episodes respiratory chain. MERRF myoclonus epilepsy and ragged- N The functional and possible pathogenic red fibers significance of mtDNA haplotypes is under MILS maternally inherited Leigh intense investigation. Homoplasmy does not syndrome rule out pathogenicity. MRS nuclear magnetic resonance N Although we have learnt a lot about mtDNA spectroscopy mutations, the pathophysiology of mtDNA- MtDNA mitochondrial DNA related diseases remains largely unknown. NARP neuropathy, ataxia, retinitis pigmentosa ND NADH dehydrogenase by mtDNA mutations (6). This concept is illustrated PCR polymerase chain reaction in Table I, a compilation of symptoms and signs PEO progressive external described in mitochondrial encephalomyopathies ophthalmoplegia due to single rearrangements (KSS, PS, and PEO), PS Pearson syndrome to point mutations in genes affecting protein synth- rRNA ribosomal RNA esis in toto (MELAS; MERRF), and to a protein- RRF ragged-red fibers coding gene (NARP and MILS). This table For personal use only. tRNA transfer RNA highlights the clinical features of the most common SDH succinate dehydrogenase syndromes, which are difficult to miss in typical patients. It is also a reminder that any combination of these symptoms and signs ought to alert the astute phenomenon, called mitotic segregation, explains clinician to the possibility of a mtDNA-related how certain patients with mtDNA-related disorders disorder. A third function of the table is to serve as may actually shift from one clinical phenotype to a a concise descriptor of the six most common different one as they grow older. mtDNA-related syndromes, which will not be described here in any more detail. If more details 3. Maternal inheritance. At fertilization, all mtDNA are needed, the reader is referred to textbook reviews

Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 derives from the ovum. Therefore, the mode of (6). transmission of mtDNA and of mtDNA point As shown in Table II, mtDNA-related disorders mutations (single deletions of mtDNA are usually fall into two major groups: 1) those due to mutations sporadic events) differs from Mendelian inheritance. in genes involved in mitochondrial protein synthesis, A mother carrying a mtDNA point mutation will and 2) those due to mutations in genes encoding pass it on to all her children (males and females), but individual proteins of the respiratory chain. Clinical only her daughters will transmit it to their progeny. features are not terribly useful in differentiating the A disease expressed in both sexes but with no two groups, but laboratory results, muscle biopsy, evidence of paternal transmission is strongly and muscle biochemistry are better discriminators suggestive of a mtDNA point mutation. and offer useful clues for a targeted molecular Over 150 point mutations and innumerable large- analysis. In defects of protein synthesis, lactic scale rearrangements have been associated with a acidosis is seen more consistently and tends to be bewildering variety of diseases (Figure 1). This is higher, and muscle biopsies almost invariably show not surprising when one considers that mitochondria RRF, which are characteristically COX-negative are ubiquitous organelles and all human tissues, in (except in typical MELAS, where RRF stain with isolation or in various combinations, can be affected the COX reaction, though not intensely so). Not 224 S. DiMauro & G. Davidzon For personal use only.

Figure 1. Morbidity map of the human mitochondrial genome. The map of the 16,569 bp mtDNA shows differently colored areas representing the protein-coding genes for the seven subunits of complex I (ND), the three subunits of cytochrome c oxidase (CO), cytochrome b (cyt b), and the two subunits of ATP synthase (A6 and A8), the 12S and 16S rRNAs (12S, 16S), and the 22 tRNAs identified by one-letter codes for the corresponding amino acids. See list of abbreviations. FBSN5familial bilateral striatal necrosis. Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13

Figure 2. Schematic representation of the respiratory chain. Subunits encoded by mtDNA are in blue and subunits encoded by nuclear DNA are in red. Electrons (e-) flow along the electron transport chain, and protons (H+) are pumped from the matrix to the intermembrane space through complexes I, III, and IV, then back into the matrix through complex V, producing ATP. Coenzyme Q (CoQ) and cytochrome c are electron carriers. Mitochondrial DNA and disease 225

Table I. Clinical features in mitochondrial diseases associated with mtDNA mutations. Clinical features of mtDNA-related diseases. Boxes highlight typical features of specific syndromes (except Leigh syndrome, which is defined by the neuroradiological or neuropathological alterations). CNS5central nervous system; PNS5peripheral nervous system; GI5gastrointestinal system; ENT5ear-nose-throat. D- mtDNA denotes deleted mtDNA. Other abbreviations are explained in the List of Abbreviations.

D-mtDNA tRNA ATPase

Tissue Symptom/sign KSS Pearson n MERRF MELAS NARP MILS

CNS Seizures 22 ++ 2 + Ataxia + 2 ++ +¡ Myoclonus 22 + ¡ 22 Psychomotor retardation 222 2 2 + Psychomotor regression + 2 ¡ + 22 Hemiparesis/hemianopia 222 + 22 Cortical blindness 222 + 22 Migraine-like headaches 222 + 22 Dystonia 222 + 2 + PNS Peripheral neuropathy ¡ 2 ¡¡ + 2 Muscle Weakness + 2 ++ ++ Ophthalmoplegia + ¡ 22 22 Ptosis + 22 2 22 Eye Pigmentary retinopathy + 22 2 + ¡ Optic atrophy 222 2 ¡¡ Cataracts 222 2 22 Blood Sideroblastic anemia ¡ + 22 22 Endocrine Diabetes mellitus ¡ 22¡ 22 Short stature + 2 ++ 22 Hypoparathyroidism ¡ 22 2 22 Heart Conduction block + 22¡ 22 Cardiomyopathy ¡ 22¡ 2 ¡ GI Exocrine pancreatic ¡ + 22 22 dysfunction Intestinal pseudo- 222 2 22 obstruction

For personal use only. ENT Sensorineural hearing loss 22 ++ ¡ 2 Kidney Fanconi’s syndrome ¡¡ 2 ¡ 22 Laboratory Lactic acidosis +++ + 2 ¡ Muscle biopsy: RRF + ¡ ++ 22 Inheritance Maternal 22 ++ ++ Sporadic ++22 22

Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 Table II. Clinical, morphological, and biochemical features of mtDNA-related disorders.

Type Mutation CLINICAL LA RRF BIOCHEMISTRY

KSS ++(COX-) Y I, III, IV Single deletions PEO ++(COX-) Y I, III, IV Mutations affecting PS 22 mitochondrial MELAS. ++(COX)+ Y I, QIII, IV protein synthesis MERRF & other in toto tRNA mutations +(COX-) Y I, III, IV multisystemic + myopathy ++(COX-) Y I, III, IV LHON 22 Q I(+/2) ND genes MELAS, LS ++/2(COX+) Y I myopathy +/2 +(COX+) Y I Mutations in multisystemic +/2 +(COX+) Y III protein-coding Cyt b myopathy ++(COX+) Y III genes multisystemic +/2 +/2 (COX-) Y IV COX genes myopathy ++(COX-) Y IV ATPase 6 gene NARP/MILS +/22 Y V 226 S. DiMauro & G. Davidzon

surprisingly, given the impaired synthesis of all 13 mutations are considered, the minimum prevalence mtDNA-encoded subunits, biochemical analysis of is at least 1 in 5,000 (12). To focus on patients with muscle shows combined defects of all complexes mtDNA mutations, a study of adult patients in containing such subunits, which are easily demon- northern England had shown an overall prevalence strable for complexes I, III, and IV, but more of 6.57/100,000 (13), with a particularly high difficult to document for complex V, which is not prevalence of LHON (3.22/100,000) (14). An measured routinely. In contrast, the biochemical apparent discrepancy between the high prevalence finding of a specific respiratory chain deficiency is a of the MELAS-3243G-related symptoms in north- strong indicator that a mutation may be present in ern Finland (5.71/100,000) (15) and a much lower one of the mtDNA genes encoding subunits of that prevalence (0.95/100,000) in northern England particular complex. Until a few years ago, it was (13), was apparently due to an underestimation of believed that RRF were not seen in disorders due to the affected English population (12). Two epide- mutations in protein-coding genes. This belief was miological studies of affected children have been based on our experience with LHON (due to conducted in antipodal countries, Sweden (16) and mutations in three ND genes) and NARP/MILS Australia (17). The results were remarkably similar, (due to mutations in the ATPase 6 gene), but was both in terms of overall prevalence of mitochon- proven erroneous by studies of patients with myo- drial diseases (about 5/100,000) and in terms of pathy or multisystem disorders and mutations in prevalence of mtDNA-related disorders, which ND, cyt b, or COX genes. In contrast to the COX- accounted for about 15% of the total. negative RRF typical of defects of protein synthesis, the RRF in these patients stain intensely both with the SDH stain and with the COX stain (7), except, Inheritance of single mtDNA deletions of course, for patients with mutations in COX genes (8). By and large, single mtDNA deletions are neither There have been some practical improvements in inherited from the mother nor transmitted to the our diagnostic armamentarium, such as the observa- progeny and disorders due to single mtDNA tion that urinary sediment cells – obtainable more deletions, KSS, PEO, and PS, are almost always easily and less invasively than blood samples – are sporadic. This phenomenon is attributed to a more sensitive than blood cells for the detection ‘bottleneck’ between the ovum (where the giant

For personal use only. and quantitation of the A3243G mutation in deletion probably occurs) and the embryo, such that oligosymptomatic MELAS patients (9,10). This is only a small minority of maternal mtDNA populates almost certainly true for other mtDNA mutations, the fetus (2). However, a few cases of maternal although large series are not yet available. Another transmission have been reported (18–21), raising the useful test in patients with MELAS and in their question of how reassuring can we be in counseling oligosymptomatic or asymptomatic relatives is pro- carriers of single mtDNA deletions. A recent multi- ton magnetic resonance spectroscopy (MRS) of the center retrospective study of 226 families has brain, which allows the measurement of cerebro- confirmed that the risk of a carrier woman to have spinal fluid (CSF) lactate non-invasively. In a large affected children is very small, but finite (1 in 24 cohort, there was a good correlation between births) and has disproved the idea that the risk increases with maternal age (22). Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 cerebral lactic acidosis – estimated by ventricular MRS lactate levels – and severity of neurological and neuropsychological impairment (11). The rest of this review will be devoted to new and con- Pathogenic mutations in mtDNA: Recent troversial issues regarding the pathology of mtDNA arrivals mutations. Although the small circle of mtDNA is getting saturated with pathogenic mutations, it is true now – as it was 5 years ago (23) – that we are not yet Frequency of mtDNA-related diseases scraping the bottom of the barrel. Novel mutations A flurry of epidemiological studies in recent years are still being reported, especially in protein-coding (reviewed by Schaefer et al. (12)) has confirmed the genes, albeit at a slower pace. A first flurry of new notion that mitochondrial diseases – long considered mutations in protein-coding genes was associated of purely academic interest – are, in fact, among the with the all-too-frequent but often elusive syndrome most common genetic disorders and a major burden of exercise intolerance (with or without episodic for society. When studies in children and adults are myoglobinuria). In retrospect, it was surprising that combined and both nuclear DNA and mtDNA these symptoms, long associated with defects in the Mitochondrial DNA and disease 227

utilization of the two major ‘muscle fuels’, glycogen LS/LHON (48). Muscle biopsy in these patients and fatty acids, had not been seen in defects of the occasionally shows RRF or pre-RRF (fibers with respiratory chain, the quintessential energy-yielding subsarcolemmal rims of hyperintense SDH stain) pathway (24). Within a few years, numerous patients that are invariably COX-positive (Table III). with exercise intolerance were found (or rediscov- Two recently reported mutations are of special ered) to have mutations in genes encoding subunits interest because of their unusual clinical phenotypes. of complex I (25–27), complex IV (8,28,29) and The first, G12147A in tRNAHis, was described in a especially in the one mtDNA gene for complex III, previously normal 19-year-old man, who had an cyt b (7,30–36). One reason that delayed the unusually dramatic presentation, with stroke follow- identification of these patients is that these muta- ing a seizure and complicated by severe brain edema tions are de novo events occurring in myoblasts or leading to emergency temporal lobectomy (51). The myoblast precursors after germ-layer differentiation: stroke was preceded by rhabdomyolysis (serum CK thus, contrary to the ‘rules’ of mitochondrial 37, 880 IU/L) and further complicated by Reye-like genetics, these patients are sporadic and the disease liver failure. The take-home message here is that is confined to skeletal muscle (7). As an unfortunate some mtDNA mutations can debut in a very stormy clinical consequence, these patients are often mis- fashion, suggesting, as in this young man, venous diagnosed as having chronic fatigue syndrome, infarction or encephalitis. The second mutation, fibromyalgia rheumatica or conversion syndrome. G611A in tRNAPhe, is unusual in that it presented in As a matter of curiosity, one of these mutations, a a young woman with the clinical phenotype of microdeletion in the ND2 gene (27), generated a MERRF (52), which thus far has been associated furor in mitochondrial circles not in and by itself, but only with mutations in the tRNALys gene (53). because it led to the discovery that most skeletal muscle mtDNA in this patient was of paternal origin. This revolutionary finding was shown to be The question of homoplasmy the proverbial exception that confirms the rule (37– 39) but the unique coexistence of paternal and Because mtDNA mutates spontaneously at a high maternal mtDNA in the same tissue made it possible rate and most changes are neutral polymorphisms, a to document that mtDNA molecules can recombine situation exploited in forensic medicine (54,55), a (40). set of canonical rules has been established to prove

For personal use only. More recently, another protein-coding gene has the pathogenicity of a novel mtDNA mutation. First, been the object of much attention and has reached the mutation should not be present in normal ‘hotspot’ status, ND5. Several mutations have been individuals of the same ethnic group. Second, it described, all associated with maternally inherited should alter a site conserved in evolution and, multisystemic disorders (Table III). One mutation therefore, functionally important. Third, it should (G13513A) seems to be particularly common and cause single or multiple respiratory chain enzyme causes MELAS (41,42), LS (43–45) or MELAS/ deficiencies in affected tissues or defects of mito- LHON overlap (46). Five other mutations in the chondrial protein synthesis and respiration demon- same gene have been associated with MELAS strable in cybrid cell lines. Fourth, there should be a (47,48), MELAS/LS (49), MELAS/MERRF (50) correlation between degree of heteroplasmy and

Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 and even a three-way overlap syndrome, MELAS/ clinical severity as well as a correlation between

Table III. Clinical syndromes, abundance of RRF, and complex I deficiency in patients with mutations in the ND5 gene. B, brain; L, liver; M, muscle.

Mutation Syndrome RRF Complex I Reference

G13513A MELAS +(COX+) 46% (B); 52% (L) (41) MELAS/LHON 5% (COX+) ‘isolated defect’ (M) (46) MELAS 1% (COX+) 42% (M) (42) LS 0 35% (M) (43) LS n.d. partial defect’’ (M) (44) LS 0 25% (M) (45) A13514G MELAS 0-several 40%–60% (M) (47) A13084T MELAS/LS 0 85% (M) (49) A12770G MELAS 0 normal (48) A13045C MELAS/LHON/LS 0 ‘mildly reduced’ (M) G13042A MELAS/MERRF 0 15%–57% (M) (50) 228 S. DiMauro & G. Davidzon

degree of heteroplasmy and cell pathology (best resolution Northern blots have shown decreased documented by single fiber PCR). steady-state levels of tRNAIle in the heart of patients As the last criterion implies, a corollary of these with the A4300G mutation (60), and decreased guidelines is that pathogenic mutations are usually levels of tRNAGlu in muscle of patients with the heteroplasmic whereas neutral polymorphisms are T14709C mutation (63). Similar studies are neces- homoplasmic. In general this is true, but there are sary to document a pathogenic role of the T4291C many exceptions and an increasing awareness of the mutation in patients with the metabolic syndrome. possible or documented pathogenicity of homoplas- Another major question underlying the patho- mic mutations. In fact, the first point mutation genic mechanism of homoplasmic mtDNA muta- (G11778A in ND4) associated with a human tions is why they are expressed in some family disease, LHON, was homoplasmic (5), as are other members but not in others and why they can result mutations causing LHON (56). Similarly, most non- in different clinical phenotypes. At least four factors syndromic forms of deafness are due to homoplas- can influence phenotypic expression: environmental mic mutations, including A15555G in the 12S factors, mtDNA haplotype, nuclear DNA back- rRNA gene (57), and two mutations in the ground, and tissue-specific expression of interacting tRNASer(UCN) gene, A7455G (58) and T7511C genes. The importance of environmental factors is (59). A homoplasmic mutation (A4300G) in exemplified by the deleterious effect of aminoglyco- tRNAIle caused maternally inherited hypertrophic side exposure in triggering deafness in carriers of the cardiomyopathy in two families (60), and a homo- A1555G mutation (57,68). The influence of plasmic mutation (C1624T) in tRNAVal caused mtDNA haplotype was shown by the higher pene- multiple neonatal deaths and LS in the offspring of trance of the A7455G mutation in a family that also an also homoplasmic but mildly affected woman harbored three ‘secondary’ LHON mutations (69). (61). The T14709C mutation in the tRNAGlu gene, The influence of nuclear background was illustrated typically associated with myopathy and diabetes by the different severity of complex I deficiency in (62), attained homoplasmy in several members of two cybrid cell lines, both homoplasmic for the one large family, some of whom – strangely – were A3460G LHON mutation, but derived from differ- 0 asymptomatic (63). The latest ‘cause cele`bre’ of ent rho cells (osteosarcoma and lung) (70). homoplasmy regards a large pedigree in which the ‘metabolic syndrome’ (syndrome X or dyslipidemic For personal use only. hypertension), which includes various combinations The importance of mtDNA haplotypes of central obesity, atherogenic dyslipidemia, hyper- In their migration out of Africa, human beings have tension, hypomagnesemia, and insulin resistance, accumulated distinctive variations from the mtDNA was transmitted maternally and attributed to a of our ancestral ‘mitochondrial Eve’, resulting in Ile homoplasmic mutation (T4291C) in the tRNA several haplotypes characteristic of different ethnic (64). Because the metabolic syndrome afflicts about groups (71). It has been suggested that different one fourth of the US population, this finding did not mtDNA haplotypes may modulate oxidative phos- go unnoticed (65). The challenge with this, as with phorylation, thus influencing the overall physiology other homoplasmic mutations, is to go beyond the of individuals and predisposing them to, or protect- association and to document a deleterious functional ing them from, certain diseases (71). Among the Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 effect. Nuclear magnetic resonance spectroscopy functional characteristics reportedly influenced by (MRS) and muscle biopsy were performed in a mtDNA haplotypes are intelligence quotient (IQ) single 55-year-old member of the family with the (72), spermatozoa swiftness (73) and adaptation to metabolic syndrome. MRS showed decreased ATP cold climates (74). Among the diseases, cardiomyo- production and a few pre-RRF were seen in the pathy (75), Alzheimer disease and dementia with biopsy – rather meager evidence of mitochondrial Lewy bodies (76), and multiple sclerosis (77) have dysfunction, especially considering the age of the been associated with specific mtDNA haplotypes. patient studied. Also, patients with LHON and certain mtDNA Most of the canonical criteria for pathogenicity haplogroups have a higher risk of developing listed above do not apply to homoplasmic mutations, blindness (78), whereas no link has been established except for biochemical evidence of respiratory chain between the variable phenotypic expression of dysfunction or direct evidence that the expression of MELAS-3243 and mtDNA haplotypes (79). In fact, mutated genes is impaired. Defective ATP produc- a recent retrospective multicenter study of patients tion due to distinct respiratory chain dysfunctions with MELAS and the A3243G mutation (80) has has been documented in cybrid cells harboring also failed to confirm a previously reported associa- different LHON mutations (66,67), and high tion between a polymorphic variant (A12308G) and Mitochondrial DNA and disease 229

increased risk of stroke (81). Clearly, much work abundant in the walls of cerebral arterioles (Tanji remains to be done to better define both the and Bonilla, unpublished), the 8344-MERRF muta- pathogenic role of homoplasmic mutations and the tion is abundant in the dentate nucleus of the modulatory role of haplotypes in health and disease. cerebellum (88), and both the MELAS mutation and single deletions abound in the choroid plexus (89). However, these data do not explain what Pathogenesis ‘directs’ each mutation to a particular area of the A recent review article by Neil Howell on mitochon- brain. drial diseases was aptly subtitled: ‘answering ques- Finally, mutations in different tRNA genes may tions and questioning answers’ (78). Seventeen years have different mechanisms of action, as suggested by after the discovery of pathogenic mutations in the selective tissue vulnerability associated with mtDNA, we have lots of answers, i.e. molecular mutations in certain tRNAs: for example, cardio- causes, but precious little understanding of how the pathy is often associated with mutations in tRNAIle; different molecular defects cause different syn- diabetes is a frequent manifestation of the T14709C dromes. In fact, it is surprising that mtDNA mutation in tRNAGlu (62) and multiple lipomas mutations should cause different syndromes in the have been reported only in patients with mutations first place. If, as conventional wisdom dictates, in tRNALys (53). But, again, these are associations, mtDNA rearrangements and point mutations in not explanations. It is fair to conclude that the rRNA or tRNA genes impair mitochondrial protein pathogenesis of mtDNA-related disorders is still synthesis and ATP production, it would be logical to largely terra incognita. expect a clinical swamp of ill-defined and over- This review does not exhaust the subject of the lapping symptoms and signs, as was originally title, ‘mitochondrial DNA and disease’. We have predicted by the ‘lumpers’ (82). Although clinical only considered disorders whose primary causes are overlap does occur in mtDNA-related diseases (see well-defined mtDNA mutations, but presumably above), it is fair to say that the ‘splitters’ won the day secondary mtDNA alterations are also involved in in that most mutations result in well defined and aging and neurodegenerative disorders (90) – a vast rather stereotypical syndromes. chapter that deserves a separate review. Nor have we One major obstacle to functional studies of considered therapy of mtDNA-related disorders, mtDNA mutations is the lack of animal models which is still woefully inadequate and largely For personal use only. due to the still unsurmountable problem of introdu- palliative. However, at least at an experimental level, cing mtDNA into the mitochondria of mammalian interesting strategies are being developed, mostly cells. An alternative approach has been to use cybrid aimed at shifting downward the percentage of cells, that is, established human cell lines first mutant mtDNAs in affected tissues (91,92). depleted of their own mtDNA then repopulated Because the pathogenic threshold of most mtDNA with various proportions of mutated genomes (83). mutations is both high and steep, a small shift in This technique has largely confirmed the prediction heteroplasmy may result in a disproportionate that single deletions or mutations in tRNA genes clinical benefit. There is a glimmer of light at the impair respiration and protein synthesis and end of the present therapeutic tunnel. decrease ATP production (84). Elegant as it is, the

Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 in vitro cybrid system cannot replace animal models in understanding clinical expression. To be sure, two Acknowledgements transmitochondrial mice or ‘mito-mice’ were Part of the work described here was supported by obtained through clever, if circuitous, stratagems, NIH grants NS11766 and HD32062, by a grant one harboring mtDNA deletions (85) and the other from the Muscular Dystrophy Association, and by harboring a point mutation for cloramphenicol the Marriott Mitochondrial Disorders Clinical resistance (86). Although these animal ‘prototypes’ Research Fund (MMDCRF). are important proofs of principle (87), there has been no recent progress in this area. In an attempt to explain the distinctive brain References symptoms in patients with KSS, MERRF, and 1. Schon EA. The mitochondrial genome. In: Rosenberg RN, MELAS, the different mutations have been Prusiner SB, DiMauro S, Barchi RL, Nestler EJ, editors. The ‘mapped’ indirectly through immunohistochemical Molecular and Genetic Basis of Neurological and Psychi- atric Disease. Boston: Butterworth Heinemann. 2003: techniques. Consistent with clinical symptomatology p. 179–87. and laboratory data, immunocytochemical evidence 2. DiMauro S, Schon EA. Mitochondrial respiratory-chain suggests that the 3243-MELAS mutation is diseases. New Engl J Med. 2003;348:2656–68. 230 S. DiMauro & G. Davidzon

3. Schon EA, Santra S, Pallotti F, Girvin ME. Pathogenesis of mother with progressive external ophthalmoplegia and son primary defects in mitochondrial ATP synthesis. Cell with Pearson marrow-pancreas syndrome. J Pediat. 1993; Develop Biol. 2001;12:441–8. 123:598–602. 4. Holt IJ, Harding AE, Morgan Hughes JA. Deletions of muscle 21. Puoti G, Carrara F, Sampaolo S, De Caro M, Vincitorio CM, mitochondrial DNA in patients with mitochondrial myo- Invernizzi F, et al. Identical large scale rearrangement of pathies. Nature. 1988;331:717–9. mitochondrial DNA causes Kearns-Sayre syndrome in a 5. Wallace DC, Singh G, Lott MT, Hodge JA, Schurr TG, mother and her son. J Med Genet. 2003;40:858–63. Lezza A, et al. Mitochondrial DNA mutation associated 22. Chinnery PF, DiMauro S, Shanske S, Schon EA, Zeviani M, with Leber’s hereditary optic neuropathy. Science. 1988;242: Mariotti C, et al. Risk of developing a mitochondrial DNA 1427–30. deletion disorder. Lancet. 2004;364:592–5. 6. DiMauro S, Bonilla E. Mitochondrial encephalomyopathies. 23. DiMauro S, Andreu AL. Mutations in mtDNA: Are we In: Engel AG, Franzini-Armstrong C, editors. Myology. New scraping the bottom of the barrel? Brain Pathology. York: McGraw-Hill. 2004: p. 1623–62. 2000;10:431–41. 7. Andreu AL, Hanna MG, Reichmann H, Bruno C, Penn AS, 24. DiMauro S. Exercise intolerance and the mitochondrial Tanji K, et al. Exercise intolerance due to mutations in the respiratory chain. It J Neurol Sci. 1999;20:387–93. cytochrome b gene of mitochondrial DNA. New Engl J Med. 25. Andreu AL, Tanji K, Bruno C, Hadjigeorgiou GM, Sue CM, 1999;341:1037–44. Jay C, et al. Exercise intolerance due to a nonsense 8. Karadimas CL, Greenstein P, Sue CM, Joseph JT, Tanji K, mutation in the mtDNA ND4 gene. Ann Neurol. 1999;45: Haller RG, et al. Recurrent myoglobinuria due to a nonsense 820–3. mutation in the COX I gene of mtDNA. Neurology. 26. Musumeci O, Andreu AL, Shanske S, Bresolin N, Comi GP, 2000;55:644–9. Rothstein R, et al. Intragenic inversion of mtDNA: A new 9. Shanske S, Pancrudo J, Kaufmann P, Engelstad K, Jhung S, type of pathogenic mutation in a patient with mitochondrial Lu J, et al. Varying loads of the mitochondrial DNA A3243G myopathy. Am J Hum Genet. 2000;66:1900–4. mutation in different tissues: Implications for diagnosis. 27. Schwartz M, Vissing J. Paternal inheritance of mitochondrial Am J Med Genet. 2004;130A:134–7. DNA. New Engl J Med. 2002;347:576–80. 10. McDonnell MT, Schaefer AM, Blakely EL, McFarland R, 28. Keightley JA, Hoffbuhr KC, Burton MD, Salas V, Chinnery PF, Turnbull DM, et al. Noninvasive diagnosis of Johnston WSW, Penn AMW, et al. A microdeletion in the 3243AwG mitochondrial DNA mutation using urinary cytochrome c oxidase (COX) subunit III associated with epithelial cells. Eur J Hum Genet. 2004;12:778–81. COX deficiency and recurrent myoglobinuria. Nat Genet. 11. Kaufmann P, Shungu D, Sano MC, Jungh G, Engelstad K, 1996;12:410–15. Mitsis E, et al. Cerebral lactic acidosis correlates with 29. Rahman S, Taanman J-W, Cooper M, Nelson I, Hargreaves I, neurological impairment in MELAS. Neurology. 2004;62: Meunier B, et al. A missense mutation of cytochrome oxidase 1297–302. subunit II causes defective assembly and myopathy. Am J Hum 12. Schaefer AM, Taylor RW, Turnbull DM, Chinnery PF. The Genet. 1999;65:1030–39. epidemiology of mitochondrial disorders - past, present and 30. Dumoulin R, Sagnol I, Ferlin T, Bozon D, Stepien G, For personal use only. future. Biochim Biophys Acta. 2004;1659:115–20. Mousson B. A novel gly290asp mitochondrial cytochrome b 13. Chinnery PF, Wardell TM, Singh-Kler R, Hayes C, mutation linked to a complex III deficiency in progres- Johnson MA, Taylor RW, et al. The epidemiology of sive exercise intolerance. Mol Cell Probes. 1996;10: pathogenic mitochondrial DNA mutations. Ann Neurol. 389–91. 2000;48:188–93. 31. Keightley JA, Anitori R, Burton MD, Quan F, Buist NRM, 14. Man PY, Griffiths PG, Brown DT, Howell N, Turnbull DM, Kennaway NG. Mitochondrial encephalomyopathy and Chinnery PF. The epidemiology of Leber hereditary optic complex III deficiency associated with a stop-codon mutation neuropathy in the Northeast of England. Am J Hum Genet. in the cytochrome b gene. Am J Hum Genet. 2000;67: 2003;72:333–9. 1400–10. 15. Majamaa K, Moilanen JS, Uimonen S, Remes AM, 32. Andreu AL, Bruno C, Shanske S, Shtilbans A, Hirano M, Salmela PI, Karppa M, et al. Epidemiology of A3243G, Krishna S, et al. Missense mutation in the mtDNA the mutation for mitochondrial encephalomyopathy, cytochrome b gene in a patient with myopathy. Neurology. Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 lactic acidosis, and stroke-like episodes: Prevalence of the 1998;51:1444–7. mutation in an adult population. Am J Hum Genet. 33. Andreu AL, Bruno C, Dunne TC, Tanji K, Shanske S, 1998;63:447–54. Sue CM, et al. A nonsense mutation (G15059A) in the 16. Darin N, Oldfors A, Moslemi A-R, Holme E, Tulinius M. cytochrome b gene in a patient with exercise intolerance and The incidence of mitochondrial encephalomyopathies in myoglobinuria. Ann Neurol. 1999;45:127–30. childhood: Clinical features and morphological, biochemical, 34. Lamantea E, Carrara F, Mariotti C, Morandi L, Tiranti V, and DNA abnormalities. Ann Neurol. 2001;49:377–83. Zeviani M. A novel nonsense mutation (Q352X) in the 17. Skladal D, Halliday J, Thorburn DR. Minimum birth mitochondrial cytochrome b gene associated with a combined prevalence of mitochondrial respiratory chain disorders in defect of complexes I and III. Neuromusc Disord. children. Brain. 2003;126:1905–12. 2002;12:49–52. 18. Shanske S, Tang Y, Hirano M, Nishigaki Y, Tanji K, 35. Mancuso M, Filosto M, Stevens JC, Patterson M, Shanske S, Bonilla E, et al. Identical mitochondrial DNA deletion in a Krishna S, et al. Mitochondrial myopathy and complex III woman with ocular myopathy and in her son with Pearson deficiency in a patient with a new stop-codon mutation syndrome. Am J Hum Genet. 2002;71:679–83. (G339X) in the cytochrome b gene. J Neurol Sci. 2003;209: 19. Poulton J, Deadamn ME, Ramacharan S. Germ-line dele- 61–3. tions of mtDNA in mitochondrial myopathy. Am J Hum 36. Legros F, Chatzoglou E, Frachon P, Ogier De Baulny H, Genet. 1991;48:649–53. Laforet P, Jardel C, et al. Functional characterization of novel 20. Bernes SM, Bacino C, Prezant TR, Pearson MA, Wood TS, mutations in the human cytochrome b gene. Eur J Hum Fournier P, et al. Identical mitochondrial DNA deletion in Genet. 2001;9:510–18. Mitochondrial DNA and disease 231

37. Taylor RW, McDonnell MT, Blakely EL, Chinnery PF, Myoclonus and Paroxysmal Dyskinesia. Philadelphia: Taylor GA, Howell N, et al. Genotypes from patients indicate Lippincott Williams & Wilkins. 2002: p. 217–29. no paternal mitochondrial contribution. Ann Neurol. 54. Gill P, Ivanov PL, Kimpton C, Piercy R, Benson N, Tully G, 2003;54:521–24. et al. Identification of the remains of the Romanov family by 38. Filosto M, Mancuso M, Vives-Bauza C, Vila MR, Shanske S, DNA analysis. Nat Genet. 1994;6:130–5. Hirano M, et al. Lack of paternal inheritance of muscle 55. Anslinger K, Weichhold G, Keil W, Bayer B. Identification of mitochondrial DNA in sporadic mitochondrial myopathies. the skeletal remains of Martin Bormann by mtDNA analysis. Ann Neurol. 2003;54:524–6. Int J Legal Med. 2001;114:194–6. 39. Schwartz F, Vissing J. No evidence of paternal inheritance of 56. Carelli V, Ross-Cisneros FN, Sadun AA. Mitochondrial mtDNA in patients with sporadic mtDNA mutations. dysfunction as a cause of optic neuropathies. Progr Retin Eye J Neurol Sci. 2004;218:99–101. Res. 2004;23:53–89. 40. Kraytsberg Y, Schwartz M, Brown TA, Ebralidse K, 57. Prezant TR, Agapian JV, Bohlman MC, Bu X, Oztas S, Kunz WS, Clayton DA, et al. Recombination of human Qiu W-Q, et al. Mitochondrial ribosomal RNA mutation mitochondrial DNA. Science. 2004;304:981. associated with both antibiotic-induced and non-syndromic 41. Santorelli FM, Tanji K, Kulikova R, Shanske S, Vilarinho L, deafness. Nat Genet. 1993;4:289–93. Hays AP, et al. Identification of a novel mutation in the 58. Sue CM, Tanji K, Hadjigeorgiou G, Andreu AL, Nishino I, mtDNA ND5 gene associated with MELAS. Biochem Krishna S, et al. Maternally inherited hearing loss in a large Biophys Res Comm. 1997;238:326–8. kindred with a novel mutation in the mitochondrial DNA 42. Penisson-Besnier I, Reynier P, Asfar P, Douay O, Sortais A, tRNASer(UCN) gene. Neurology. 1999;52:1905–8. Dubas F, et al. Recurrent brain hematomas in MELAS 59. Li X, Fischel-Ghodsian N, Schwartz F, Yan Q, Friedman RA, associated with an ND5 gene mitochondrial mutation. Guan MX. Biochemical characterization of the mitochondrial Neurology. 2000;55:317–8. tRNASer(UCN) T7511C mutation associated with nonsyn- 43. Kirby DM, Boneh A, Chow CW, Ohtake A, Ryan MT, dromic deafness. Nucleic Acids Res. 2004;32:867–77. Thyagarajan D, et al. Low mutant load of mitochondrial 60. Taylor RW, Giordano C, Davidson MM, d’Amati G, DNA G13513A mutation can cause Leigh’s disease. Ann Bain H, Hayes CM, et al. A homoplasmic mitochondrial Neurol. 2003;54:473–8. transfer ribonucleic acid mutation as a cause of maternally 44. Chol M, Lebon S, Benit P, Chretien D, de Lonlay P, Cormier V, inherited cardiomyopathy. J Am Coll Cardiol. 2003;41: et al. The mtDNA G-A mutation at nt 13513, peviously 1786–96. reported in MELAS syndrome, is a frequent cause of 61. McFarland R, Clark KM, Morris AAM, Taylor RW, Leigh disease. Am J Hum Genet. 2002;71(Suppl.):Abstract # Macphail S, Lightowlers RN, et al. Multiple neonatal deaths 1494. due to homoplasmic mitochondrial DNA mutation. Nat 45. Petruzzella V, Di Giacinto G, Scacco S, Piemonte F, Genet. 2002;30:145–6. Torraco A, Carrozzo R, et al. Atypical Leigh syndrome 62. Mancuso M, Ferraris S, Nisjigaki Y, Azan G, Mauro A, associated with the D393N mutation in the mitochondrial Sammarco P, et al. Congenital or late-onset myopathy with

For personal use only. ND5 subunit. Neurology. 2003;61:1017–8. the T14709C mtDNA mutation. J Neurol Sci. 2005;228: 46. Pulkes T, Eunson L, Patterson V, Siddiqui A, Wood NW, 93–7. Nelson IP, et al. The mitochondrial DNA G13513A 63. McFarland R, Schaefer AM, Gardner A, Lynn S, Hayes CM, transition in ND5 is associated with a LHON/MELAS Barron MJ, et al. Familial myopathy: New insights into the overlap syndrome and may be a frequent cause of MELAS. T14709C mitochondrial tRNA mutation. Ann Neurol. Ann Neurol. 1999;46:916–9. 2004;55:478–84. 47. Corona P, Antozzi C, Carrara F, D’Incerti L, Lamantea E, 64. Wilson FH, Hariri A, Farhi A, Zhao H, Petersen KF, Tiranti V, et al. A novel mtDNA mutation in the ND5 Toka HR, et al. A cluster of metabolic defects caused by subunit of complex I i two MELAS patients. Ann Neurol. mutation in a mitochondrial tRNA. Science. 2004;306: 2001;49:106–10. 1190–4. 48. Liolitsa D, Rahman S, Benton S, Carr LJ, Hanna MG. Is the 65. Hampton T. Mitochondrial defects may play a role in the mitochondrial complex I ND5 gene a hot-spot for MELAS metabolic syndrome. JAMA. 2004;292:2823–4.

Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 causing mutations? Ann Neurol. 2003;53:128–32. 66. Baracca A, Solaini G, Sgarbi G, Lenaz G, Baruzzi A, 49. Crimi M, Galbiati S, Moroni I, Bordoni A, Perini MP, Schapira AHV, et al. Severe impairment of complex I-driven Lamantea E, et al. A missense mutation in the mitochondrial ATP synthesis in Leber’s hereditary optic neuropathy cybrids. ND5 gene associated with a Leigh-MELAS overlap syn- Arch Neurol. 2005. In press. drome. Neurology. 2003;60:1857–61. 67. Hirano M, DiMauro S. Leber’s hereditary optic neuropathy: 50. Naini A, Lu J, Kaufmann P, Bernstein RA, Mancuso M, biochemical lights in a blurry scenario. Arch Neurol. 2005. In Bonilla E, et al. Novel mtDNA ND5 mutation in a patient press. with clinical features of MELAS and MERRF. Arch Neurol. 68. Estivill X, Govea N, Barcelo’ A, Perello’ E, Badenas C, 2005;64:539–41. Romero E, et al. Familial progressive sensorineural deafness is 51. Taylor RW, Schaefer AM, McDonnell MT, Petty RKH, mainly due to the mtDNA A1555G mutation and is Thomas AM, Blakely EL, et al. Catastrophic presentation of enhanced by treatment with aminoglycosides. Am J Hum mitochondrial disease due to a mutation in the tRNAHis Genet. 1998;62:27–35. gene. Neurology. 2004;62:1420–23. 69. Fischel-Ghotsian N. Mitochondrial mutations and hearing 52. Mancuso M, Filosto M, Mootha VK, Rocchi A, Pistolesi S, loss: Paradigm for mitochondrial genetics. Am J Hum Genet. Murri L, et al. A novel mitochondrial tRNAPhe mutation 1998;62:15–9. causes MERRF syndrome. Neurology. 2004;62:2119–21. 70. Cock HR, Tabrizi SJ, Cooper JM, Schapira AHV. The 53. DiMauro S, Hirano M, Kaufmann P, Tanji K, Sano M, influence of nuclear background on the biochemical expres- Shungu DC, et al. Clinical features and genetics of myoclonic sion of 3460 Leber’s hereditary optic neuropathy. Ann epilepsy with ragged red fibers. In: Fahn S, Frucht SJ, editors. Neurol. 1998;44:187–93. 232 S. DiMauro & G. Davidzon

71. Wallace DC, Brown MD, Lott MT. Mitochondrial DNA 81. Pulkes T, Sweeney MG, Hanna MG. Increased risk of stroke variation in human evolution and disease. Gene. 1999;238: in patients with the A12308G polymorphism in mitochon- 211–30. dria. Lancet. 2000;356:2068–9. 72. Skuder P. A polymorphism in mitochondrial DNA associated 82. Rowland LP. Mitochondrial encephalomyopathies: Lumping, with IQ? Intelligence. 1995;21:1–11. splitting, and melding. In: Schapira AHV, DiMauro S, 73. Ruiz-Pesini E, Lapena AC, Diez-Sanchez C, Perez-Martos A, editors. Mitochondrial disorders in neurology. Oxford: Montoya J, Alvarez E, et al. Human mtDNA haplogroups Butterworth-Heinemann. 1994: p. 116–29. associated with high or reduced spermatozoa motility. 83. King MP, Attardi G. Human cells lacking mtDNA: repopu- Am J Hum Genet. 2000;67:682–96. lation with exogenous mitochondria by complementation. 74. Ruiz-Pesini E, Mishmar D, Brandon M, Procaccio V, Science. 1989;246:500–3. Wallace DC. Effects of purifying and adaptive selection on 84. Pallotti F, Baracca A, Hernandez-Rosa E, Walker WF, regional variation in human mtDNA. Science. 2004;303: Solaini G, Lenaz G, et al. Biochemical analysis of respiratory 223–226. function in cybrid cell lines harbouring mitochondrial DNA 75. Shin WS, Tanaka M, Suzuki J-i, Hemmi C, Toyo-oka T. A mutations. Biochem J. 2004;384:287–93. novel homoplasmic mutation in mtDNA with a single 85. Inoue K, Nakada K, Ogura A, Isobe K, Goto Y-i, Nonaka I, evolutionary origin as a risk factor for cardiomyopathy. et al. Generation of mice with mitochondrial dysfunction by Am J Hum Genet. 2000;67:1617–20. introducing mouse mtDNA carrying a deletion into zygotes. Nat Genet. 2000;26:176–81. 76. Chinnery PF, Taylor GA, Howell N, Andrews RM, 86. Sligh JE, Levy SE, Waymire KG, Allard P, Dillehay DL, Morris CM, Taylor RW, et al. Mitochondrial DNA haplo- Nusinowitz S, et al. Maternal germ-line transmission of groups and susceptibility to AD and dementia with Lewy mutant mtDNAs from embryonic stem cell-derived chimeric bodies. Neurology. 2000;55:302–4. mice. Proc Nat Acad Sci U S A. 2000;97:14461–6. 77. Kalman B, Li S, Chatterjee D, O’Connor J, Voehl MR, 87. Hirano M. Transmitochondrial mice: Proof of principle and Brown MD, et al. Large scale screening of the mitochondrial promises. Proc Nat Acad Sci U S A. 2001;98:401–3. DNA reveals no pathogenic mutations but a haplotype 88. Sparaco M, Schon EA, DiMauro S, Bonilla E. Myoclonic associated with multiple sclerosis in Caucasians. Acta epilepsy with ragged-red fibers (MERRF): An immunohisto- Neurol Scand. 1999;99:16–25. chemical study of the brain. Brain Pathol. 1995;5:125–33. 78. Howell N. Human mitochondrial diseases: answering ques- 89. Tanji K, Schon EA, DiMauro S, Bonilla E. Kearns-Sayre tions and questioning answers. Int Rev Cytol. 1999;186: syndrome: oncocytic transformation of choroid plexus 49–116. epithelium. J Neurol Sci. 2000;178:29–36. 79. Torroni A, Campos Y, Rengo C, Sellitto D, Achilli A, 90. Schon EA, Manfredi G. Neuronal degeneration and mito- Magri C, et al. Mitochondrial DNA haplogroups do not play chondrial dysfunction. J Clin Invest. 2003;111:303–12. a role in the variable phenotypic presentation of the A3243G 91. Schon EA, DiMauro S. Medicinal and genetic approach to mutation. Am J Hum Genet. 2003;72:1005–12. the treatment of mitochondrial disease. Curr Medicinal 80. Deschauer M, Chinnery PF, Schaefer AM, Turnbull DM, Chem. 2003;10:2523–33.

For personal use only. Taylor RW, Zierz S, et al. No association of the mitochon- 92. Taylor RW, Turnbull DM. Current and future prospects for drial DNA A12308G polymorphism with increased risk of the treatment of mitochondrial disorders. In: Schapira AHV, stroke in patients with the A3243G mutation. J Neurol DiMauro S, editors. Mitochondrial Disorders in Neurology 2. Neurosurg Psychiat. 2004;75:1204–5. Boston: Butterworth-Heinemann. 2002: p. 213–27. Ann Med Downloaded from informahealthcare.com by VUB Vrije University Brussels on 10/03/13 HUMAN MUTATION 15:712 (2000)

MDI SPECIAL ARTICLE

Mutation Nomenclature Extensions and Suggestions to Describe Complex Mutations: A Discussion

Johan T. den Dunnen1* and Stylianos E. Antonarakis2* 1MGC-Department of Human and Clinical Genetics, Leiden University Medical Center, Leiden, The Netherlands 2Division of Medical Genetics, University of Geneva Medical School, Geneva, Switzerland

Consistent gene mutation nomenclature is essential for efficient and accurate reporting, testing, and curation of the growing number of disease mutations and useful polymorphisms being discovered in the human genome. While a codified mutation nomenclature system for simple DNA lesions has now been adopted broadly by the medical genetics community, it is inherently difficult to represent complex mutations in a unified manner. In this article, suggestions are presented for reporting just such complex mutations. Hum Mutat 15:7–12, 2000. © 2000 Wiley-Liss, Inc.

KEY WORDS: complex mutation; mutation detection; mutation database; nomenclature; MDI

INTRODUCTION report. The items missing in the current nomen- Recently, a nomenclature system has been sug- clature recommendations which will be covered gested for the description of changes (mutations in this article include simple omissions (changes and polymorphisms) in DNA and protein se- in mitochondrial DNA), simple mutations (dupli- quences [Antonarakis et al., 1998]. These nomen- cations, inversions), and more complex mutations clature recommendations have now been largely (mutations in recessive disease, insertion/deletions, accepted and stimulated the uniform and un- changes inside codons, frame shifts). It should be equivocal description of sequence changes. How- noted that when describing a mutation as a “dele- ever, current rules do not yet cover all types of tion,” “insertion,” or “other,” one should always mutations, nor do they cover more complex mu- indicate which level is described; a substitution at tations. The goal of this article is to make sugges- the DNA level may cause an insertion at the RNA tions for additional mutation nomenclature level and a nonsense mutation at the protein level. recommendations and to stimulate discussions as Furthermore, for descriptions at protein and RNA to how far the rules should go regarding the de- levels, which are mostly derived from the DNA se- scription of complex mutations. Discussions re- quence with only rarely experimental proof, it should garding the advantages and disadvantages of the be clear that recommendations cover a description suggestions are necessary in order to continuously of the consequence rather than the nature of the se- improve the designation of sequence changes. The quence change. It can be debated whether this should consensus of the discussions will be posted on the be done, but we believe it should. World Wide Web (http://www.dmd.nl/mutnomen. A weak element in many reports is often the html). We also invite investigators to communi- description at the level of mature or processed cate with us complicated cases with a suggestion messenger RNA. Many reports fail to mention of how to describe these (send e-mail to: ddun- clearly, and discriminate in tabular listings, at [email protected] and Sty- which level the sequence variations reported were [email protected]); an overview will be listed at the same WWW-address. Received 7 September 1999; accepted revised manuscript 4 October 1999. Ultimately, this list of examples for the description *Correspondence to: Johan T. den Dunnen, Dept. of Human of complicated cases may evolve into a uniformly and Clinical Genetics, LUMC, Wassenaarseweg 72, 2333 AL accepted reference for mutation nomenclature. Leiden, The Netherlands. E-mail: [email protected]. The nomenclature needs to be accurate and LeidenUniv.nl; or Stylianos E. Antonarakis, Division of Medical Genetics, University of Geneva Medical School, 9 Avenue de unambiguous, but flexible, and the nucleotide Champel, 1211 Geneva, Switzerland. E-mail: Stylianos. change must always be included in the original [email protected]

© 2000 WILEY-LISS, INC. 8 DEN DUNNEN AND ANTONARAKIS analyzed. Consequently, it often remains unclear • A unique identifier should be obtained for each whether a change might have an effect on the mutation. Preferably, locus-specific database RNA level or whether the suggested effect on RNA curators should assign unique identifiers. Alter- has been proven or not. That this is not trivial is natively, the OMIM unique identifier or the exemplified by several cases where changes were HGMD entry can be used as a reference source originally reported as silent or missense (based on for previously cataloged mutations. DNA data), although they actually represented changes affecting mRNA processing [see, e.g., Ri- Description at the DNA Level chard and Beckmann, 1995]. Several of the rec- • Nucleotide changes start with the nucleotide ommendations below are specifically made to number and the change follows this number; clarify this issue. {nucleotide interval}{sequence changed Nomenclature recommendations by themselves nucleotide}{type of change}{sequence new do not safeguard against mistakes. A clear example nucleotide}. is the recommendation to use the one-letter amino • Substitutions are designated by “>”; 1997G>T acid code for descriptions at the protein level. Sev- denotes that at nt 1997 of the reference se- eral examples from recent publications show that it quence a G is changed to a T. is not rare that mistakes are made. Codes are mixed • Deletions are designated by “del” after the de- up easily for amino acids which have the same initial leted interval (followed by the deleted nts). letter (e.g., Alanine, Arginine, Asparagine, and As- 1997-1999del (alternatively 1997-1999- partic acid or Glycine, Glutamine, and Glutamic delTTC) denotes a TTC deletion from nts 1997 acid). Hopefully, electronic tools for submission of to 1999. A TG deletion in the sequence sequence changes, with automatic error checks, will ACTGTGTGCC (A is nt 1991) is designated help to avoid these problems (see http://ariel.ucs. as 1997-1998del (or 1997-1998delTG). unimelb.edu.au:80/~cotton/entry.htm). • Insertions are designated by “ins,” followed by the inserted nts. 1997-1998insT denotes SUMMARY OF PUBLISHED that a T was inserted between nts 1997 and RECOMMENDATIONS 1998. A TG insertion in the TG-tandem repeat sequence of ACTGTGTGCC (A is nt General [from Antonarakis et al., 1998] 1991) is described as 1998-1999insTG (where • Sequence variations are best described at the 1998 is the last G of the TG-repeat). DNA level. • Variability of short sequence repeats, e.g., in • The accession number in primary sequence ACTGTGTGCC (A is nt 1991), is designated databases (Genbank, EMBL, DDJB, SWISS- as 1993(TG)3-22 with nt 1993 containing the PROT) should be mentioned in the publica- first TG-dinucleotide which is found repeated tion/database submission. When available, 3 to 22 times in the population. the genomic reference sequence is preferred. • Intron mutations are designated by the intron For each gene, a reference sequence needs to number (preceded by “IVS”) or cDNA posi- be established. tion; positive numbers starting from the G of • To avoid confusion, the nucleotide number is the GT splice donor site, negative numbers preceded by “g.” when a genomic or by “c.” starting from the G of the AG splice acceptor when a cDNA reference sequence is used. site. IVS4-2A>C (1998-2A>C) denotes the • For genomic DNA and cDNA sequences, the A to C substitution at nt –2 of intron 4, at A of the ATG of the initiator Methionine the cDNA level positioned between nucle- codon is denoted nucleotide +1 (there is no otides 1997 and 1998. IVS4+1G>T (1997+ nucleotide zero). The nucleotide 5′ to +1 is 1G>T) denotes the G to T substitution at nt numbered –1. +1 of intron 4. When the full-length genomic • For variations in single nt (or amino acid) sequence is known, the mutation is best des- stretches or tandem repeats, the most 3′ copy ignated by the nt number of the genomic ref- is arbitrarily assigned to have been changed erence sequence. (e.g., ATGTGCA to ATGCA is described as 4-5delTG). Description at the Protein Level • Two mutations in the same allele are listed Note that recommendations for sequence varia- within brackets, separated by a semicolon; e.g. tions at the protein level describe the deduced [1997G>T; 2001A>C] (see below). consequence and not the nature of the mutation. MUTATION NOMENCLATURE 9

TABLE 1. Sequence Variation Description at the DNA Level Type of variation Description Alternative Remark g.12T>A change described in relation to a genomic sequence c.12T>A change described in relation to a cDNA sequence m.12T>A change described in relation to a mitochondrial sequence [6T>C + 13_14del] one allele containing two changes [13_14del] + [?] mutations in the 2 alleles of a recessive disease, one being unknown (=?) Substitution 12T>A 15+1G>C IVS1+1G>C change in intronic sequence (splice donor site) 93-2A>G IVS1-2A>G change in intronic sequence (splice acceptor site) Deletion 13_14delTT 13_14del IVS1_IVS5 15+?_645+?del genomic deletion of exons 2 to 5 or EX2_EX5del Duplication 10_11dupTG 10_11dup Insertion 14_15insT Inversion 4_15inv Insertion/deletion 112_117delAGGTCAinsTG 112_117delinsTG also known as ‘‘indel’’ or 112_117>TG Complex depends on change examples at http://www.dmd.nl/mutno men.html Suggestions from this article in italics. Sample sequence 5′-CATGC ATG CAT GCA TGT TTC GTGAGTATATC-3′ with nucleotides -CATGC- being the 5′ untranslated region in exon 1, -ATG-being the translation site and -GTGAGT...- being the first nucleotides in intron 1.

Furthermore, it should be avoided to report • Deletions are designated by “del” after the changes at the amino acid level without including amino acid interval. T97-C102del (or T97- the description at the nucleotide level. C102del6) denotes that amino acid Threo- nine97 to Cysteine102 are deleted. • The codon for the initiator Methionine is • Insertions are designated by “ins” after the codon 1. amino acid interval, followed by the inserted • Stop codons are designated by X. R97X de- amino acids or the number of amino acids notes a change of Arginine 96 to a termina- inserted. T97-W98insLQS (or T97-W98ins3) tion codon. denotes that three amino acids are inserted • The single letter amino acid code is recom- between amino acids 97 and 98 (i.e., after mended, three letter code is acceptable. Threonine97). • Amino acid changes are described in the for- EXTENSIONS AND ADDITIONAL mat {code first amino acid changed}{amino SUGGESTIONS acid interval}{code new amino acid or type of change}. Y97S denotes Tyrosine97 is sub- Sequence Variations in Mitochondrial DNA stituted by a Serine. Suggestion (from David Fung, Camperdown,

TABLE 2. Sequence Variation Description at the Level of Mature or Processed Messenger RNA Type of variation Description Alternative Remark r.15c>u change described in relation to a RNA sequence as for DNA but lower case letters Splice variants [16g>t + 16_112del] mutation affecting splicing, producing two mRNAs, one normal and one with a deletion of nucleotides 16 to 112 (exon 2) Complex depends on change examples at http://www.dmd.nl/mutno men.html Suggestions from this article in italics. Sample sequence 5′-CAUGC AUG CAU GCA UGU UUC GUC-3′ with nucleotides -CAUGC- being the 5′ untranslated region in exon 1 and -AUG- being the translation initiation codon. 10 DEN DUNNEN AND ANTONARAKIS

TABLE 3. Sequence Variation Description at the Protein Level Type of variation Description Alternative Remark p.R5S change described in relation to a protein sequence others see Table I Substitution R5S W4X change to stop codon Deletion L3_W4del Duplication L3_W4dup Insertion W4_R5insK Inversion – not relevant Frame shift W4fsX8 W4fs frame shift causing a translational stop 5 codons downstream Complex depends on change examples at http://www.dmd.nl/mutnomen. html Suggestions from this article in italics. Sample sequence M-I-L-W-R-R-C, with amino acid M representing the translation initiating Methionine.

Australia): when a mitochondrial reference se- short tandem repeats (or single nucleotide quence is used, the nucleotide number is preceded stretches) can also be described as a duplication, by “m.” (e.g., m.1203A>T). e.g., 1997_1998dupTG (now 1998_1999insTG). Sequence Variations in Protein Sequences Inversions Suggestion: when a protein reference sequence Recommendations for inversions are missing but is used, the amino acid is preceded by “p.” (e.g., can be rather straightforward using the existing p.K93W). rules. Suggestion: inversions are described as 203_ Descriptions of a Range 506inv (or 203_506inv304) indicating that the 304 Due to the fact that the “–” symbol is used for two nt’s from position 203 to 506 have been inverted. different purposes, i.e., to indicate a range (R12-W13) as well as to indicate a negative distance (77-2A>G), Mutations in Recessive Diseases current recommendations to describe sequence The current suggestion for the description of changes starting and or ending in intronic sequences recessive mutations is [1997G>T + 2001A>G], may easily cause confusion. For example, does 5-77- indicating the substitution of nt 1997 on one al- 77del describe a deletion from nt 5-77 to 77 or from lele and of nt 2001 on the other allele. The de- nt 5 to 77-77? It would be better not to use the “–” scription should be given the status of a symbol for two purposes. Since for intronic positions recommendation, which is important for two rea- both the “–” and “+” symbols are used, a change sons, 1) it makes clear whether a mutation was should involve the “–” symbol separating the first found on both alleles, and 2) it ensures that re- from the last affected nt. searchers show which mutations were identified Suggestion: the “_” symbol (underscore) should in which combinations. The latter is important be used to separate the first from the last affected since severity might depend on the combination nt (or amino acid), e.g., 85_86delAG. On the proof mutations present, while other combinations tein level as K23_W29. might not be deleterious at all. However, the cur- Duplications rent description is not completely straightforward and might cause confusion with that for the de- No recommendations have been made to describe scription of two mutations in one allele, currently duplications. Although they can be seen as a specific like [1997G>T; 2001A>C]. type of insertion, and could be described as such, Suggestion: two variations in one allele are they often originate through other mutational mecha- described as [1997G>T + 2001A>C] while nisms. We therefore prefer to provide a distinctive variations in different alleles, e.g., in recessive designation of this type of sequence change diseases, are designated as [1997G>T] + Suggestion: duplications are described as [2001A>G]. In homozygous cases the format 1992_1994dupCTG (or 1992_1994dup). On the is [1997G>T] + [1997G>T]. When only one protein level as L78dup. mutated allele has been identified, the format As a consequence, duplicating insertions in is [1997G>T] + [?]. On the protein level, the MUTATION NOMENCLATURE 11 designation is likewise, e.g., two variations in unknown position in intron 2 (after base 77) and one allele [R175X + C305S] versus [R175X] ending at an unknown position in intron 5 (after + [C305S] for variations in different alleles. base 923). Mutations Analyzed at Which Level? Insertion-Deletions Many reports fail to mention clearly, and dis- The occurrence of a combination of a deletion criminate in tabular listings, at which level (DNA, and insertion, sometimes named “indel,” is not RNA, and/or protein) the sequence variations re- rare. Recommendations for their description have ported were analyzed and whether experimental not yet been made. Based on existing terminol- proof was obtained regarding the descriptions pro- ogy, a suggestion can be rather straightforward. vided at the RNA and protein level. Suggestion: a combination of a deletion and Suggestion: In tabular listings of the sequence insertion at the same site is described as 112_ variations identified, it should be stated clearly 117delAGGTCAinsTG (alternatively 112_ which variation was analyzed at which level, i.e., 117delinsTG or 112_117>TG). On the protein DNA, RNA, and/or protein. level, likewise as W33_K35delinsR. Description of Mutations at the RNA Level Mutations in the Translation Initiation Site When RNA has been analyzed, the effect is of- Currently, mutations in the translation initiat- ten not described properly and recommendations ing Methionine (M1) are mostly described as a for its description are lacking. Based on the no- substitution, e.g., M1V. We would like to note that menclature rules to describe mutations on the this is not correct; either no protein is produced DNA level, suggestions can be simply copied when or the translation initiation site moves up- or three additions are made. downstream. Unless experimental proof is avail- Suggestion 1: An “r.” is used to indicate that a able, it is probably best to report the effect on pro- change is described at the RNA level. tein level as “unknown.” When experimental data Suggestion 2: To discriminate between descrip- show that no protein is made, the description “p.0” tions at the DNA and protein levels, lower case might be most appropriate. letters and the “u” for Uracil are used to describe changes at the RNA level. Sequence Variation in Codons Suggestion 3: When one change affects RNA- Current recommendations do not fully cover the processing, yielding two or more transcripts, these description of amino acid substitutions and are described between brackets, separated by a “+” changes inside codons that do not alter the read- symbol, e.g., [r.76a>c + r.70_77del], i.e., the nt ing frame. change c.76A>C causes the appearance of two Suggestion 1: C28_V29delinsW denotes a 3 bp RNA molecules, one carrying the variation only deletion affecting the codons for Cysteine28 and and one containing a deletion of nucleotides 70 to Valine29, changing them to a codon for Tryp- 77 (shift of splice site). tophan. It should be noted here that the designations at Suggestion 2: C28delinsWV denotes a 3 bp in- the RNA level, similar to that on the protein level, sertion in the codon for Cysteine28, generating describe the consequence and not the nature of codons for Tryptophan and Valine. the mutation. Frame-Shifting Mutations Exon Deletions Detected at the At the protein level, no recommendations have Genomic Level been made regarding the description of frame-shift- In diseases such as Duchenne Muscular Dys- ing mutations. Although it is probably not useful trophy (DMD), many mutations are found which to add much detail in this description, it might be delete (sets of) whole exons, detected on South- sensible, e.g., in the case of C-terminal mutations, ern blot using cDNA probes or using exon specific to include the length of the new, shifted reading PCR-tests. Current rules for mutation description frame. do not cover these, with the consequence that Suggestion 1: Frame-shifting mutations are des- everybody uses their own system. ignated by “fs.” R97fs denotes a frame-shifting Suggestion: exonic deletions are described as change with Arginine97 as the first affected amino IVS2_IVS5del (alternatives 77+?_923+? or acid. The length of the shifted open reading frame EX3_5del), indicating a deletion starting at an may be described using the format R97fsX121, in- 12 DEN DUNNEN AND ANTONARAKIS dicating a frame-shifting change with Arginine97 Beaudet AL, the Ad Hoc Committee on Mutation Nomencla- ture. 1996. Update on nomenclature for human gene muta- as the first affected amino acid and the new read- tions. Hum Mutat 8:197–202. ing frame being open for 23 amino acids. Beutler E, McKusick VA, Motulsky A, Scriver CR, Hutchinson REFERENCES F. 1996. Mutation nomenclature: nicknames, systematic names and unique identifiers. Hum Mutat 8:203–206. Antonarakis SE, the Nomenclature Working Group. 1998. Rec- ommendations for a nomenclature system for human gene Richard I, Beckmann JS. 1995. How neutral are synonymous mutations. Hum Mutat 11:1–3. codon mutations? Nat Genet 10:259. research Techniques made simple 

Next-Generation Sequencing: Methodology and Application Ayman Grada1 and Kate Weinbrecht2 Journal of Investigative Dermatology (2013) 133, e11; doi:10.1038/jid.2013.248

INTRODUCTION Nucleic acid sequencing is a method for determining WHAT NGS DOES the exact order of nucleotides present in a given DNA or • NGS provides a much cheaper and higher- RNA molecule. In the past decade, the use of nucleic acid throughput alternative to sequencing DNA than sequencing has increased exponentially as the ability to traditional Sanger sequencing. Whole small sequence has become accessible to research and clini- genomes can now be sequenced in a day. cal labs all over the world. The first major foray into DNA • High-throughput sequencing of the human sequencing was the Human Genome Project, a $3 billion, genome facilitates the discovery of genes and 13-year-long endeavor, completed in 2003. The Human regulatory elements associated with disease. Genome Project was accomplished with first-generation • Targeted sequencing allows the identification sequencing, known as Sanger sequencing. Sanger sequenc- of disease-causing mutations for diagnosis of ing (the chain-termination method), developed in 1975 pathological conditions. by Edward Sanger, was considered the gold standard for nucleic acid sequencing for the subsequent two and a half • RNA-seq can provide information on the entire decades (Sanger et al., 1977). transcriptome of a sample in a single analysis Since completion of the first human genome sequence, without requiring previous knowledge of the demand for cheaper and faster sequencing methods has genetic sequence of an organism. This technique increased greatly. This demand has driven the develop- offers a strong alternative to the use of microarrays ment of second-generation sequencing methods, or next- in gene expression studies. generation sequencing (NGS). NGS platforms perform massively parallel sequencing, during which millions of fragments of DNA from a single sample are sequenced in LIMITATIONS unison. Massively parallel sequencing technology facili- • NGS, although much less costly in time and money tates high-throughput sequencing, which allows an entire in comparison to first-generation sequencing, is genome to be sequenced in less than one day. In the past still too expensive for many labs. NGS platforms decade, several NGS platforms have been developed that can cost more than $100,000 in start-up costs, and provide low-cost, high-throughput sequencing. Here we individual sequencing reactions can cost upward of highlight two of the most commonly used platforms in $1,000 per genome. research and clinical labs today: the LifeTechnologies Ion • Inaccurate sequencing of homopolymer regions Torrent Personal Genome Machine (PGM) and the Illumina (spans of repeating nucleotides) on certain NGS MiSeq. The creation of these and other NGS platforms has platforms, including the Ion Torrent PGM, and made sequencing accessible to more labs, rapidly increas- short-sequencing read lengths (on average 200–500 ing the amount of research and clinical diagnostics being nucleotides) can lead to sequence errors. performed with nucleic acid sequencing. • Data analysis can be time-consuming and may require special knowledge of bioinformatics to OVERVIEW OF THE METHODOLOGY garner accurate information from sequence data. Although each NGS platform is unique in how sequencing is accomplished, the Ion Torrent PGM and the Illumina MiSeq have a similar base methodology that includes template preparation, sequencing and imaging, and data analysis platforms discussed have unique aspects. An overview of the (Metzker, 2010). Within each generalized step, the individual sequencing methodologies discussed is provided in Figure 1.

1Department of Dermatology, Boston University School of Medicine, Boston, Massachusetts, USA and 2School of Forensic Sciences, Center for Health Sci- ences, Oklahoma State University, Tulsa, Oklahoma, USA Correspondence: Ayman Grada, Department of Dermatology, Boston University School of Medicine, 609 Albany Street, Boston, Massachusetts 02118, USA. E-mail: [email protected]

Template preparation Data analysis Template preparation consists of building a library of nucleic Once sequencing is complete, raw sequence data must acids (DNA or complementary DNA (cDNA)) and amplify- undergo several analysis steps. A generalized data analysis ing that library. Sequencing libraries are constructed by frag- pipeline for NGS data includes preprocessing the data to menting the DNA (or cDNA) sample and ligating adapter remove adapter sequences and low-quality reads, mapping sequences (synthetic oligonucleotides of a known sequence) of the data to a reference genome or de novo alignment of onto the ends of the DNA fragments. Once constructed, the sequence reads, and analysis of the compiled sequence. libraries are clonally amplified in preparation for sequencing. Analysis of the sequence can include a wide variety of bio- The PGM utilizes emulsion PCR on the OneTouch system to informatics assessments, including genetic variant calling for amplify single library fragments onto microbeads, whereas detection of SNPs or indels (i.e., the insertion or deletion of the MiSeq utilizes bridge amplification to form template clus- bases), detection of novel genes or regulatory elements, and ters on a flow cell (Berglund et al., 2011; Quail et al., 2012). assessment of transcript expression levels. Analysis can also include identification of both somatic and germline mutation Sequencing and imaging events that may contribute to the diagnosis of a disease or To obtain nucleic acid sequence from the amplified librar- genetic condition. Many free online tools and software pack- ies, the Ion Torrent PGM and the MiSeq both rely on ages exist to perform the bioinformatics necessary to success- sequencing by synthesis. The library fragments act as a fully analyze sequence data (Gogol-Döring and Chen, 2012). template, off of which a new DNA fragment is synthesized. The sequencing occurs through a cycle of washing and APPLICATIONS flooding the fragments with the known nucleotides in a The applications of NGS seem almost endless, allowing for sequential order. As nucleotides incorporate into the grow- rapid advances in many fields related to the biological sci- ing DNA strand, they are digitally recorded as sequence. ences. Resequencing of the human genome is being per- The PGM and the MiSeq each rely on a slightly different formed to identify genes and regulatory elements involved in mechanism for detecting nucleotide sequence information. pathological processes. NGS has also provided a wealth of The PGM performs semiconductor sequencing that relies knowledge for comparative biology studies through whole- on the detection of pH changes induced by the release of genome sequencing of a wide variety of organisms. NGS a hydrogen ion upon the incorporation of a nucleotide into is applied in the fields of public health and epidemiology a growing strand of DNA (Quail et al., 2012). By contrast, through the sequencing of bacterial and viral species to facili- the MiSeq relies on the detection of fluorescence generated tate the identification of novel virulence factors. Additionally, by the incorporation of fluorescently labeled nucleotides gene expression studies using RNA-Seq (NGS of RNA) have into the growing strand of DNA (Quail et al., 2012). begun to replace the use of microarray analysis, providing researchers and clinicians with the ability to visualize RNA expression in sequence form. These are simply some of the broad applications that begin to skim the surface of what NGS can offer the researcher and the clinician. As NGS continues to grow in popularity, it is inevitable that there will be additional innovative applications.

NGS IN PRACTICE Whole-exome sequencing Mutation events that occur in gene-coding or control regions can give rise to indistinguishable clinical presentations, leaving the diagnosing clinician with many possible causes for a given condition or disease. With NGS, clinicians are provided a fast, affordable, and thorough way to determine the genetic cause of a disease. Although high- throughput sequencing of the entire human genome is possible, researchers and clinicians are typically interested in only the protein-coding regions of the genome, referred to as the exome. The exome comprises just over 1% of the genome and is therefore much more cost-effective to sequence than the entire genome, while providing sequence information for protein-coding regions. Exome sequencing has been used extensively in the past several years in gene discovery research. Several gene discovery studies have resulted in the identification of genes that are relevant to inherited skin disease (Lai-Cheong and Figure 1. next-generation sequencing methodology. McGrath, 2011). Exome sequencing can also facilitate the

or clinicians to include specific genomic regions of interest. In addition, sequencing panels that target common regions of interest can be purchased for clinical use; these include panels that target hotspots for cancer-causing mutations (Rehm, 2013). Targeted sequencing—whether of individual genes or whole panels of genomic regions—aids in the rapid diagnosis of many genetic diseases. The results of disease-targeted sequencing can aid in therapeutic decision making in many diseases, including many cancers for which the treatments can be cancer-type specific (Rehm, 2013).

QUESTIONS Answers are available as supplementary material online and at http://www.scilogs.com/jid/.

1. The basic methodological steps of NGS include Figure 2. clinical application of whole-exome sequencing in the detection the following: of two disease-causing mutations. Reprinted from Cullinane et al., 2011. A. Template preparation, emulsion PCR, sequencing, data analysis. identification of disease-causing mutations in pathogenic B. Template preparation, sequencing and imaging, presentations where the exact genetic cause is not known. data analysis. Figure 2 (Cullinane et al., 2011) demonstrates the direct C. Template amplification, sequencing and imaging, effect that NGS can have on the correct diagnoses of a data analysis. patient. It summarizes the use of homozygosity mapping followed by whole-exome sequencing to identify two dis- D. Template preparation, sequencing and imaging, ease-causing mutations in a patient with oculocutaneous alignment to a reference genome. albinism and congenital neutropenia (Cullinane et al., 2011). E. DNA fragmentation, sequencing, data analysis. Figure 2a and 2b display the phenotypic traits common to oculocutaneous albinism type 4 and neutropenia observed 2. a dvantages of targeted sequencing as opposed to in this patient. Figure 2c is a pedigree of the patient’s family, full-genome, exome, or transcriptome sequencing both the affected and unaffected individuals. The idiogram include the following: (graphic chromosome map) in Figure 2d highlights the A. Affordable and efficient for quickly interrogating areas of genetic homozygosity. These regions were identi- particular genomic regions of interest. fied by single-nucleotide-polymorphism array analysis and were considered possible locations for the disease-causing B. Provides a deeper coverage of genomic regions mutation(s). Figures 2e and 2f display chromatograms for the of interest. two disease-causing mutations identified by whole-exome C. Can be utilized in deciding a therapeutic plan of sequencing. Figure 2e depicts the mutation in SLC45A2, and action for both germline and somatic cancers. Figure 2f depicts the mutation in G6PC3. This case portrays the valuable role that NGS can play in the correct diagno- D. Detects and quantifies low-frequency variants sis of an individual patient who displays disparate symptoms such as rare drug-resistant viral mutations with an unidentified genetic cause. (e.g., HIV, hepatitis B virus, or microbial pathogens). E. All of the above. Targeted sequencing Although whole-genome and whole-exome sequencing are 3. a pplications of NGS in medicine include the following: possible, in many cases where a suspected disease or con- A. Detecting mutations that play a role in diseases dition has been identified, targeted sequencing of specific such as cancer. genes or genomic regions is preferred. Targeted sequencing is more affordable, yields much higher coverage of genomic B. Identifying genes responsible for inherited skin regions of interest, and reduces sequencing cost and time diseases. (Xuan et al., 2012). Researchers have begun to develop C. Determining RNA expression levels. sequencing panels that target hundreds of genomic regions that are hotspots for disease-causing mutations. These pan- D. Identifying novel virulence factors through els target only desired regions of the genome for sequenc- sequencing of bacterial and viral species. ing, eliminating the majority of the genome from analysis. E. All of the above. Targeted sequencing panels can be developed by researchers

CONFLICT OF INTEREST Gogol-Döring A, Chen W (2012) An overview of the analysis of next The authors state no conflict of interest. generation sequencing data. Methods Mol Biol 802:249–57 Lai-Cheong JE, McGrath JA (2011) Next-generation diagnostics for inherited SUPPLEMENTARY MATERIAL skin disorders. J Invest Dermatol 131:1971–3 Answers and a PowerPoint slide presentation appropriate for journal club Metzker ML (2010) Sequencing technologies—the next generation. Nat Rev or other teaching exercises are available at http://dx.doi.org/10.1038/ Genet 11:31–46 jid.2013.248. Quail MA, Smith M, Coupland P et al. (2012) A tale of three next generation REFERENCES sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC Genom 13:341 Berglund EC, Kiialainen A, Syvänen AC (2011) Next-generation sequencing technologies and applications for human genetic history and forensics. Rehm HL (2013) Disease-targeted sequencing: a cornerstone in the clinic. Invest Genet 2:23 Nat Rev Genet 14:295–300 Cullinane AR, Vilboux T, O’Brien K et al. (2011) Homozygosity mapping Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain- and whole-exome sequencing to detect SLC45A2 and G6PC3 mutations terminating inhibitors. Proc Natl Acad Sci USA 74:5463–7 in a single patient with oculocutaneous albinism and neutropenia. J Xuan J, Yu Y, Qing T et al. (2012) Next-generation sequencing in the clinic: Invest Dermatol 131:2017–25 promises and challenges. Cancer Lett; e-pub ahead of print 19 November 2012

review article

Mechanisms of Disease

Monogenic Mitochondrial Disorders

Werner J.H. Koopman, Ph.D., Peter H.G.M. Willems, Ph.D., and Jan A.M. Smeitink, Ph.D.

From the Department of Biochemistry, o function normally, human cells require energy in the form Nijmegen Center for Molecular Life Sci- of ATP. In many cell types, ATP is primarily generated by mitochondria, ences (W.J.H.K., P.H.G.M.W.), and the De- partment of Pediatrics, Nijmegen Center which are also key players in other important cellular processes, such as for Mitochondrial Disorders (J.A.M.S.) — T 1 2 3 adaptive thermogenesis, ion homeostasis, innate immune responses, production both at Radboud University Medical Cen- of reactive oxygen species,4 and programmed cell death (apoptosis).5 Mitochondria ter, Nijmegen, the Netherlands. Address reprint requests to Dr. Smeitink at Nijme- contain their own DNA (mtDNA), which encodes 13 mitochondrial proteins, 2 ribo- gen Center for Mitochondrial Disorders, somal RNAs (rRNAs), and 22 transfer RNAs (tRNAs). The replication, transcription, Radboud University Nijmegen Medical translation, and repair of mtDNA are controlled by proteins encoded by nuclear DNA Center, Geert Grooteplein Zuid 10, P.O. 6,7 Box 9101, 6500 HB Nijmegen, the Neth- (nDNA). erlands, or at [email protected]. Mitochondrial dysfunction is not only observed in monogenic mitochondrial disorders but is also associated with more common pathologic conditions, such as N Engl J Med 2012;366:1132-41. 8 9 10 11 12 Copyright © 2012 Massachusetts Medical Society. Alzheimer’s disease, Parkinson’s disease, cancer, cardiac disease, diabetes, epilepsy,13 Huntington’s disease,14 and obesity.15 In addition, a progressive decline in the expression of mitochondrial genes is a central feature of normal human aging.16 It is not entirely clear whether the changes in expression that occur with aging have positive or negative effects on life span. Given the aging of the population in developed societies and the increasing prevalence of conditions such as Alzheimer’s disease and diabetes, the investigation of mitochondrial processes and diseases may make a timely contribution to our understanding of the human aging process and its relationship with the above conditions. Other sources of interference in mitochondrial function include the off-target effects of environmental toxins (e.g., rotenone) and frequently used drugs (e.g., amiodarone, biguanides, haloperidol, statins, valproic acid, zidovudine), anesthetics (e.g., halothane), antibiotics (e.g., chloramphenicol), chemotherapeutic agents (e.g., doxorubicin), and even aspirin (acetylsalicylic acid).17,18 Certain drugs may lead more frequently to adverse reactions and side effects in patients with mitochondrial disorders than in healthy persons.17,19 The term “mitochondrial medicine”20 refers to approaches that have been developed to manage mitochondrial dysfunction and, directly or indirectly, its consequences.21 In the past decade, the analysis of monogenic mitochondrial diseases has considerably advanced our understanding of the cellular pathophysiology of mitochondrial dysfunction. Here we summarize these insights and explain how they can contribute to the rational design of intervention strategies for mitochondrial dysfunction; we present our ongoing research on human mitochondrial complex I deficiency as an example of mitochondrial medicine. This information is preceded by a brief primer on the basics of mitochondrial structure and ATP generation.

1132 n engl j med 366;12 nejm.org march 22, 2012 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. Mechanisms of Disease

membrane potential (Δψ) and a matrix-directed Internal and External proton-motive force. The proton-motive force is STRUCTURE AND ATP GENERATION used at complex V to generate ATP, which is Structure transported to the cytosol by the adenine nucleo- Mitochondrial internal and external structure var- tide translocator. The proton-motive force also ies with cell type and metabolic state and often sustains many other mitochondrial functions becomes altered during mitochondrial dysfunction (e.g., ion transport, metabolite exchange, protein (Fig. 1A and 1B).22 Net mitochondrial morphology import, and mitochondrial fusion).27 As a conse- depends on the balance between mitochondrial quence, defects in oxidative phosphorylation of- motility, fission, and fusion. This equilibrium is ten induce multiple cellular aberrations. regulated by dedicated proteins and plays a role in metabolic energy dissipation, turnover of dam- MONOGENIC CELL MODELS OF aged mitochondria, distribution of mitochondria MITOCHONDRIAL DYSFUNCTION throughout the cell, induction of apoptosis, mitochondrial inheritance during cell division, and de- Primary and Secondary Disorders fense against aging.23 Mitochondria consist of outer With the use of mitochondrial proteome analysis,28 and inner membranes that envelop an aqueous approximately 1000 genes encoding mitochondrial compartment, the mitochondrial matrix (Fig. 1C proteins have been identified in humans (MitoCarta and 1D). The space between the inner and outer human inventory, Broad Institute). Mitochondrial membranes is referred to as the intermembrane dysfunction can arise from a mutation in one of space. The outer membrane is relatively smooth, these genes (causing a primary mitochondrial dis- whereas the inner membrane contains many ma- order) or from an outside influence on mitochon- trix-protruding folds (or cristae) that increase the dria (causing a secondary mitochondrial disorder). surface area of the inner membrane and have a dy- Causes of secondary disorders include viral infec- namic structure.22 These structural dynamics may tions29 and off-target drug effects.17,18 To date, serve to regulate mitochondrial metabolism.24 mutations in 228 protein-encoding nDNA genes and 13 mtDNA genes have been linked to a human ATP Generation disorder (Fig. 2). (For a list of these genes and The best-known mitochondrial function is the their associated disease phenotypes, see Table 1 in production of ATP. For this purpose, glucose is the Supplementary Appendix, available with the converted to pyruvate through the glycolysis path- full text of this article at NEJM.org.) Given the way in the cytosol (Fig. 1E). Pyruvate can be con- preponderance of nDNA-encoded mutations, this verted into lactate10 or taken up by mitochondria, review focuses mainly on these genes. A detailed where it is converted to acetyl coenzyme A (CoA). discussion of mtDNA mutations and their associ- Acetyl CoA enters the tricarboxylic acid cycle that ated pathology is provided elsewhere.30-35 generates the reduced forms of NADH and flavin adenine dinucleotide (FADH2). Alternatively, fatty Mutations and Phenotype acids25 and glutamine10 can be used as substrates. Although it is evident that mutations in mito- NADH and FADH2 fuel the oxidative-phosphory- chondrial proteins induce mitochondrial dysfunc- lation system, which consists of five functionally tion, it is less clear how specific genetic defects coupled mitochondrial protein complexes.26 NADH are linked to dysfunction at the level of cells, or- and FADH2 are oxidized at mitochondrial com- gans, and the whole organism. One major diffi- plexes I and II, respectively (Fig. 1F). The released culty in determining the effects of specific defects electrons are transported to complex III by coen- is that the consequences of mitochondrial dysfunc- zyme Q10 (CoQ10) and then to complex IV by cy- tion are affected by the action of compensatory tochrome c, where they are donated to molecular stress–response pathways. At the cellular level, oxygen to form water. The energy released by these responses include mitochondrial biogenesis, electron transport is used at complexes I, III, and increased expression of oxidative phosphorylation IV to expel protons (H+) from the mitochondrial proteins, a switch to a more glycolytic mode of matrix, which establishes a proton gradient ATP production, and the removal of dysfunctional across the mitochondrial inner membrane. The lat- mitochondria by quality-control systems.9,36-39 To ter is associated with an inside-negative inner- complicate matters even further, the substrate sup-

n engl j med 366;12 nejm.org march 22, 2012 1133 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. T h e new england journal o f medicine

A Normal fibroblast B Patient fibroblast (Leigh’s disease)

Low ∆ψ High ∆ψ Low ∆ψ High ∆ψ

C D MOM MIM

Matrix

Cristae IMS

E F

Glucose Mitochondrion Cytosol Matrix MIM IMS MOM ATP Glycolysis NADH NADH VDAC Cytosol

Lactate Pyruvate H+ FADH2 VDAC Pyruvate Fatty acids GIutamine CoQ10

Acetyl CoA H+ VDAC Glutamate

TCA cycle ATP Cytochrome c O2 VDAC + NADH FADH2 CIV H Mitochondrion O2 - + - + OXPHOS - + VDAC CV H+ ATP ATP

ply, the mode of ATP generation, the level of de- organism, genetic background — COLORboth FIGURE mitochon- Draft 4 3/02/12 mand for ATP, mitochondrial dynamics, and the drial and nuclear — also modifiesAuthor Koopman the phenotype rate of oxidative phosphorylation differ among cell of human mitochondrial diseasesFig # 1 (e.g., as reported types and tissue types. by Bénit et al.41). In this sense,Title mutations in mi- These factors increase the likelihood that the tochondrial proteins can evokeME pathologic pheno- DE Longo various types of tissue are not equally sensitive to types specific to a cell, tissue,Artist Knoperorgan, or patient 27,40 AUTHOR PLEASE NOTE: mitochondrial dysfunction. At the level of the that are manifested only whenFigure hasa beencertain redrawn and typethreshold has been reset Please check carefully Issue date 3/22/12 1134 n engl j med 366;12 nejm.org march 22, 2012 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. Mechanisms of Disease

42 Figure 1 (facing page). Mitochondrial Structure treatment. However, mitochondrial metabolism and ATP Generation. in situ is closely linked to that of the cell and is Panel A shows elongated mitochondria (filaments) in generally associated with submaximal rates of mi- a living skin fibroblast from a healthy person (staining tochondrial enzyme activity. In addition, the cel- with the mitochondria-specific cation tetramethylrho- lular milieu provides for communication among damine methyl ester [TMRM] and visualized with fluo- mitochondria, cytosol, and other organelles, and rescence microscopy). The more intense (red) the TMRM signal, the more negative the mitochondrial mitochondrial structure is greatly altered during membrane potential (Δψ). Panel B shows the fragment- isolation. As a consequence, the functional prop- ed mitochondrial structure in living skin fibroblasts erties of isolated mitochondria differ considerably from a patient with a mitochondrial disorder (Leigh’s from those within the cell.43-45 disease) caused by a mutation in NDUFS2, which en- Mitochondrial function can also be investigated codes a subunit of complex I. TMRM staining is less in- 22,24,25,27,42,46-48 tense (i.e., membrane potential is less negative) than in in intact (patient) cells. Here we healthy fibroblasts. In the electron micrograph shown summarize our ongoing research on complex I in Panel C, individual mitochondrial filaments (arrows) deficiency to illustrate how live-cell analysis can be can be seen in the cytosol of a fixed primary-skin fibro- integrated into an approach to the development blast from a healthy person. The dark line is the mem- of treatment strategies (Fig. 3). brane of the cell nucleus. Panel D shows mitochondrial ultrastructure and compartmentalization, highlighting Using biopsy specimens from pediatric patients the mitochondrial outer membrane (MOM), mitochon- carrying nDNA-encoded complex I mutations, we drial inner membrane (MIM), and intermembrane space have cultured primary fibroblast cell lines, which (IMS). Panel E summarizes the main ATP production are maintained under standardized conditions.47 pathway in human cells. In the cytosol, glucose is con- Cellular and mitochondrial physiology is assessed verted into pyruvate, which is subsequently processed in the mitochondrion to acetyl coenzyme A (CoA) and with the use of fluorescent reporter molecules that the reduced forms of NADH and flavin adenine dinu- are introduced into the cells and analyzed by cleotide (FADH2). In addition to using pyruvate as a means of live-cell microscopy (Fig. 4). The results substrate, the mitochondrion can also use fatty acids are then compared with those in cells from healthy and glutamine. Mitochondrial ATP production is car- children.49,52-57 Statistical evaluation of 26 phys- ried out by the oxidative phosphorylation (OXPHOS) system, shown at the bottom of Panel E. This system is iological variables in 14 control and 24 patient cell embedded in the MIM and consists of five multiprotein lines has revealed that complex I mutations lead to complexes (CI through CV), as shown in Panel F. NADH a reduction in the expression of complex I, depo- and FADH2 are oxidized at CI and CII, and the electrons larization of mitochondrial membrane potential, released are transported to CIII by coenzyme Q10 the accumulation of NADH, increased levels of (CoQ10). The electrons are then transferred to cytochrome c and delivered to CIV, where they react with reactive oxygen species, aberrations in mitochon- molecular oxygen (O2). TCA denotes tricarboxylic acid. drial structure, and aberrations in the homeostasis The energy released during electron transport is used of cytosolic and mitochondrial Ca2+ and ATP.58 to expel protons (H+) from the mitochondrial matrix The extent of these aberrations has been corre- across the MIM into the IMS. This creates a proton lated with the age of the patient at disease onset gradient across the MIM, which is associated with an 58 inside-negative potential. At CV, the energy stored in and with death from the disease. the proton gradient is used to drive ATP production by These results are currently being used in dis- allowing the reentry of H+ into the matrix. Because of ease modeling and drug-target prediction to de- the presence of voltage-dependent anion channels sign an intervention strategy focused on the above (VDACs), the MOM is ion-permeable. aberrations. Once a lead compound has been identified, the dependence of its effects on time and of mitochondrial dysfunction or cellular demand concentration can be evaluated at the cellular level on mitochondrial metabolism is exceeded. This to assess structure–activity relationships and its phenomenon is exemplified by the broad variety of properties of absorption, distribution, metabolism, clinical presentations associated with mutations and excretion (or toxicity).59 In the case of complex in nDNA-encoded mitochondrial genes (see Table I deficiency, lead compounds will then be evaluat- 1 in the Supplementary Appendix). ed in an animal model.57,60 Animal models are also available for several other primary and second- Developing a Rational Intervention Strategy ary mitochondrial disorders.31,32,56,61,62 Once the Mitochondrial function is often studied in mito- outcome scores in the animal model are satisfac- chondrial suspensions that have been isolated from tory, the effects of any compounds that are de- patient cells or tissues with the use of detergent veloped can be evaluated in clinical trials.

n engl j med 366;12 nejm.org march 22, 2012 1135 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. T h e new england journal o f medicine

AARS2 FH PCCB ARMS2 AK2 MTND1 ABCB7 DHODH NDUFB3 SDHD ACAD8 GCDH PCK2 BCL2 DIABLO MTND2 ACADVL DNAJC19 NDUFB9 SLC25A3 ACAD9 GCSH PDHA1 CPT1A GATM MTND3 ADCK3 FASTKD2 NDUFV1 SLC25A4 ACADM GFM1 PDHB DNM1L GFER MTND4 AGK GPD2 NDUFV2 SLC25A12 ACADS GLUD1 PDHX GCK HTRA2 MTND4L ATP5E HADHA NDUFS1 SLC25A13 ACADSB HADH PDP1 GK PANK2 MTND5 C12orf62 HADHB NDUFS2 SLC25A15 ACAT1 HARS2 POLG KIF1B PPOX MTND6 COX4I2 HCCS NDUFS3 SLC25A19 ALAS2 HIBCH POLG2 MAOA MTCYB COX6B1 L2HGDH NDUFS4 SLC25A20 ALDH2 HMGCS2 PYCR1 PINK1 MTCO1 CPT2 MMAA NDUFS6 SLC25A22 ALDH4A1 HMGCL RARS2 MTCO2 CRAT MPV17 NDUFS7 SLC25A38 ALDH6A1 HSD17B10 RMRP MTCO3 CYCS NDUFA1 NDUFS8 SPG7 AMT HSPD1 SARDH MTATP6 CYP11A1 NDUFA2 OPA1 TIMM8A ATPAF2 IDH2 SARS2 Mitochondrial MTATP8 CYP11B1 NDUFA9 OPA3 UCP1 AUH IDH3B SCO1 outer membrane CYP11B2 NDUFA10 PDSS1 UCP2 BCAT2 ISCU SCO2 CYP24A1 NDUFA11 SDHA UCP3 BCKDHA IVD SDHAF1 CYP27A1 NDUFA12 SDHB UQCRB BCKDHB KARS SDHAF2 Intermembrane CYP27B1 NDUFA13 SDHC UQCRQ BCS1L MCCC1 SOD2 space C8orf38 MCCC2 SUCLA2 C10orf2 MCEE SUCLG1 C12orf65 ME2 SURF1 Mitochondrial C20orf7 MRPS16 TACO1 inner membrane AIFM1 HLCS COA5 MRPS22 TK2 AKAP10 LRPPRC 7 81 AMACR LRRK2 COX10 MTFMT TMEM70 9 COX15 MTPAP TRMU APTX MFN2 CPS1 MUT TSFM 22 Partially BAX MLYCD D2HGDH NAGS TTC19 localized BOLA3 NFU1 DARS2 NDUFAF1 TUFM CYB5R3 PARK2 DBT NDUFAF2 UNG ETHE1 PARK7 DECR1 NDUFAF3 XPNPEP3 FXN SACS GDAP1 SPG20 DGUOK NDUFAF4 YARS2 107 DLD NUBPL HK1 WWOX DLAT OAT 15 DMGDH OGDH ETFA OTC Mitochondrial Submitochondrial ETFB OXCT1 matrix location AFG3L2 GLRX5 PNKD ETFDH PC COQ2 HOGA1 PUS1 FOXRED1 PCCA COQ6 MMAB REEP1 COQ9 MMADHC STAR GLDC PDSS2 TMEM126A

Figure 2. Genes of Mitochondria-Localized Proteins Linked to Disease in Humans. COLOR FIGURE This list summarizes the currently identified mtDNA-encoded (red) and nDNA-encoded (black) genes associated with mitochondrial Draft 6 2/10/12 diseases in humans when mutated. The genes are categorized according to the predicted localization of their corresponding proteins Author Koopman in the mitochondrial matrix (107 genes), the outer membrane (9 genes), the intermembrane space (7 genes), andFig # the2 inner membrane (81 genes). Also included are gene products of unknown submitochondrial location (15 genes) and gene productsTitle that partially localize to mitochondria (22 genes). Detailed information about the genes and their associated disease phenotypes is provided in Table 1 in the ME Supplementary Appendix. DE Longo Artist Knoper AUTHOR PLEASE NOTE: Figure has been redrawn and type has been reset Please check carefully Issue date 3/22/12 INTERVENTION STRATEGIES that were induced by reactive oxygen species. It appears that primary and secondary mitochondrial In a primary mitochondrial disorder, the mutation disorders have similar consequences at the cellular directly affects the expression level of the corre- level (Fig. 5).27,58,64,65 sponding protein, its function, or both, inducing Four intervention strategies for mitochondrial primary cell consequences and secondary cell con- dysfunction have been described: genetic therapy, sequences (Fig. 5).27,63 The secondary consequenc- the use of small molecules to target mitochondrial es often constitute part of the adaptive signaling dysfunction, metabolic manipulation, and diet and mechanisms. exercise (Fig. 5, and Table 2 in the Supplemen- Adaptations include the partial mitigation of tary Appendix). Genetic therapy, which is carried reduced mitochondrial ATP production by in- out at the preclinical level and focuses mainly on creased glycolysis, increases in the cellular levels mtDNA-associated disorders, is discussed else- of mitochondrial proteins and mitochondrial func- where.19,63,64,66,67 Small-molecule therapies, met- tion through mitochondrial biogenesis, and up- abolic manipulation, and dietary and exercise regi- regulation of the detoxification of reactive oxygen mens generally aim to increase the capacity for species, triggered by changes in the redox state ATP synthesis, bypass the mitochondrial defect,

1136 n engl j med 366;12 nejm.org march 22, 2012 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. Mechanisms of Disease

Administration – Dosage – Duration Manual Manual Manual Chemical Protein Automated Automated Automated modification SARS Culturing Chemical High content, high throughput, or both Outcome Outcome ADME–Tox scores scores

Fluorescent Live-cell Lead Primary Image Statistical Cellular Lead Animal Clinical Patient reporter micros- optimi- cells analysis evaluation target compound model trials molecule copy zation

Administration – Dosage – Duration

Figure 3. Proposed Approach to the Development of Intervention Strategies through Microscopical Analysis of Cells from Patients with Mitochondrial Diseases. This schematic flow chart illustrates how the analysis of patient-derived primary cells by means of fluorescent reporter molecules and live- cell microscopy can be used to determine the cellular consequences of a mitochondrial dysfunction. This strategy can be used to extract the maximal amount of information from individual images (high content), test a large number of conditions (high throughput), or both. The information obtained can provide the basis for the discovery of lead compounds with pharmacologic or biologic activity. The chemical structure of the lead compounds is then modified to improve their potency, selectivity, or pharmacokinetic characteristics (a process known as lead optimization). These optimized compounds can then be tested in cells (red line) and, if this step is successful, in a suit- able animal model and clinical trials. The blue boxes signify the administration of test agents at various concentrations and for various durations. SARS denotes structure–activity relationships, and ADME–Tox absorption, distribution, metabolism, excretion, and toxicity.

stimulate mitochondrial biogenesis, or reduce lev- MITO-porters). Recently, in a mouse model of els of reactive oxygen species.66 Targeting reactive mitochondrial lipoamide dehydrogenase (LAD) oxygen species may not be entirely beneficial, deficiency, mitochondrial enzyme-replacement however, since they can act as signaling mole- therapy mediated by TAT (a transactivating tran- cules,4,27,48,53 in which case their elimination might scriptional activator of human immunodeficiency also have detrimental effects. virus 1) was used to introduce a TAT-LAD fusion protein.75 Mitochondria-Targeted Small Molecules In contrast with membrane-permeable small Treatment of Mitochondrial Disorders molecules, which exert their effect throughout In 2006, a large-scale review of published clinical the cell, novel therapeutic strategies involve the trials of various treatments for primary mitochon- specific targeting of mitochondria by small mol- drial disorders revealed no evidence supporting the ecules (referred to as “cargo”).65,68-74 Targeting use of any intervention.76 More recently, the results can be achieved by coupling the cargo to a delo- of several trials in which a variety of treatments calized lipophilic cation, leading to its accumula- for mitochondrial disease were studied, including tion in mitochondria. Several antioxidants have dichloroacetate, vitamins, and a cocktail of spe- been successfully targeted using the cation ap- cific food components (nutraceuticals), were re- proach (e.g., plastoquinones and CoQ variants). viewed.77 Although some of these trials showed a Protein-based cargo can be coupled to a mitochon- positive effect on one or more clinical or biochem- drial targeting sequence recognized by the mito- ical primary end points, none led to the filing of chondrial protein import machinery. Another strat- a New Drug Application with the Food and Drug egy involves the use of mitochondria-penetrating Administration. peptides, engineered cell-penetrating peptides that The drug idebenone (a CoQ10 variant) has been target mitochondria on the basis of their mem- approved for the treatment of Friedreich’s atax- brane potential and lipophilicity (e.g., the antioxi- ia.41 A large multicenter, randomized, placebo- dant Szeto–Schiller peptide, SS-31). There are also controlled trial of idebenone in patients with vesicle-based transporters that target mitochon- Leber’s hereditary optic neuropathy revealed that dria through macropinocytosis, endosomal es- patients with discordant visual acuities were the cape, and membrane fusion (e.g., DQAsomes and most likely to benefit from this treatment.78 In

n engl j med 366;12 nejm.org march 22, 2012 1137 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. T h e new england journal o f medicine

A Morphology and Mem- B NADH C ROS D Redox State G Size-Based Mitogram brane Potential

F Mitochondrial Free Ca2+ E Cytosolic Free ATP

Figure 4. Typical Cell Readouts in Primary Fibroblasts from Human Skin. Mitochondrial morphology and membrane potential can be visualized with the use of TMRM staining (Panel A),46 NADH levels with auto- 49 48 fluorescence (Panel B), levels of reactive oxygen species with the chemical reporter CM-H2DCFDA (Panel C), mitochondrial redox state with the mitochondria-targeted protein-based sensor Mit-roGFP149 (400-nm image shown) (Panel D), the cytosolic free ATP concentration with the protein-based sensor ATeam (Panel E),50 and levels of mitochondrial free Ca2+ in a cell stimulated with the hormone bradykinin and the calcium-sensitive cation Rhod-2 (Panel F).51 A mitogram shows all mitochondrial structures in the cell, sorted on the basis of size (Panel G).52

one study, investigators found that a ketogenic term-mitochondrial+disease); these include stud- diet was effective in preventing epileptic seizures ies of CoQ10 for the treatment of muscle weakness in children with electron-transport-chain defects.79 and mitochondrial diseases, dietary supplements The findings in another study indicated that nu- for MELAS (mitochondrial encephalomyopathy, tritional modulation affects mitochondrial func- lactic acidosis, and strokelike episodes), EPI-743 tion, suggesting that it may be worthwhile to for mitochondrial diseases, human growth hor- pursue nutritional treatment strategies.64 mone for obesity, nutritional therapy for diabetes, A successful treatment strategy has been de- pioglitazone for diabetes, idebenone for MELAS, veloped for patients with a secondary mitochon- and vitamin E for mitochondrial trifunctional drial disorder involving Ullrich’s congenital mus- protein deficiency. cular dystrophy and Bethlem’s myopathy.80-82 These myopathies, caused by mutations in the FUTURE PERSPECTIVES extracellular-matrix protein collagen VI, are associated with mitochondrial dysfunction and A field that began more than 50 years ago, when muscle-cell apoptosis. The pathogenic mechanism a physician detected a mitochondrial disorder in involves inappropriate opening of the mitochon- a single patient with hypermetabolism,84 has now drial permeability transition pore. This action was evolved into the discipline of mitochondrial med- prevented in patients treated with a permeability- icine. Lessons learned from studies of rare diseases transition-pore desensitizer, cyclosporin A. An- have implications for a broad range of medical other study showed that cyclosporin A reduced disciplines. Within the next few years, the appli- the size of myocardial infarcts during cardiac re- cation of new technologies such as whole-exome perfusion.83 Other published intervention strate- sequencing can be expected to result in a huge gies are summarized in Table 2 in the Supple- expansion of the number of known causative nu- mentary Appendix. clear gene defects in patients with mitochondrial An overview of current clinical trials can be disease (which is currently diagnosed by means found online (www.clinicaltrials.gov/ct2/results? of biochemical methods, mtDNA and nDNA se-

1138 n engl j med 366;12 nejm.org march 22, 2012 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. Mechanisms of Disease

Primary mitochondrial disorder

Genetic Mutation Secondary mitochondrial disorder strategies

Mitochondrial Primary cell Secondary cell Disease protein defect consequences consequences

Expression ∆Ψ ATP production Brain Function Reactive oxygen Glycolysis Eyes species Redox state Heart Dynamics PTP opening Liver Substrate accu- Mitophagy Kidney mulation Apoptosis Muscle Ionic balance Nerve Adaptation Signaling Mitochondrial biogenesis

Genetic Treatment with Metabolic Diet and strategies small molecules manipulation exercise

Figure 5. Consequences of Mitochondrial Dysfunction and Potential Intervention Strategies. Mitochondrial dysfunction can have primary and secondary pathologic consequences. Several cellular feedback mechanisms exist that can counteract the effects of the mitochondrial dysfunction (adaptation). For instance, the increased production of reactive oxygen species (ROS) caused by mitochondrial dysfunction can induce the expression of antioxidant systems. Possible intervention strategies (indicated by dotted lines) may intervene at the level of the protein defect, the primary consequences, the secondary consequences, or the adaptive responses. The symbol Δψ denotes change in mitochondrial membrane potential, and PTP permeability transition pore.

quencing, and candidate-gene studies). In the near may also be useful to at least partially counter- future, the challenge will be to increase our under- balance the consequences of mitochondrial dys- standing of the consequences of mitochondrial function. dysfunction at all levels of complexity in order to Given the metabolic individuality in humans,85 drive the development of rational treatment strat- we do not expect monotherapeutic metabolic ma- egies. Although gene therapy has been proved nipulation strategies to be a magic bullet but pre- beneficial, its use is still limited by the sheer dict that the next step in treatment development number of potential mitochondrial gene defects. will be the use of combinations of manipulation Direct enzyme-replacement therapy may be feasi- strategies applied in an individualized way. In ble in addressing single-protein enzymes, such as the meantime, efforts must be made on a global those in the tricarboxylic acid cycle, and perhaps scale to genetically categorize patient cohorts, mitochondrial multiprotein enzyme complexes. monitor them in a standardized way by means of Another promising approach may be indirect prognostic scoring systems,86 and develop new enzyme-replacement therapy, which bypasses biomarkers to allow for proper monitoring of electron-transport defects with the use of alter- the effect of intervention strategies. native dehydrogenases or oxidases (see Table 2 in Disclosure forms provided by the authors are available with the Supplementary Appendix). Although more ex- the full text of this article at NEJM.org. We thank Dr. J. Fransen, Department of Cell Biology, Radboud perimental data are required, exogenous stimula- University Nijmegen Medical Center, for providing electron- tion of endogenous cellular adaptation programs microscopical images.

n engl j med 366;12 nejm.org march 22, 2012 1139 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. T h e new england journal o f medicine

References 1. Azzu V, Brand MD. The on-off switch- ylation diseases. Biochim Biophys Acta between cell repair, apoptosis or senes- es of the mitochondrial uncoupling pro- 2009;1792:1159-67. cence in response to damaging signals. teins. Trends Biochem Sci 2010;35:298-307. 20. Luft R. The development of mitochon- Cell Signal 2011;23:1076-81. 2. Cardoso AR, Queliconi BB, Kowal- drial medicine. Proc Natl Acad Sci U S A 37. Kourtis N, Tavernarakis N. Cellular towski AJ. Mitochondrial ion transport 1994;91:8731-8. stress response pathways and ageing: intri- pathways: role in metabolic diseases. Bio- 21. Swerdlow RH. Mitochondrial medicine cate molecular relationships. EMBO J 2011; chim Biophys Acta 2010;1797:832-8. and the neurodegenerative mitochondri- 30:2520-31. 3. West AP, Shadel GS, Ghosh S. Mito- opathies. Pharmaceuticals (Basel) 2009;2: 38. Twig G, Shirihai OS. The interplay be- chondria in innate immune responses. Nat 150-67. tween mitochondrial dynamics and mi- Rev Immunol 2011;11:389-402. 22. Benard G, Rossignol R. Ultrastruc- tophagy. Antioxid Redox Signal 2011;14: 4. Murphy MP, Holmgren A, Larsson NG, ture of the mitochondrion and its bearing 1939-51. et al. Unraveling the biological roles of on function and bioenergetics. Antioxid 39. Youle RJ, Narendra DP. Mechanisms reactive oxygen species. Cell Metab 2011; Redox Signal 2008;10:1313-42. of mitophagy. Nat Rev Mol Cell Biol 2011; 13:361-6. 23. Westermann B. Mitochondrial fusion 12:9-14. 5. Spencer SL, Sorger PK. Measuring and and fission in cell life and death. Nat Rev 40. Rossignol R, Faustin B, Rocher C, modeling apoptosis in single cells. Cell Mol Cell Biol 2010;11:872-84. Malgat M, Mazat JP, Letellier T. Mitochon- 2011;144:926-39. 24. Dieteren CEJ, Gielen SCAM, Nijtmans drial threshold effects. Biochem J 2003; 6. Scarpulla RC. Transcriptional para- LGJ, et al. Solute diffusion is hindered in 370:751-62. digms in mammalian mitochondrial bio- the mitochondrial matrix. Proc Natl Acad 41. Bénit P, El-Khoury R, Schiff M, Sain- genesis and function. Physiol Rev 2008; Sci U S A 2011;108:8657-62. sard-Chanet A, Rustin P. Genetic back- 88:611-38. 25. Bastin J, Lopes-Costa A, Djouadi F. ground influences mitochondrial func- 7. Shutt TE, Shadel GS. A compendium Exposure to resveratrol triggers pharmaco- tion: modeling mitochondrial disease for of human mitochondrial gene expression logical correction of fatty acid utilization therapeutic development. Trends Mol Med machinery with links to disease. Environ in human fatty acid oxidation-deficient 2010;16:210-7. Mol Mutagen 2010;51:360-79. fibroblasts. Hum Mol Genet 2011;20:2048- 42. Brand MD, Nicholls DG. Assessing 8. Coskun P, Wyrembak J, Schriner S, et 57. mitochondrial dysfunction in cells. Bio- al. A mitochondrial etiology of Alzheimer 26. Smeitink JAM, van den Heuvel L, chem J 2011;435:297-312. and Parkinson disease. Biochim Biophys DiMauro S. The genetics and pathology of 43. Cortassa S, Aon MA, Winslow RL, Acta 2011 August 16 (Epub ahead of print). oxidative phosphorylation. Nat Rev Genet O’Rourke B. A mitochondrial oscillator 9. McCoy MK, Cookson MR. Mitochon- 2001;2:342-52. dependent on reactive oxygen species. drial quality control and dynamics in Par- 27. Koopman WJH, Nijtmans LGJ, Diet- Biophys J 2004;87:2060-73. kinson’s disease. Antioxid Redox Signal eren CEJ, et al. Mammalian mitochondri- 44. Juhaszova M, Zorov DB, Kim SH, et al. 2011 July 7 (Epub ahead of print). al complex I: biogenesis, regulation, and Glycogen synthase kinase-3 beta medi- 10. Cairns RA, Harris IS, Mak TW. Regu- reactive oxygen species generation. Anti- ates convergence of protection signaling lation of cancer cell metabolism. Nat Rev oxid Redox Signal 2010;12:1431-70. to inhibit the mitochondrial permeability Cancer 2011;11:85-95. 28. Pagliarini DJ, Calvo SE, Chang B, et transition pore. J Clin Invest 2004;113: 11. Hoppel CL, Tandler B, Fujioka H, Riva al. A mitochondrial protein compendium 1535-49. A. Dynamic organization of mitochon- elucidates complex I disease biology. Cell 45. Picard M, Taivassalo T, Ritchie D, et dria in human heart and in myocardial 2008;134:112-23. al. Mitochondrial structure and function disease. Int J Biochem Cell Biol 2009; 29. Wang C, Liu X, Wei B. Mitochondrion: are impaired by standard isolation meth- 41:1949-56. an emerging platform critical for host an- ods. PLoS One 2011;6(3):e18317. 12. Sleigh A, Raymond-Barker P, Thack- tiviral signaling. Expert Opin Ther Targets 46. Distelmaier F, Koopman WJH, Testa ray K, et al. Mitochondrial dysfunction in 2011;15:647-65. ER, et al. Life cell quantification of mito- patients with primary congenital insulin 30. Dimauro S, Schon EA. Mitochondrial chondrial membrane potential at the sin- resistance. J Clin Invest 2011;121:2457-61. disorders in the nervous system. Annu Rev gle organelle level. Cytometry A 2008;73: 13. Lönnqvist T, Paetau A, Valanne L, Pihko Neurosci 2008;31:91-123. 129-38. H. Recessive twinkle mutations cause se- 31. Tyynismaa H, Suomalainen A. Mouse 47. Distelmaier F, Koopman WJH, van vere epileptic encephalopathy. Brain 2009; models of mitochondrial DNA defects den Heuvel LP, et al. Mitochondrial com- 132:1553-62. and their relevance for human disease. plex I deficiency: from organelle dysfunc- 14. Mochel F, Haller RG. Energy deficit in EMBO Rep 2009;10:137-43. tion to clinical disease. Brain 2009;132: Huntington disease: why it matters. J Clin 32. Wallace DC, Fan W. The pathophysiol- 833-42. Invest 2011;121:493-9. ogy of mitochondrial disease as modeled in 48. Forkink M, Smeitink JAM, Brock R, 15. Tseng YH, Cypess AM, Kahn CR. Cel- the mouse. Genes Dev 2009;23:1714-36. Willems PH, Koopman WJ. Detection and lular bioenergetics as a target for obesity 33. Gredilla R, Bohr VA, Stevnsner T. Mi- manipulation of mitochondrial reactive therapy. Nat Rev Drug Discov 2010;9:465- tochondrial DNA repair and association oxygen species in mammalian cells. Bio- 82. with aging — an update. Exp Gerontol chim Biophys Acta 2010;1797:1034-44. 16. Bishop NA, Lu T, Yankner BA. Neural 2010;45:478-88. 49. Verkaart S, Koopman WJH, Cheek J, et mechanisms of ageing and cognitive de- 34. Swerdlow RH. Does mitochondrial al. Mitochondrial and cytosolic thiol re- cline. Nature 2010;464:529-35. DNA play a role in Parkinson’s disease? A dox state are not detectably altered in iso- 17. Finsterer J, Segall L. Drugs interfering review of cybrid and other supportive evi- lated human NADH:ubiquinone oxidore- with mitochondrial disorders. Drug Chem dence. Antioxid Redox Signal 2011 May ductase deficiency. Biochim Biophys Acta Toxicol 2010;33:138-51. 25 (Epub ahead of print). 2007;1772:1041-51. 18. Cohen BH. Pharmacologic effects on 35. Yarham JW, Elson JL, Blakely EL, 50. Imamura H, Nhat KP, Togawa H, et al. mitochondrial function. Dev Disabil Res McFarland R, Taylor RW. Mitochondrial Visualization of ATP levels inside single Rev 2010;16:189-99. tRNA mutations and disease. Wiley Inter- living cells with fluorescence resonance 19. Dimauro S, Rustin P. A critical ap- discip Rev RNA 2010;1:304-24. energy transfer-based genetically encod- proach to the therapy of mitochondrial 36. Erol A. Deciphering the intricate reg- ed indicators. Proc Natl Acad Sci U S A respiratory chain and oxidative phosphor- ulatory mechanisms for the cellular choice 2009;106:15651-6.

1140 n engl j med 366;12 nejm.org march 22, 2012 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. Mechanisms of Disease

51. Koopman WJH, Distelmaier F, Esseling 62. Schmidt S, Linnartz B, Mendritzki S, et MS, Lorberboum-Galski H. Successful TAT- JJ, Smeitink JA, Willems PH. Computer- al. Genetic mouse models for Parkinson’s mediated enzyme replacement therapy in assisted live cell analysis of mitochondrial disease display severe pathology in glial a mouse model of mitochondrial E3 defi- membrane potential, morphology and cal- cell mitochondria. Hum Mol Genet 2011; ciency. J Mol Med (Berl) 2011;89:161-70. cium handling. Methods 2008;46:304-11. 20:1197-211. 76. Chinnery P, Majamaa K, Turnbull D, 52. Koopman WJH, Visch HJ, Verkaart S, 63. Wallace DC, Fan W, Procaccio V. Mi- Thorburn D. Treatment for mitochondrial van den Heuvel LW, Smeitink JA, Willems tochondrial energetics and therapeutics. disorders. Cochrane Database Syst Rev PH. Mitochondrial network complexity Annu Rev Pathol 2010;5:297-348. 2006;1:CD004426. and pathological decrease in complex I 64. Schiff M, Bénit P, Coulibaly A, Loublier 77. Stacpoole PW. Why are there no prov- activity are tightly correlated in isolated S, El-Khoury R, Rustin P. Mitochondrial en therapies for genetic mitochondrial human complex I deficiency. Am J Physiol response to controlled nutrition in health diseases? Mitochondrion 2011;11:679-85. Cell Physiol 2005;289:C881-C890. and disease. Nutr Rev 2011;69:65-79. 78. Klopstock T, Yu-Wai-Man P, Dimitriadis 53. Koopman WJH, Verkaart S, Visch HJ, 65. Camara AKS, Lesnefsky EJ, Stowe DF. K, et al. A randomized placebo-controlled et al. Human NADH:ubiquinone oxidore- Potential therapeutic benefits of strategies trial of idebenone in Leber’s hereditary op- ductase deficiency: radical changes in mi- directed to mitochondria. Antioxid Redox tic neuropathy. Brain 2011;134:2677-86. tochondrial morphology? Am J Physiol Cell Signal 2010;13:279-347. 79. Kang HC, Lee YM, Kim HD, Lee JS, Physiol 2007;293:C22-C29. 66. Wenz T, Williams SL, Bacman SR, Slama A. Safe and effective use of the ke- 54. Koopman WJH, Verkaart S, van Moraes CT. Emerging therapeutic ap- togenic diet in children with epilepsy and Emst-de Vries SE, et al. Mitigation of proaches to mitochondrial diseases. Dev mitochondrial respiratory chain complex NADH:ubiquinone oxidoreductase defi- Disabil Res Rev 2010;16:219-29. defects. Epilepsia 2007;48:82-8. ciency by chronic Trolox treatment. Bio- 67. Craven L, Elson J, Irving L, et al. Mito- 80. Irwin WA, Bergamin N, Sabatelli P, et chim Biophys Acta 2008;1777:853-9. chondrial DNA diseases: new options for al. Mitochondrial dysfunction and apop- 55. Koene S, Smeitink JAM. Metabolic prevention. Hum Mol Genet 2011;20:R168- tosis in myopathic mice with collagen VI manipulators: a well founded strategy to R174. deficiency. Nat Genet 2003;35:367-71. combat mitochondrial dysfunction. J In- 68. Yousif LF, Stewart KM, Horton KL, 81. Angelin A, Tiepolo T, Sabatelli P, et al. herit Metab Dis 2010;34:315-25. Kelley SO. Mitochondria-penetrating pep- Mitochondrial dysfunction in the patho- 56. Valsecchi F, Koopman WJH, Manjeri tides: sequence effects and model cargo genesis of Ullrich congenital muscular GR, Rodenburg RJ, Smeitink JA, Willems transport. Chembiochem 2009;10:2081-8. dystrophy and prospective therapy with PH. Complex I disorders: causes, mecha- 69. Chacko BK, Reily C, Srivastava A, et cyclosporins. Proc Natl Acad Sci U S A nisms, and development of treatment al. Prevention of diabetic nephropathy in 2007;104:991-6. strategies at the cellular level. Dev Disabil Ins2(+/)− (AkitaJ) mice by the mitochon- 82. Merlini L, Angelin A, Tiepolo T, et al. Res Rev 2010;16:175-82. dria-targeted therapy MitoQ. Biochem J Cyclosporin A corrects mitochondrial 57. Roestenberg P, Manjeri GR, Valsecchi 2010;432:9-19. dysfunction and muscle apoptosis in pa- F, Smeitink JA, Willems PH, Koopman WJ. 70. Shokolenko IN, Alexeyev MF, LeDoux tients with collagen VI myopathies. Proc Pharmacological targeting of mitochon- SP, Wilson GL. The approaches for ma- Natl Acad Sci U S A 2008;105:5225-9. drial complex I deficiency: the cellular level nipulating mitochondrial proteome. Envi- 83. Piot C, Croisille P, Staat P, et al. Effect and beyond. Mitochondrion 2012;12:57- ron Mol Mutagen 2010;51:451-61. of cyclosporine on reperfusion injury in 65. 71. Zhang E, Zhang C, Su Y, Cheng T, Shi acute myocardial infarction. N Engl J Med 58. Blanchet L, Buydens LMC, Smeitink C. Newly developed strategies for multi- 2008;359:473-81. JAM, et al. Isolated mitochondrial com- functional mitochondria-targeted agents 84. Luft R, Ikkos D, Palmieri G, Ernster L, plex I deficiency: explorative data analysis in cancer therapy. Drug Discov Today 2011; Afzelius B. A case of severe hypermetabo- of patient cell parameters. Curr Pharm 16:140-6. lism of nonthyroid origin with a defect in Des 2011;17:4023-33. 72. Skulachev MV, Antonenko YN, Anisi- the maintenance of mitochondrial respi- 59. Zanella F, Lorens JB, Link W. High mov VN, et al. Mitochondrial-targeted ratory control: a correlated clinical, bio- content screening: seeing is believing. plastoquinone derivatives: effect on senes- chemical, and morphological study. J Clin Trends Biotechnol 2010;28:237-45. cence and acute age-related pathologies. Invest 1962;41:1776-804. 60. Kruse SE, Watt WC, Marcinek DJ, Curr Drug Targets 2011;12:800-26. 85. Suhre K, Shin SY, Petersen AK, et al. Kapur RP, Schenkman KA, Palmiter RD. 73. Smith RA, Hartley RC, Murphy MP. Human metabolic individuality in bio- Mice with mitochondrial complex I defi- Mitochondria-targeted small molecule ther- medical and pharmaceutical research. ciency develop a fatal encephalomyopathy. apeutics and probes. Antioxid Redox Sig- Nature 2011;477:54-60. Cell Metab 2008;7:312-20. nal 2011;15:3021-38. 86. Morava E, van den Heuvel L, Hol F, et 61. Koene S, Willems PHGM, Roestenberg 74. Won YW, Lim KS, Kim YH. Intracel- al. Mitochondrial disease criteria: diag- P, Koopman WJ, Smeitink JA. Mouse mod- lular organelle-targeted non-viral gene nostic applications in children. Neurolo- els for nuclear DNA-encoded mitochon- delivery systems. J Control Release 2011; gy 2006;67:1823-6. drial complex I deficiency. J Inherit Metab 152:99-109. Copyright © 2012 Massachusetts Medical Society. Dis 2011;34:293-307. 75. Rapoport M, Salman L, Sabag O, Patel

n engl j med 366;12 nejm.org march 22, 2012 1141 The New England Journal of Medicine Downloaded from nejm.org at KU LEUVEN BIOMEDICAL LIBRARY on September 11, 2012. For personal use only. No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. Annals of Medicine, 2012; 44: 41–59

TRENDS IN MOLECULAR MEDICINE

Mechanisms of mitochondrial diseases

EMIL YLIKALLIO 1 & ANU SUOMALAINEN1,2

1 Research Programs Unit, Molecular Neurology, Biomedicum-Helsinki, University of Helsinki, Finland, and 2 Department of Neurology, Helsinki University Central Hospital, Helsinki, Finland

Abstract Mitochondria are essential organelles with multiple functions, the most well known being the production of adenosine triphosphate (ATP) through oxidative phosphorylation (OXPHOS). The mitochondrial diseases are deﬁ ned by impairment of OXPHOS. They are a diverse group of diseases that can present in virtually any tissue in either adults or children. Here we review the main molecular mechanisms of mitochondrial diseases, as presently known. A number of disease-causing genetic defects, either in the nuclear genome or in the mitochondria ’ s own genome, mitochondrial DNA (mtDNA), have been identiﬁ ed. The most classical genetic defect causing mitochondrial disease is a mutation in a gene encoding a structural OXPHOS subunit. However, mitochondrial diseases can also arise through impaired mtDNA maintenance, defects in mitochondrial translation factors, and various more indirect mechanisms. The putative consequences of mitochondrial dysfunction on a cellular level are discussed.

Key words: Genetic diseases, inborn , mitochondria , mitochondrial diseases

For personal use only. Mitochondrial diseases are among the most common mito chondria take part in a number of other proof the inherited disorders of metabolism (reviewed cesses including heme biosynthesis, steroid hormone in (1)). For the diseases caused by mutations in mito- biosynthesis, calcium homeostasis, and apoptosis chondrial DNA (mtDNA), a population prevalence (reviewed in (5)). Mitochondrial diseases are gener- of at least 9.2 per 100,000 people was measured in ally understood as diseases where one or more of the the working-age population of north-east England. OXPHOS complexes are dysfunctional. This review In addition, 16.2 per 100,000 people were identifi ed focuses on the various molecular mechanisms behind as asymptomatic mtDNA mutation carriers who are these diseases. Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 at risk of developing mitochondrial disease (2). These Mitochondria are surrounded by two membranes. fi gures did not include mitochondrial diseases caused The outer mitochondrial membrane (OMM) con- by nuclear gene defects, and thus the total prevalence tains large amounts of porin (also known as voltage- of mitochondrial diseases is thought to be higher, at dependent anion channel or VDAC), which allows least in the order of 1 in 5,000 people. passage of small hydrophilic molecules such as sug- The mitochondrial diseases may cause symptoms ars, ions, and amino acids. The IMM is impermeable in any organ and present at any age (reviewed in to most solutes. It has numerous folds called cristae, (3,4)). A central function of mitochondria is produc- and it encloses the mitochondrial matrix. Mitochon- tion of the cellular energy currency adenosine triphos- dria are dynamic organelles that can move, fuse, and phate (ATP) through oxidative phosphorylation divide according to the needs of the cell. In fact, in (OXPHOS). OXPHOS is carried out by fi ve enzyme many cell types, it is often more appropriate to regard complexes in the inner mitochondrial membrane the mitochondria as a dynamic network rather than (IMM) (Figure 1). Apart from energy conversion, multiple discrete organelles (reviewed in (5)).

Correspondence: Emil Ylikallio, University of Helsinki, Room C519b, Haartmaninkatu 8, Helsinki 00290, Finland. Fax: ϩ 358 9 4717 1964. E-mail: emil.ylikallio@helsinki.ﬁ

Key messages Abbreviations • Mitochondrial diseases can manifest in any organ ad autosomal-dominant at any age. They are caused by mutations in the ar autosomal-recessive genes of mitochondrial DNA or nuclear DNA, AS Alpers syndrome and their inheritance can be autosomal- ATP adenosine triphosphate CI complex I dominant or recessive, X-linked, or maternal. CII complex II • Many of the genes that are mutated in mito- CIII complex III chondrial diseases encode proteins that are CIV complex IV structural components or assembly factors CV complex V CoQ coenzyme Q of the OXPHOS complexes. Others encode 10 COX cytochrome c oxidase proteins involved in mtDNA maintenance dATP deoxyadenosine triphosphate or mitochondrial protein synthesis. In addi- dCTP deoxycytidine triphosphate tion, OXPHOS dysfunction can arise through dGK deoxyguanosine kinase indirect mechanisms. dGTP deoxyguanosine triphosphate • The metabolic consequences of mitochondrial dNTP deoxynucleoside triphosphate dTTP thymidine triphosphate dysfunction are incompletely understood, GRACILE growth retardation, amino aciduria, cholestasis, both on the level of the cell and the level of the iron overload, lactic acidosis, and early death organism, and cannot be explained by mere IMM inner mitochondrial membrane ATP deﬁ ciency. IMS inter-membrane space IOSCA Infantile-onset spinocerebellar ataxia KSS Kearns– Sayre syndrome LHON Leber’ s hereditary optic neuropathy Genetics of mitochondrial disease LS Leigh syndrome LSBL leukoencephalopathy with brain-stem and Mitochondrial diseases can be inherited by maternal, spinal cord involvement and lactate elevation autosomal, or X-chromosomal transmission. This MDS mitochondrial DNA depletion syndrome exceptional genetic variability is due to the unique MELAS mitochondrial encephalopathy with lactic acidosis and stroke-like episodes genetic control of the organelle, which depends on two MERRF myoclonic epilepsy with ragged-red ﬁ bers separate genomes. Mitochondria contain their own MIRAS mitochondrial recessive ataxia syndrome

For personal use only. genome, called mtDNA. Human mtDNA is an intron- MLASA mitochondrial myopathy, lactic acidosis, and less multi-copy, circular 16,569 bp molecule that is sideroblastic anemia exclusively inherited via the maternal line (6). Mito- MNGIE mitochondrial neurogastrointestinal encephalopathy chondrial DNA encodes 13 proteins, each of which MRP mitochondrial ribosomal protein is an essential subunit of one of the OXPHOS com- mtDNA mitochondrial DNA plexes (Figure 1). In addition, mtDNA encodes 22 NARP neurogenic weakness, ataxia, retinitis pigmentosa tRNAs and 2 rRNAs required for the translation of nDNA nuclear DNA these proteins (6). Primary or secondary defects of OMM outer mitochondrial membrane OXPHOS oxidative phosphorylation Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 mtDNA are an important cause of mitochondrial dis- PEO progressive external ophthalmoplegia ease, often leading to one of several classical mtDNA PS Pearson’ s syndrome syndromes (Table I). The mtDNA syndromes are Q ubiquinone (oxidized) sporadic or maternally inherited, when the primary defect QH2 ubiquinone (reduced) is a mutation or deletion in mtDNA, and autosomally RC respiratory chain RNR ribonucleotide reductase inherited when the mtDNA defect is secondary to a ROS reactive oxygen species mutation in a nuclear gene that is required for mtDNA SANDO sensory ataxic neuropathy, dysarthria, and maintenance. However, most of the mitochondrial ophthalmoparesis proteins, including the majority of OXPHOS com- SCA-E spinocerebellar ataxia with epilepsy plex subunits and assembly factors, are encoded by TK2 thymidine kinase 2 TP thymidine phosphorylase the nuclear DNA (nDNA) (7). Therefore, the majority of the mitochondrial diseases are caused by defects in nuclear genes and are inherited according to their Mitochondrial DNA genetics chromosomal location. A mitochondrial disease may involve isolated dysfunction of only one OXPHOS Inheritance of mtDNA mutations is different from complex or combined dysfunction of several com- that of nDNA mutations because mtDNA is a multi- plexes. The latter results for instance from defects in copy genome with hundreds or thousands of copies per mtDNA maintenance, mitochondrial protein synthesis, cell, and because mtDNA is only inherited from the or mitochondrial protein importation. mother. In most cases, all of the mtDNA molecules Mitochondrial diseases 43 For personal use only.

Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 Figure 1. This ﬁ gure shows human mtDNA represented by a circle. The positions of each of the protein-coding genes as well as the 12S and 16S rRNA genes and the tRNA genes are indicated. The OXPHOS system is shown above in simpliﬁ ed form. The protein-coding genes are color-coded according to the complex to which their product belongs. The non-coding D-loop region is also shown. The two strands of mtDNA are divided into a heavy strand and a light strand. The regions known as origins of heavy and light strand replication

(OH and OL, respectively) are indicated, as are the transcription promoters for heavy and light strands (HSP and LSP, respectively). In mitochondrial energy conversion, acetyl-coenzyme A (CoA), which can be derived from pyruvate produced in cytoplasmic glycolysis or from mitochondrial fatty acid oxidation, conveys the carbon atoms of the acetyl group into the tricarboxylic acid (TCA) cycle. The enzymes of the TCA cycle oxidize these carbons and generate high-energy electrons that are transferred to the electron carriers nicotinamide ϩ adenine dinucleotide (NADH (reduced), NAD (oxidized)), or ﬂ avin adenine dinucleotide (FADH2 (reduced), FAD (oxidized)). The OXPHOS system comprises ﬁ ve large enzyme complexes, labeled complex I–V. All OXPHOS complexes are embedded in the inner mitochondrial membrane (IMM). Complexes I–IV together constitute the respiratory chain (RC), which uses energy released during electron transfer to pump protons from the matrix into the inter-membrane space (IMS). Complex I (CI) is a NADH oxidase, and

complex II (CII) is a succinate dehydrogenase. CII is also a TCA cycle enzyme that oxidizes succinate and uses FADH2 as the electron carrier. It is the only RC complex that does not pump protons and that does not contain mtDNA-encoded subunits. Both CI and CII

transfer electrons onward to the lipid-soluble electron carrier ubiquinone (coenzyme Q10, CoQ10, or Q (oxidized), QH2 (reduced)) inside the IMM. QH2 is oxidized by complex III (CIII), and electrons are transferred to cytochrome c (Cyt c), which is a water-soluble electron carrier in the IMS. Complex IV (CIV) catalyzes the ﬁ nal transfer of electrons to molecular oxygen to generate water. The combined action of the RC generates an electrochemical potential difference across the IMM. This is utilized by ATP synthase or complex V (CV) to catalyze the phosphorylation of ADP to ATP. 44 E. Ylikallio & A. Suomalainen

Table I. This table lists the common mitochondrial syndromes and the main organs that are affected in each case. The syndromes are grouped according to their typical molecular etiology. MELAS, MERRF, NARP, and LHON are caused by mtDNA point mutations. KSS, PS, and PEO are caused by single mtDNA deletions that are either sporadic or maternally inherited; ad/ar PEO, MDS, MNGIE, MIRAS, and AS are caused by defective mtDNA due to mutations in nuclear genes responsible for mtDNA maintenance. LS is typically caused by mutations in mitochondrial or nuclear genes encoding structural proteins or assembly factors of the OXPHOS complexes. The inheritance of LS may thus be maternal, autosomal, or X-linked. Adapted from reference (4). Abbreviated name Full name Typical molecular etiology Principal affected organs

MELAS Mitochondrial encephalopathy, Mutation in tRNA or protein- Skeletal muscle, brain, heart, lactic acidosis, stroke-like coding gene of mtDNA endocrine pancreas, ear, gut episodes MERRF Myoclonus epilepsy with Mutation in tRNA gene of Skeletal muscle, brain, heart ragged-red ﬁ bers mtDNA NARP Neuropathy, ataxia, and Mutation in protein-coding Brain, eye retinitis pigmentosa gene of mtDNA LHON Leber’ s hereditary optic mutation in protein-coding Eye, heart neuropathy gene of mtDNA KSS Kearns– Sayre syndrome Single mtDNA deletion Skeletal muscle, brain, heart, eye PS Pearson’ s syndrome Single mtDNA deletion Bone-marrow, exocrine pancreas, skeletal muscle, brain PEO Progressive external Single mtDNA deletion Skeletal muscle (especially ophthalmoplegia extra-ocular), heart ad/ar PEO Autosomal-dominant/ Multiple mtDNA deletions Skeletal muscle (especially recessive PEO extra-ocular), heart MDS mtDNA depletion syndrome mtDNA depletion Skeletal muscle, brain, liver, kidney; typically tissue-speciﬁ c MNGIE Mitochondrial mtDNA depletion, multiple Gut, skeletal muscle, brain, neurogastrointestinal mtDNA deletions and point peripheral nerve encephalopathy mutations MIRAS a Mitochondrial recessive ataxia mtDNA deletions and subtle Brain, peripheral nerve syndrome depletion AS Alpers syndrome mtDNA depletion Brain, liver LS Leigh syndrome Mutation in protein coding Brain, eye, skeletal muscle, gene of mtDNA or nDNA peripheral nerve For personal use only. a MIRAS is also known as SCA-E (spinocerebellar ataxia with epilepsy) or SANDO (sensory ataxic neuropathy, dysarthria, and ophthalmoparesis). ad ϭ autosomal-dominant; ar ϭ autosomal-recessive.

within the cells of an individual are identical. This random segregation of mtDNA species as the germ situation is known as homoplasmy . However, in mtDNA cells divide (9). Alternatively, the bottle-neck may be diseases, the patients are often heteroplasmic , mean- caused by replication of only a subset of mtDNAs in ing that they have two different mtDNA populations. primary oocytes that undergo folliculogenesis (10). Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 In general, disease severity correlates with the relative Because of the bottle-neck, heteroplasmy levels can shift proportion of mutated to intact mtDNA. A heteroplas- rapidly between generations. Therefore, members of mic person will only develop the disease if the mutant the same family may exhibit striking clinical variabil- load exceeds a certain threshold. The threshold may be ity. Evidence from mouse models of mtDNA disease different for different mutations and different tissues. suggests that severely defective mtDNA molecules The uniparental inheritance pattern of mtDNA can be selected against during germ cell or oocyte means that it is in theory possible that mutations development (11,12). This purifying selection may accumulate slowly over successive generations until, explain why moderately pathogenic mtDNA mutations eventually, a threshold mutant level is reached that that do not cause complete inhibition of OXPHOS and manifests as a disease (reviewed in (8)). Therefore, lead to late-onset disease are more common than a mechanism is required to prevent the transmission highly deleterious mtDNA mutations (11). of defective mtDNA to offspring. This protection has Mitochondrial DNA mutations are also known to been attributed to a genetic bottle-neck of mtDNA occur sporadically in somatic tissues. The mutations in developing primordial germ cells (reviewed in (8)), may undergo clonal expansion, eventually reaching the meaning that only a small subset of the mtDNAs of threshold level and causing mitochondrial dysfunc- the original oocyte populate the germ cells that will tion at a later age. Accumulating mtDNA mutations, become the next generation. The bottle-neck may result and subsequent progressive mitochondrial dysfunc- from a strong reduction of mtDNA copy number in tion, are thought to contribute to the normal aging primordial germ cells, followed by ampliﬁ cation and process (reviewed in (13)). Mitochondrial diseases 45

Defects of structural OXPHOS subunits and Complex I defi ciency assembly factors Isolated complex I defi ciency is among the most com- The OXPHOS complexes are made up of at least 89 mon forms of mitochondrial disease. Complex I, also structural protein subunits encoded by either mtDNA known as NADH dehydrogenase or NADH:quinone or nDNA. In addition, a number of nDNA-encoded reductase, is a ∼ 980 kDa structure composed of 45 assembly factors are needed for the intricate assem- subunits, of which 7 are encoded by mtDNA and 38 bly processes of the complexes. Defects in a number by nDNA (15). The complex is L-shaped, with a hydro- of structural and assembly proteins are known to phobic arm embedded in the IMM and a perpen- cause mitochondrial disease (reviewed in (14)). The dicular hydrophilic peripheral arm that protrudes diseases present with either isolated or combined com- into the matrix. The conserved structures of both plex defi ciencies, and their clinical manifestations are subunits from bacteria and yeast have been charac- diverse (Table II). terized recently (16– 19). CI has three functional

Table II. This table lists the disease-associated genes that encode either structural or assembly factors of the OXPHOS complexes. Note that structural proteins are encoded by either nDNA or mtDNA, whereas assembly factors, i.e. proteins needed to make the complex but that are not part of the ﬁ nal complex, are only encoded by nDNA. Genetic defect Genes Major clinical manifestations Reference

CI mtDNA-encoded ND1 ND2 ND3 ND4 LHON, MELAS, LS (98) structural gene ND4L ND5 ND6 nDNA-encoded NDUFS1 NDUFS2 LS, encephalopathy, (20,123,124) structural gene NDUFS3 NDUFS4 cardiomyopathy NDUFS6 NDUFS7 NDUFS8 NDUFV1 NDUFV2 NDUFA1 NDUFA2 NDUFA11 nDNA-encoded NDUFAF1 LS, cardioencephalomyopathy, assembly factor NDUFAF2 C6orf66 infantile lactic acidosis C20orf7ACAD9 C8ORF38 CII nDNA-encoded SDH-A SDH-B LS, paraganglioma, (123) For personal use only. structural gene SDH-C SDH-D pheochromocytoma nDNA-encoded SDHAF1 SDHAF2 Infantile leukoencephalopathy, (125,126) assembly factor paraganglioma CIII mtDNA-encoded CYTB LHON, encephalopathy, (31) structural gene cardiomyopathy, myopathy nDNA-encoded UQCRB UQCRQ Hypoglycemia, lactic acidosis (31,127) structural gene or psychomotor retardation with extrapyramidal signs nDNA-encoded BCS1L TTC19 Encephalopathy, liver failure, (31,128) Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 assembly factor tubulopathy, GRACILE syndrome, Björnstad syndrome CIV mtDNA-encoded COX1 COX2 COX3 Encephalopathy, myopathy, (37) structural gene sideroblastic anemia, myoglobinuria, MELAS nDNA-encoded COX6B1 COX4I2 Infantile encephalomyopathy, (37,129) structural gene or exocrine pancreatic insufﬁ ciency and anemia nDNA-encoded SURF1 SCO1 SCO2 LS, French-Canadian LS, (37,130) assembly factor COX10 COX15 encephalopathy, LRPPRC C2orf64 cardiomyopathy, myopathy, liver failure, tubulopathy CV mtDNA-encoded ATP6 ATP8 LS, NARP, cardiomyopathy (98,131) structural gene nDNA-encoded ATP5E 3-methylglutaconic aciduria, (48) structural gene lactic acidosis, mild mental retardation, peripheral neuropathy nDNA-encoded ATP12 TMEM70 Encephalopathy, (47,132) assembly factor lactic acidosis, cardioencephalomyopathy 46 E. Ylikallio & A. Suomalainen

modules: a dehydrogenase module that oxidizes NADH, assembly factors. Several such proteins exist, and disease- a hydrogenase module that reduces ubiquinone, and causing mutations have so far been found in the a proton-transferring module that pumps protons. genes encoding six of them (Table II). Further, in The latter module constitutes much of the membrane many cases where CI fails to assemble, the respon- arm and also contains all of the mtDNA-encoded sible gene defects have not been found. Therefore, it subunits. Electron transfer in the hydrophilic arm is expected that more assembly factor mutations will induces conformational changes that push an α -helix be found in the future. Also, more information will be that is positioned in a parallel orientation within the needed on the precise mechanisms of CI assembly. membrane arm, and whose movement tilts other heli- The tissue-selectivity of clinical manifestations in ces in the membrane arm to allow the passage of pro- CI defi ciency may depend on differences in the resid- tons from the matrix side to the inter-membrane space ual level of CI activity in different tissues. The cases of (IMS) (17,18). CI defi ciency that are caused by mtDNA mutations CI defi ciency is associated with various phenotypes exhibit greater variation in severity, which can be par- both in children and adults. Many patients have Leigh tially accounted for by the relative load of mutant syndrome (LS), which is characterized clinically by mtDNA (20). Finally, CI defi ciency may be impor- a severe symptom constellation including develop- tant in the pathogenesis of ataxia, having been found mental delay and failure to thrive, and radiologically in the mitochondrial ataxia syndromes (described or histologically by typical necrotic lesions in the under disorders of mtDNA maintenance), and a basal ganglia and brain-stem (reviewed in (4)). Others CI-defi cient mouse model (25). present with fatal infantile lactic acidosis, neonatal cardiomyopathy, leukoencephalopathy, myopathy, com- Complex II defi ciency bined tubulopathy and hepatopathy, or less well defi ned phenotypes (reviewed in (20)). Another classi- Succinate-coenzyme Q reductase, or CII, is different cal CI-related disorder is Leber ’ s hereditary optic from the other OXPHOS complexes since all of its neuropathy (LHON), which is an adult-onset disease four subunits, SDH-A , SDH-B , SDH-C , and SDH-D , affecting almost exclusively the optic nerve. The fi rst are encoded by nDNA. Furthermore, CII provides disease-causing mtDNA mutations were described in a physical link between OXPHOS and the citric acid LHON patients, in the gene encoding the ND4 sub- cycle, as it catalyzes the transfer of electrons from the unit of CI (21). Children with CI-related disease tend citric acid cycle intermediate succinate to the OXPHOS

For personal use only. to have normal prenatal development, which may electron carrier ubiquinone. Homozygous or com- refl ect a relatively low demand for mitochondrial func- pound heterozygous mutations in the SDH-A gene tion during embryonic life, and up-regulation of cause LS (26). Mutations in the other three genes OXPHOS following birth (reviewed in (20)). predispose to tumors, specifi cally paragangliomas of Pathogenic mutations have been reported in all the carotid bodies and pheochromocytomas (27– 29). of the mtDNA-encoded CI subunits and a number Tumor predisposition is inherited in an autosomal- of nDNA-encoded subunits (Table II). Some genetic dominant manner. The mechanisms by which citric defects interfere with the insertion of the polypeptide acid cycle or OXPHOS defects lead to tumor forma- Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 into the complex, while others allow complex assem- tion are not known. One possibility is that changes bly but impair the enzymatic activity of the fi nal com- in the cell ’ s metabolic state are sensed as hypoxia, plex (22). In the former, complex assembly intermediates leading to the activation of growth-promoting accumulate depending on which stage of the assem- transcriptional pathways (reviewed in (30)). bly process the defective subunit is normally inserted in (23). Complex III defi ciency Two different models of human CI assembly have been suggested. In the fi rst model, the membrane arm Isolated CIII defects are among the least common and peripheral arms are fi rst assembled individually respiratory chain (RC) disorders (reviewed in (31)). and then attached to each other. This is reminiscent The full name of complex III is coenzyme Q:cytochrome of the well studied CI assembly process in the fungus c oxidoreductase. It consists of 11 subunits, of which Neurospora crassa (23). In the second model, the sub- only cytochrome b is encoded by mtDNA. Electron units from both arms form subcomplexes that come transfer from QH 2 to cytochrome c is achieved by a together already before the process is fully fi nished. stepwise process known as the Q cycle (reviewed in The second model is supported by the accumulated (32)). The Q cycle involves a partially oxidized semi- assembly intermediates that have been described in quinone intermediate that is prone to auto-oxidation, patients (14,22,24). Proteins that are needed for i.e. transfer of one electron to oxygen to make super- the assembly of CI, but that are not themselves com- oxide. Therefore, CIII is a major source of reactive ponents of the fi nal structure, are referred to as CI oxygen species (ROS), which can damage many Mitochondrial diseases 47

cellular macromolecules. Increased ROS may thus such as myopathy or MELAS (mitochondrial enceph- be an important feature in diseases caused by CIII alopathy with lactic acidosis and stroke-like episodes), defi ciency (reviewed in (31)). respectively. The mutations have been found to alter Almost all of the known CIII subunit mutations the assembly or stability of the complex. The regula- are in the gene encoding cytochrome b . Most of the tion of COX activity is complex, involving tissue-specifi c pathogenic amino acid changes are located outside of isozymes, phosphorylation, and allosteric regulation. the transmembrane domains of the protein, and they Therefore, tissue variability of regulatory factors is affect the catalytic activity and/or assembly of CIII a potential explanation for the observed clinical (reviewed in (31)). The clinical consequences of defec- diversity (reviewed in (37)). tive cytochrome b are diverse: predominant symptoms The assembly of CIV is a stepwise process that may arise in optic nerve, heart, brain, or muscle. Some is estimated to require more than 20 nuclear-encoded cytochrome b amino acid changes lead to CI defi - factors that are not part of the fi nal holoenzyme ciency, which supports the notion that CI and CIII (reviewed in (14)). Defects in a number of these fac- function as a supercomplex and that supercomplex tors are associated with variable diseases including formation is dependent on intact cytochrome b (33). LS or Leigh-like diseases, cardiomyopathy, and liver Furthermore, supercomplex stabilization appears failure (Table II). Two disease-associated assembly to depend on cardiolipin, which is a phospholipid factors, COX10 and COX15, are needed for the syn- that is unique to the IMM. Deficiency of cardio- thesis of the heme a component of CIV, and their lipin causes Barth syndrome (cardioskeletal myopa- defects caused loss of CIV holoenzyme (38,39). Another thy, neutropenia, and 3-methylglutaconic aciduria), example of an essential CIV assembly factor is the probably through destabilization of respiratory 30 kDa Surf1 protein (40). The function of this protein supercomplexes (34). is not completely understood, but it may be involved Disease-causing mutations have been identifi ed in the insertion of heme a into COX1 (41). in two nDNA genes encoding structural CIII subunits A new mechanism of CIV defi ciency was found and in the BCS1L gene, which encodes an essential in a patient with slowly progressive LS, who had a CIII assembly factor (Table II). At least 20 BCS1L mutation in a gene encoding a protein of previously mutations have been reported, and they underlie a unknown function. This protein, named TACO1, remarkably wide range of phenotypes ranging from was found to be needed for the activation of transla- the GRACILE syndrome (growth retardation, amino tion of COX1 (42). TACO1 was suggested to be a

For personal use only. aciduria, cholestasis, iron overload, lactic acidosis, member of a group of translational activators needed and early death) (35) to the Bjö rnstad syndrome that for the activation of mitochondrial mRNAs, which includes sensorineural hearing loss and hair changes in contrast to cytoplasmic mRNAs lack 5 ’ untrans- known as pili torti (36). The function of the BCS1L lated regions. Furthermore, CIV defi ciency and gene product is to insert the Rieske iron-sulfur pro- mitochondrial encephalomyopathy was found in tein during the late stages of complex assembly (31). patients with mutations in the gene FASTKD2 , which Accordingly, BCS1L gene mutations have been found encoded a mitochondrial protein potentially involved to cause the accumulation of an almost fully assem- in apoptosis (43). However, the exact mechanism of Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 bled CIII that is severely lacking in enzymatic activity. CIV defi ciency had not been fully elucidated in the Mutations causing more severe phenotypes have been setting of FASTKD2 mutation. found to induce greater ROS production, which may account for variable disease severity and organ Complex V defi ciency involvement (36). Mitochondrial complex V (CV) couples proton current to the phosphorylation of ADP. Known also as Complex IV defi ciency ATP synthase, the complex has a membrane part F0 Complex IV, or cytochrome c oxidase (COX), has 13 and a peripheral part F1 . Two F0 subunits, ATP6 and subunits, of which the 3 large core subunits (COX1, ATP8, are mtDNA-encoded, whereas all of the F1 COX2, and COX3) that are responsible for electron subunits are nuclear-encoded. Mutations in the ATP6 transfer are mtDNA-encoded. The 10 nDNA-encoded gene of mtDNA are well known to cause disease. The subunits are not directly involved in catalysis but are T8993G and T8993C mutations in this gene cause apparently needed for stability and regulation of the disease depending on mutant load: a low load is complex (reviewed in (14)). asymptomatic, an intermediate load causes NARP Similar to the other RC complexes, COX-defi ciency (neurogenic weakness, ataxia, retinitis pigmentosa) is responsible for a diverse number of clinical pre- (44), and a high load causes maternally inherited LS, sentations. Mutations in the COX1-3 genes of mtDNA potentially through impaired CV assembly (reviewed cause single-organ or multi-organ manifestations, in (45)). 48 E. Ylikallio & A. Suomalainen

Like the other OXPHOS complexes, CV has asse- both in the cytosol and mitochondria (reviewed in mbly factors encoded by nuclear genes. Atp12 and (53)). Interestingly, defects in one mtDNA mainte- the related Atp11 have been characterized as essen- nance protein can cause several different types of syn-

tial factors required for the formation of the F1 com- dromes. Thus, the clinical picture is not always a good ponent of CV in both yeast and humans (46). Mutations guide to fi nding the responsible gene. in the ATP12 gene were found in a child with early- onset encephalopathy and lactic acidosis, and the The mtDNA replisome in disease amount of assembled CV was strongly decreased (47). Furthermore, a number of other patients with A large number of disease-causing mutations have apparent defects in CV assembly, but no mutations been found in the POLG1 gene, which encodes the in the known disease genes, have been described. A catalytic subunit of Pol γ (Pol γ A) (reviewed in (54)). mutation in a nDNA-encoded structural gene has The spectrum of Pol γ -related clinical manifestations is also been identifi ed recently (Table II) (48). The nuclear likewise large. The three main Pol γ -related phenotypes gene defects leading to CV defi ciency generally lead are: infant- or childhood-onset hepatocerebral MDS to different phenotypes than NARP or LS (reviewed (known as Alpers syndrome), ataxia-neuropathy disor- in (45)). ders such as MIRAS (mitochondrial recessive ataxia syndrome) that has a median age of onset of 28 years (range 5– 41), and PEO with multiple mtDNA dele- Disorders of mtDNA maintenance tions, which can be either dominant or recessive and Defects in the nuclear-encoded proteins responsible which rarely presents before 20 years of age (49,55,56). for mtDNA maintenance lead to decreased mtDNA In addition, Pol γ defects have been associated with a copy number, mtDNA point mutations, multiple number of other phenotypes including Parkinsonism mtDNA deletions, or combinations thereof. The dis- and premature menopause (50). orders of mtDNA maintenance form a diverse group The positions of POLG1 mutations show correla- that ranges from severe infant-onset multi-system tion with the clinical outcome. Pol γ A has a C-terminal disease, where mtDNA copy number is severely polymerase domain and an N-terminal proof-reading depleted in one or more tissues (mtDNA depletion exonuclease domain, separated by a spacer region syndrome, MDS), to mild adult-onset autosomal- involved in DNA binding and interaction with the dominant (ad) or autosomal-recessive (ar) progres- accessory subunit Pol γ B. The latter is encoded by

For personal use only. sive external ophthalmoplegia (PEO). The genetic the gene POLG2 , and it confers increased DNA bind- causes are heterogeneous (reviewed in (49)). In ing, processivity, and polymerization rate to the holoen- PEO, mtDNA deletions gradually accumulate in zyme (reviewed in (52)). In general, polymerase domain patients’ tissues, but mtDNA copy number usually mutations tend to cause dominant disease, as the remains normal. The disease affects particularly DNA binding is not impaired and the mutant can external eye muscles, but more generalized myopa- compete with the wild-type protein. Recessive muta- thy with exercise intolerance is often observed, as tions cluster in the spacer and exonuclease regions, well as additional symptoms that include cardiomy- often causing reductions in DNA binding ability and Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 opathy, mild ataxia, Parkinsonism and depression accessory subunit interaction (54). (4,49,50). Furthermore, we recently found that a The Pol γ crystal structure was particularly per- very high mtDNA copy number was associated with tinent to the understanding of the spacer regions muta- a number of detrimental effects on mtDNA mainte- tions, since this region does not share homology with nance and expression in transgenic mice (51). These the related DNA polymerase of the T7 phage in the results suggested that mitochondrial disease could manner the polymerase domain does (57). One of also be caused by an abnormally high mtDNA the most common Pol γ amino acid changes, A467T, copy number. However, this possibility remains affects a residue that is located in the thumb domain unexplored in humans. of Pol γ A. This domain was found to be involved in Most mtDNA maintenance diseases are caused by both template binding and the interaction with Pol mutations in genes encoding proteins with well deﬁ ned γ B. Thus, the position of the mutated residue in the roles in mtDNA replication or mitochondrial deoxy- enzyme’ s tertiary structure explained the results from nucleoside triphosphate (dNTP) pool maintenance earlier biochemical experiments that the mutation (Table III). Two proteins that are intimately involved impairs both polymerase activity and processivity in mtDNA replication have particularly strong asso- (57). Mutation in the POLG2 gene has been associ- ciations with human disease: the mtDNA polymerase ated with PEO in two patients so far (58,59). POLG2 γ (Pol γ ), and the replicative helicase Twinkle (reviewed defects may be a rare cause of PEO, but more patients in (52)). Mitochondrial dNTP pools are regulated by need to be found before the position of POLG2 as a a complex system of interlinked pathways localized disease gene is ﬁ rmly established. Mitochondrial diseases 49

Table III. The genes listed in this table encode proteins that are essential for mtDNA maintenance. Mutations in these genes cause mtDNA disease through different mechanisms, as indicated. Gene product and its Gene function Molecular consequence Clinical consequence Ref

mtDNA replication: POLG Pol γ A, the catalytic Multiple mtDNA deletions ad/arPEO (56) subunit of the mtDNA mtDNA depletion Alpers-type MDS or (55) polymerase MIRAS POLG2 Pol γ B, the accessory Multiple mtDNA deletions ad PEO (58) subunit of the mtDNA polymerase C10Orf2 Twinkle, the replicative Multiple mtDNA deletions adPEO (60) mtDNA helicase mtDNA depletion Hepatocerebral MDS or (61) IOSCA dNTP pool maintenance: DGUOK dGK, intramitochondrial mtDNA depletion Hepatocerebral MDS (71) salvage of purine nucleosides TK2 TK2, intramitochondrial mtDNA depletion Myopathic MDS (72) salvage of pyrimidine nucleosides TYMP TP, cytoplasmic breakdown mtDNA depletion, deletions, MNGIE (76) of thymidine nucleosides and point mutations RRM2B p53R2, constitutively mtDNA depletion or Multi-system MDS or (73,74) expressed small subunit of mtDNA deletions adPEO ribonucleotide reductase SLC25A4 ANT1, adenine nucleotide Multiple mtDNA deletions adPEO (133) translocator in the IMM SUCLG1 Subunits of succinyl CoA mtDNA depletion and Encephalomyopathy (134,135) SUCLA2 synthetase, citric acid cycle succinyl-CoA and nucleoside salvage accumulation Other or unknown: OPA1 Protein required for IMM Multiple mtDNA deletions adPEO (136) fusion For personal use only. MPV17 IMM protein of unknown mtDNA depletion Hepatic MDS (137) function

ad ϭ autosomal-dominant; ar ϭ autosomal-recessive; PEO ϭ progressive external ophthalmoplegia; MDS ϭ mtDNA depletion syndrome; MIRAS ϭ mitochondrial recessive ataxia syndrome; IOSCA ϭ infantile-onset spinocerebellar ataxia; MNGIE ϭ mitochondrial neurogastrointestinal encephalopathy; IMM ϭ inner mitochondrial membrane.

Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 Twinkle is the mitochondrial replicative helicase. The mechanisms by which Pol γ and Twinkle It was found based on its similarity to the T7 phage mutations cause mtDNA deletions and instability helicase primase gp4, and was found to be defective have been studied in various systems, including cul- in several families with adPEO and multiple mtDNA tured cells, in-vitro biochemical assays, and a trans- deletions in skeletal muscle (60). Recessive Twinkle genic mouse model (reviewed in (52)). The Twinkle mutations cause either hepatocerebral MDS that is holoenzyme is a homohexamer, and most of the dom- reminiscent of Alpers syndrome (61,62), or a syndrome inant mutations impair subunit interaction (52). PEO of intermediate severity termed infantile-onset spi- mutations are dominant because the presence of just nocerebellar ataxia (IOSCA) (63). IOSCA is part of one defective subunit can impair the assembly and the Finnish disease heritage. It manifests between loading of the entire holoenzyme. Transgenic expres- ages 1 and 2 years and is slowly progressive with ataxia, sion of Twinkle with a linker region duplication of neuropathy, ophthalmoplegia, and seizures. Brains amino acids 353 – 364, which was originally described from IOSCA patients showed mtDNA depletion but in a Finnish adPEO family (60), caused progressive no deletions or point mutations (63). Mitochondrial mtDNA deletion accumulation in skeletal muscle DNA depletion in IOSCA may be more pronounced and brain, similar to the patients (64). These so-called in particular neuronal populations, for instance cer- Deletor mice provided an ideal tool for studying the ebellar Purkinje cells, which could account for the in-vivo pathogenic mechanisms of the dominant restricted clinical findings and longer life-span Twinkle defect. Expression of PEO-related mutants compared to other forms of MDS (63). of both Twinkle and Pol γ in human cultured cells 50 E. Ylikallio & A. Suomalainen

induced signifi cant stalling of the mtDNA replisome salvage for mtDNA maintenance. For some time it (65,66). Replication stalling was also observed in the was thought that post-mitotic cells almost completely tissues of Deletor mice (65). Stalling could lead to lack RNR, and that mtDNA replication in non- double-strand DNA breaks, which in turn are known cycling cells relies solely on dNTPs derived from the to induce deletion formation through double-strand salvage pathway. However, this view changed when break repair pathways (67). Importantly, replication it was found that RNR is in fact also essential for stalling in Deletor mice was evident already at 6 weeks mtDNA maintenance in post-mitotic tissues. Inacti- of age, whereas deletions were detectable starting at vating mutations in the RRM2B gene, encoding the ∼ 12 months age (64,65). This suggested that the under- p53-inducible small subunit of RNR (p53R2), caused lying replication defect in PEO is present throughout multi-system, recessively inherited MDS (73). Fur- life and that deletions accumulate from initially very thermore, we recently found that a heterozygous muta- small levels, until they eventually reach the threshold tion of RRM2B , that leads to truncation of the p53R2 that causes disease. Deletion accumulation is enhanced protein, causes adPEO with multiple mtDNA deletions by clonal expansion of deleted molecules within indi- (74). Therefore, both salvage and de-novo production vidual muscle cells (68). Clonal expansion may be of dNTPs is necessary for mtDNA replication. enhanced by the deleted molecules having a replica- The patients with homozygous or compound hete- tive advantage due to their shorter length compared ro zygous defects in the anabolic enzymes of deoxy- to wild-type mtDNA (69). nucleotide synthesis, TK2, dGK, or p53R2, are usually normal at birth, but the MDS manifests abruptly in specifi c tissues during the fi rst months or years of life. Mitochondrial dNTP pool maintenance and disease Reasons for the time of onset and tissue selectivity The four dNTPs, deoxyadenosine-, deoxyguanosine-, of these diseases are unknown. A recent study on a deoxycytidine-, and thymidine triphosphate (dATP, mouse model of TK2 defi ciency suggested that disease dGTP, dCTP, and dTTP, respectively), are the build- onset coincides with down-regulation of the cyto- ing blocks of DNA. A suffi ciently large dNTP pool plasmic salvage enzyme TK1 (75). This TK1 down- is required for replication and repair of both nDNA regulation essentially unmasked a latentTK2 defi ciency. and mtDNA. The relative proportions of the four The same study also suggested that increased tran- dNTPs also need to be balanced in order to avoid scription of mtDNA could partially compensate for mutagenesis (reviewed in (70)). Nuclear DNA rep- mtDNA depletion in skeletal muscle (75). Therefore,

For personal use only. licates only in S-phase of the cell cycle, during which it is conceivable that tissue-specifi cities of MDS may dNTP synthesis is heavily up-regulated. Mitochon- be determined by different capacities to compensate drial DNA replicates independently of the cell cycle for the various genetic defects. in replicative cells and continues to be replicated in The importance of proper dNTP pool balance post-mitotic cells, for instance in neurons and skeletal is illustrated by the disease MNGIE (mitochondrial muscle cells. Therefore, dNTP synthesis is required neurogastrointestinal encephalomyopathy). This also in non-proliferative cells. There are two main disease is caused by deficiency of the catabolic pathways to supply dNTPs: in the de-novo pathway enzyme thymidine phosphorylase (TP) that degrades Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 ribonucleotides, derived from the purine and pyrim- thymidine (76). TP defi ciency leads to thymidine idine biosynthetic pathways, are converted into the excess and probably to elevations of the mitochon- corresponding deoxyribonucleotides by the cytoplas- drial dTTP pool in relation to the other dNTPs. mic enzyme ribonucleotide reductase (RNR); in the This dNTP imbalance causes mtDNA deletions salvage pathway, deoxynucleosides undergo sequen- and point mutations in addition to mtDNA deple- tial phosphorylations into deoxynucleoside mono- and tion (reviewed in (77)). Furthermore, we recently diphosphates, which are fi nally phosphorylated into studied a mouse model over-expressing more than dNTPs (reviewed in (53)). one RNR subunit. The RNR over-expression caused The de-novo pathway for deoxynucleotide synthe- dNTP pool imbalance and led to mtDNA depletion sis is located in the cytoplasm, but mitochondria con- in skeletal muscle, but it did not cause mtDNA dele- tain their own salvage pathway. Two mitochondrial tions or point mutations (78). Therefore, it is clear kinases, thymidine kinase 2 (TK2) and deoxyguanos- that mtDNA replication is sensitive to the dNTP ine kinase (dGK), are able to phosphorylate all four pool balance. However, the exact mechanisms by deoxynucleosides and thus form the basis of the mito- which dNTP pool imbalances cause mtDNA insta- chondrial deoxynucleoside salvage pathway. Muta- bility remain incompletely understood. It is also tions in the genes encoding TK2 or dGK in humans unknown why certain changes to the enzymatic were found to cause recessively inherited, muscle- pathways regulating dNTP pools lead to mtDNA specifi c or hepatocerebral MDS, respectively (71,72). depletion only, while other changes cause point This proved the importance of deoxynucleoside mutations or deletions. Mitochondrial diseases 51

Disorders of mitochondrial protein synthesis Mutations in the PUS1 gene were found in patients with the disease MLASA (mitochondrial Mitochondrial translation is more reminiscent of myopathy, lactic acidosis, and sideroblastic anemia), prokaryotic translation than eukaryotic cytoplasmic which affects bone-marrow, skeletal muscle, and the translation. However, several signifi cant differences central nervous system but shows clinical variability exist, and the mitochondrial translation machinery (82). PUS1 encodes pseudouridine synthase 1 (Pus1), is incompletely characterized to date (reviewed in which is not directly involved in translation but is (79)). Mitochondria use a genetic code that is slightly required for the post-translational modifi cation of different from the universal genetic code of other sys- tRNAs both in the cytoplasm and in mitochondria tems. Furthermore, the mitochondrial mRNAs also (79). It was suggested that modifi cation of the expres- lack 5’ -end untranslated regions and ‘ cap ’ structures, sion level of ribosomal proteins could compensate and the same tRNA-Met is used in both translation for the phenotype and account for the variability in initiation and elongation. In addition to the 22 tRNAs phenotypes between tissues and between individuals and 2 rRNAs that are encoded by mtDNA, mito- (83). In addition, Pus1 could have several non-tRNA chondrial translation requires a wealth of nDNA- substrates (83). encoded proteins. Translation initiation requires the Defects in another enzyme involved in tRNA mod- initiation factors mtIF2 and mtIF3, whereas elonga- ifi cation, tRNA 5-methylaminomethyl-thiouridylate tion of the polypeptide is dependent on the elongation (Trmu), are also associated with mitochondrial dis- factors mtEFTu, mtEFTs, mtEFG1, and mtEFG2 ease. Trmu modifi es wobble base positions of three (reviewed in (80)). The release factors mtRF1 and mitochondrial tRNAs: tRNA-Lys, tRNA-Gln, and mtRF1a are needed to terminate translation at stop tRNA-Glu. Several mutations in the TRMU gene codons. The mitochondrial ribosomes have particularly caused acute liver failure and were found to render high protein content, with up to 81 mitochondrial the tRNAs hypomodifi ed, leading to defective mitoribosomal proteins (MRPs). Finally, aminoacylation chondrial protein synthesis (84). One TRMU muta- of mitochondrial tRNAs is performed by mitochon- tion was not associated with liver failure but caused drial aminoacyl-tRNA synthetases, of which 19 have aggravation of the deafness phenotype associated been described (reviewed in (81)). with mitochondrial 12S rRNA mutations (85). Mutations in the mitoribosomal proteins MRPS16 Defects in nuclear-encoded mitochondrial and MRPS22 impair assembly and stability of the small translation factors ribosomal subunit (86,87). Clinically, the MRPS16

For personal use only. Disease-causing mutations have been identifi ed in defect led to agenesis of the corpus callosum, dysmor- several of the nDNA-encoded mitochondrial transla- phism, and fatal neonatal lactic acidosis (86). The tion factors (Table IV). In general, the associated MRPS22 defect led to antenatal skin edema, hypotonia, phenotypes are severe, affecting the synthesis of all cardiomyopathy, and tubulopathy (87). fi ve OXPHOS complexes, and causing early death. Disease-causing mutations have been identifi ed However, the organ manifestations are diverse, even in genes encoding translational elongation factors among patients who carry the same mutation. Under- but not in those encoding initiation factors. The syn- standing the molecular basis of the tissue specifi city dromes associated with elongation factor mutations

Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 is challenging, given that all factors are involved in the exhibit remarkable tissue selectivity. All of these muta- same molecular machinery. tions are associated with defective translation of most

Table IV. Nuclear-encoded mitochondrial translation factors involved in disease. Function Gene/protein Affected tissue Reference

tRNA modiﬁ cation PUS1 Skeletal muscle, bone-marrow (82) TRMU Liver, ear (84,85) Elongation factor GFM1/mtEFG1 Brain, liver (88) TUFM/mtEFTu Brain (89) TSFM/mtEFTs Heart or skeletal muscle and brain (91) Ribosomal protein MRPS16 Brain (86) MRPS22 Heart, kidney (87) Aminoacyl-tRNA synthetase RARS2 Brain (92) DARS2 Brain (93) YARS2 Skeletal muscle, bone-marrow (94) SASR2 Kidney, pulmonary circulation (95) HARS2 Ovary, ear (97) AARS2 Heart (96) Peptide release factor C12orf65 Skeletal muscle, brain (138) 52 E. Ylikallio & A. Suomalainen

mitochondrial transcripts, but bicistronic transcripts similar to that caused by PUS1 mutation, a common (e.g. the one encoding the ATP6 and ATP8 genes) mechanism was invoked. The dysfunctional Pus1 can be translated at normal or elevated levels. The may cause disease through hypomodifi cation of tRNA- mtEFG1 defi ciency caused a severe hepato(encephalo) Tyr, leading to decreased amino acid charging rem- pathy, but the heart was spared despite a high nor- iniscent of the situation in YARS2 defi ciency (94). mal expression level of the affected protein in this However, it remains unclear why the brain is not tissue (88– 90). Mutation of mtEFTu in turn was affected. Three further mitochondrial aminoacyl-tRNA associated with a rapidly progressive encephalopathy synthetases, encoded by SARS2 , HARS2 , and AARS2 , (89). However, a single homozygous mutation in have been associated with disease very recently (95– mtEFTs caused hypertrophic cardiomyopathy in one 97). The involved organs appear to be strikingly diverse patient and encephalomyopathy in another (91). and specifi c for each gene (Table IV). The relatively benign phenotype in some tissues is apparently related to more favorable relative expres- Mitochondrial tRNA and rRNA mutations and sion levels of the translation factors, as well as adap- single mtDNA deletions tive changes in these ratios. For instance, the heart of patients with mtEFG1 mutation had an up-regula- Most human mtDNA point mutations occur in tRNA tion of the mtEFTu:mtEFTs ratio, whereas the genes (www.mitomap.org). The clinical manifesta- reverse was true for the liver (90). In addition, there tions of tRNA mutations are manifold. Two of the may be other genetic modifi ers that are responsible best studied mitochondrial tRNA mutations are the for tailoring mitochondrial translation to tissue- A3243G mutation in tRNA-Leu(UUR) and the specifi c needs. The mtEFTs mutant could be com- A8344G mutation in tRNA-Lys. The former has a pensated for by over-expression of mtEFTu, probably population prevalence of as high as 5.7 per 100,000 because the mutation interferes with the formation of and causes a wide range of phenotypes of which the complex between these two proteins and renders MELAS is prominent, and the latter is associated both proteins unstable. Bringing in additional with MERRF (myoclonic epilepsy with ragged-red mtEFTu thus helps stabilize the complex (91). It is fi bers) (reviewed in (98)). Mutations in other tRNA possible that this type of compensatory mechanism genes can lead to distinct phenotypes, e.g. deafness accounted for the difference between the two due to mutations in tRNA-Ser(UCN) or cardiomyo- mtEFTs patients. pathy due to mutations in tRNA-Ile (reviewed in

For personal use only. Mutations in two of the aminoacyl-tRNA syn- (99,100)). A number of explanations have been put thetases affected the brain. RARS2 (encoding mito- forth to explain the clinical heterogeneity of tRNA chondrial arginyl-tRNA synthase) mutations caused mutations, including variations in heteroplasmy or pontocerebellar hypoplasia (92), whereas the DARS2 mtDNA segregation, different OXPHOS complexes (encoding mitochondrial aspartyl-tRNA synthetase) being differently affected depending on their amino mutations led to LSBL (leukoencephalopathy with acid composition, tissue-specifi c toxicities of prema- brain-stem and spinal cord involvement and lactate turely terminated translation products, or other tissue- elevation) (93). The mutations were in introns and specifi c modifi ers that affect mitochondrial protein Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 affected splice sites. Higher expression of splicing fac- synthesis or function (100). tors in extracerebral tissues was suggested as a rea- Mutations in the mitochondrial rRNA genes are son for brain specifi city of the phenotypes in RARS2 associated with non-syndromic sensorineural deaf- and DARS2 mutations (92). The RARS2 mutation ness or aminoglycoside-induced deafness. The most caused a decrease in the total abundance of mito- common mutation is A1555G in the 12S rRNA gene chondrial tRNA-Arg, probably because the unloaded (101). The mutation alters the structure of the rRNA tRNA is unstable (92). However, the DARS2 muta- such that it more closely resembles the bacterial 16S tion did not lead to a translation defi cit or OXPHOS rRNA. This facilitates interaction with aminoglyco- dysfunction in patient fi broblasts, even though the sides, leading to translation defect. Not all people aminoacylation activity was strongly reduced (93). who carry this mutation develop deafness. In addition The mechanism by which mutation in this gene causes to aminoglycoside exposure, the penetrance depends disease is therefore unclear. It is possible that only a on mtDNA haplotype and nuclear modifi er genes (79). subset of neurons is affected, meaning that studies on This is a good example of how a mitochondrial disease whole-brain lysates or cultured fi broblasts are not is modifi ed by genetic and environmental factors. informative (93). The mtDNA deletion syndromes are caused by A mutation in YARS2 , which encodes the mito- large-scale (usually several thousand base pairs) dele- chondrial tyrosyl-tRNA, synthetase was found to cause tions of mtDNA, which are usually sporadic (102). MLASA with no apparent effects on brain structure In these disorders, the patient tissues typically harbor or function (94). Since the phenotype was highly a single partially deleted species together with the Mitochondrial diseases 53

wild-type mtDNA. These diseases are denoted single OPA1 mutations cause autosomal-dominant optic mtDNA deletion diseases to distinguish them from the atrophy (106,107). In most cases, this disease speciﬁ - multiple deletion diseases, in which deletions of differ- cally involves degeneration of retinal ganglion cells. ent sizes are present and which are caused by defects However, more diverse OPA1 -related phenotypes have in mtDNA maintenance. Deletions usually involve sev- been described recently, and they include disorders eral genes including at least one tRNA, meaning that of mtDNA maintenance (Table III) (103). mitochondrial protein synthesis as a whole will be affected. Clinically, the mtDNA deletion syndromes Disorders where OXPHOS is form a spectrum that ranges from relatively benign indirectly affected adult-onset disorders such as PEO to severe infantile- In most of the disorders described so far, mitochondrial onset disorders such as Pearson’ s syndrome (Table I). dysfunction arises as a direct consequence of a defect in genes involved in OXPHOS or in the synthesis of Disorders of mitochondrial dynamics OXPHOS subunits. However, mitochondrial dysfunction Mitochondrial fusion and ﬁ ssion, collectively mito- can arise also through indirect mechanisms.

chondrial dynamics, are essential for mitochondrial Ubiquinone or coenzyme Q (CoQ10 ) shuttles distribution and function. Mitochondria form an inter- electrons from CI and CII to CIII. It consists of a connected network that is constantly reorganized benzoquinone ring and a tail of typically 10 isoprenyl (reviewed in (5)). Defective fusion or ﬁ ssion underlies subunits that anchors it to membranes (reviewed in

a number of neurological diseases in humans. Mito- (108)). Reduced ubiquinone (QH2 ) also functions chondrial fusion requires three proteins: Mitofusins as an antioxidant. Disorders of CoQ10 biosynthesis 1 and 2 (Mfn1 and Mfn2) are needed for outer mem- form a group of rare autosomal-recessive disorders. brane fusion, and Opa1 has been suggested to be Clinical manifestations are reminiscent of other involved in inner membrane fusion (reviewed in (103)). mitochondrial disorders and are divided into ﬁ ve Mutations in the MFN2 gene cause the autosomal- groups: encephalomyopathy, severe infantile multi- dominant Charcot– Marie – Tooth disease type 2A, which systemic disease, cerebellar ataxia, isolated myopa- is a peripheral neuropathy caused by degeneration thy, and nephritic syndrome (Table V) (108). Correct of axons in long sensory and motor nerves of the dis- diagnosis of these patients is essential, as ubiquinone tal extremities (104). The selective manifestation of Q10 supplementation may improve the condition of Mfn2 mutations in neurons has been attributed to a some patients dramatically. For personal use only. low relative level of Mfn1 expression. Mfn1 is able to The import of nuclear-encoded proteins into complement Mfn2 functionally (105), and tissues with mitochondria requires specialized multi-subunit high endogenous Mfn1 expression may thus be resis- machineries in the IMM, IMS, and OMM. Defects tant to Mfn2 defects. In addition, peripheral neurons in the protein translocation machinery have been may be particularly susceptible to aberrant mitochon- found to cause disease by impairing the importation drial dynamics due to the extreme length of their axons of proteins needed for OXPHOS. The consequence of (reviewed in (103)). mutation in the deafness/dystonia protein 1/translocase Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14

Table V. Disease-associated genes invloved in the biosynthesis of coenzyme Q (CoQ10). Derived from reference (108). Gene Protein function/disease mechanism Phenotype

ADCK3/CABC1 Encodes a putative mitochondrial kinase involved Encephalomyopathy, juvenile-onset

in the regulation of CoQ10 biosynthesis cerebellar ataxia APTX Encodes aprataxin, which is involved in DNA Ataxia-oculomotor apraxia 1

repair. Secondary CoQ10 deﬁ ciency COQ2 Encodes para-hydroxybenzoate-polyprenyl Infantile-onset multi-system syndrome

transferase, direct role in CoQ10 synthesis or renal disease PDSS2 Polyprenyl diphosphate synthase, direct role in Nephrotic syndrome and LS

CoQ10 biosynthesis PDSS1 Polyprenyl diphosphate synthase, direct role in Infantile-onset multi-system syndrome

CoQ10 biosynthesis COQ9 Direct role in CoQ10 biosynthesis Infantile-onset multi-system syndrome ETFDH Encodes electron-transferring-ﬂ avoprotein Myopathy dehydrogenase. Also associated with glutaric

aciduria type II in which CoQ10 levels in muscle are normal BRAF Involved in mitogen-activated protein kinase Cardiofaciocutaneous syndrome

pathway, CoQ10 deﬁ ciency by indirect mechanism 54 E. Ylikallio & A. Suomalainen

of mitochondrial inner membrane 8a (DDP1/ aberrant calcium handling, and ROS production TIMM8a) is Mohr– Tranebjaerg syndrome/deafness- (reviewed in (116)). dystonia syndrome, which is an X-linked disorder Mitochondria produce ROS as a side product of characterized by progressive sensorineural deafness, normal respiration. The production of ROS can be cortical blindness, dystonia, dysphagia, and paranoia considerably increased in malfunctioning mitochon- (109,110). Certain cysteine-rich proteins are dria, and the effect of ROS is believed to be toxic, since imported into the IMS with the aid of a disulfi de they can irreversibly modify many cellular macromol- relay system, which catalyzes the oxidative folding of ecules. There are various ROS detoxifying enzymes these proteins. The disulfi de relay system donates to mitigate these effects. Moreover, a limited produc- electrons to oxygen via cytochrome c and CIV, thus tion of ROS also may play an important signaling role, connecting it to the RC. Accordingly, mutation in by acting as a retrograde signal that infl uences gene the gene GFER , which encodes one of two key com- expression in the nucleus in response to alterations ponents of the disulfi de relay system, was found to of mitochondrial membrane potential or redox state cause dysfunction of multiple RC complexes and a (reviewed in (117)). progressive mitochondrial myopathy (111). One consequence of OXPHOS dysfunction is that Another cause of OXPHOS defect was found in NADH produced by the citric acid cycle cannot be the dysfunction of the protein paraplegin in patients fed forward, leading to elevation of the NADH:NAD ϩ with hereditary spastic paraplegia (112). Paraplegin ratio. The level of pyruvate, produced through glyco- is a subunit of a ubiquitous mitochondrial protease lysis, is increased due to an inhibition of the citric acid that has a quality control role, suggesting that the cycle. Thus, the equilibrium of the NADH-dependent patients have problems with mitochondrial protein turn- lactate dehydrogenase is shifted towards the produc- over (113). Recently, mutation in the X-chromosomal tion of lactate from pyruvate. Lactate is released to the gene AIFM1 , encoding the apoptosis-inducing fac- blood-stream, which causes a systemic drop in pH. tor (AIF), was found to be the cause of mitochon- Indeed, lactic acidosis is among the most important drial encephalomyopathy in two male infants (114). symptoms of mitochondrial disease (reviewed in (3)). AIF is an IMS-targeted protein whose function is ATP defi ciency is one of the most obvious con- incompletely understood. The protein can be released sequences of OXPHOS defi ciency. Decreased rates into the cytoplasm and nucleus where it induces frag- of ATP production have been found in mitochondria mentation of nuclear DNA, leading to a form of pro- from CI-defi cient patient muscle, but ATP defi ciency

For personal use only. grammed cell death that is independent of caspase. may not be the most crucial metabolic derangement Patient muscle displayed increased sensitivity to this responsible for cellular dysfunction in these disor- form of programmed cell death, in addition to mtDNA ders (116). ATP defi ciency and aberrant calcium sig- depletion and OXPHOS failure. The latter may have naling have been proposed as interlinked pathways been due to destabilization of the IMM (114). leading to cell dysfunction in mitochondrial disease: Finally, severe lack of CIV activity was found in fi rst, because mitochondrial ATP production is needed patients with ethylmalonic encephalopathy and to fuel calcium pumps in the endoplasmic reticulum, mutation in the gene ETHE1 . The gene encodes a and, second, because mitochondria themselves can Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 mitochondrial dioxygenase, and the mutation caused buffer calcium and have their function regulated by accumulation of sulfi de, which is a potent inhibitor the infl ux of calcium (reviewed in (118)). This model of CIV (115). Together, these studies showed that could account for the frequent involvement of mus- mitochondrial dysfunction can result from a multi- cle and nerve tissues in mitochondrial diseases, since tude of mechanisms other than direct impairment of these cells rely heavily on ATP and on fl uctuating OXPHOS. levels of activity mediated by Ca2 ϩ pulses. However, as different mitochondrial disorders are highly tissue- specifi c, ATP defi ciency cannot be the sole underlying Consequences of OXPHOS defects factor in mitochondrial diseases. Our understanding of the genetic etiology of mito- Finally, OXPHOS dysfunction in individual tis- chondrial diseases is expanding rapidly. However, sues is likely to have metabolic consequences on the relatively little is known of the molecular conse- systemic level. For instance, we recently reported quences of impaired OXPHOS that account for the that skeletal muscle in mice reacts to OXPHOS dys- development of symptoms in specifi c tissues. Given function by developing a starvation-like state that the multitude of functions that mitochondria take includes up-regulating the expression of the fasting- part in and the universal need of ATP by all cells, related hormone FGF21, which is likely to induce the pathogenic mechanisms are likely to be complex. the mobilization of energy stores in liver and fat for Potential consequences of OXPHOS impairment use in the starved skeletal muscle (119). The starva- include metabolite build-up, defi ciency of ATP, tion-like state could also entail increased turn-over Mitochondrial diseases 55

of mitochondria by the process known as mitochon- 2. Schaefer AM, McFarland R, Blakely EL, He L, Whittaker RG, drial autophagy, or mitophagy. Selective removal of Taylor RW, et al. Prevalence of mitochondrial DNA disease dysfunctional mitochondria by mitophagy is likely to in adults. Ann Neurol. 2008;63:35– 9. 3. Debray FG, Lambert M, Mitchell GA. Disorders of mito- be a central mechanism by which cells maintain a chondrial function. Curr Opin Pediatr. 2008;20:471– 82. healthy mitochondrial population (120,121). Intrigu- 4. McFarland R, Taylor RW, Turnbull DM. The neurology of ingly, defective mitophagy has been implicated in the mitochondrial DNA disease. Lancet Neurol. 2002;1:343– 51. development of Parkinson’ s disease (120). Hence, mod- 5. Chan DC. Mitochondria: dynamic organelles in disease, aging, ifi cation of the physiological responses to OXPHOS and development. Cell. 2006;125:1241– 52. 6. Anderson S, Bankier AT, Barrell BG, de Bruijn MH, dysfunction could provide novel therapeutic tools to Coulson AR, Drouin J, et al. Sequence and organization of combat mitochondrial and neurodegenerative dis- the human mitochondrial genome. Nature. 1981;290: eases. For instance, we found that high-fat feeding of 457 – 65. mice considerably improved the ultrastructural changes 7. Pagliarini DJ, Calvo SE, Chang B, Sheth SA, Vafai SB, of mitochondria in skeletal muscle of late-onset mito- Ong SE, et al. A mitochondrial protein compendium elucidates complex I disease biology. Cell. 2008;134:112– 23. chondrial myopathy mice (122). These results sug- 8. Poulton J, Chiaratti MR, Meirelles FV, Kennedy S, Wells D, gested the following: 1) Mitochondrial biogenesis is Holt IJ. Transmission of mitochondrial DNA diseases and boosted upon lipid feeding. The mitochondria are ways to prevent them. PLoS Genet. 2010;6:pii:e1001066. the major lipid-oxidizing organelle, whereas glucose 9. Cree LM, Samuels DC, de Sousa Lopes SC, Rajasimha HK, can be used for ATP production both by mitochondria Wonnapinij P, Mann JR, et al. A reduction of mitochondrial DNA molecules during embryogenesis explains the rapid and by cytoplasmic glycolysis. Use of lipids requires segregation of genotypes. Nat Genet. 2008;40:249– 54. active mitochondria. 2) If glucose is available and 10. Wai T, Teoli D, Shoubridge EA. The mitochondrial DNA glycolytic ATP production is possible, even mild dys- genetic bottleneck results from replication of a subpopula- function in mitochondria may cause their active down- tion of genomes. Nat Genet. 2008;40:1484– 8. regulation, leading to cells relying on glycolysis. 3) 11. Fan W, Waymire KG, Narula N, Li P, Rocher C, Coskun PE, et al. A mouse model of mitochondrial disease reveals germ- By lipid-feeding mitochondria are forced to be active, line selection against severe mtDNA mutations. Science. and poorly working mitochondria may actually be 2008;319:958– 62. more beneficial for cells than down-regulated 12. Stewart JB, Freyer C, Elson JL, Wredenberg A, Cansu Z, mitochondria, as they produce more ATP than mere Trifunovic A, et al. Strong purifying selection in transmission glycolysis. Therefore, correct composition of nutri- of mammalian mitochondrial DNA. PLoS Biol. 2008;6:e10. 13. Greaves LC, Turnbull DM. Mitochondrial DNA mutations tion may be crucial for mitochondrial patients. and ageing. Biochim Biophys Acta. 2009;1790:1015– 20. For personal use only. 14. Fernandez-Vizarra E, Tiranti V, Zeviani M. Assembly of the oxidative phosphorylation system in humans: what we have Conclusion learned by studying its defects. Biochim Biophys Acta. The fi rst description of genetic mutations in mito- 2009;1793:200– 11. 15. Carroll J, Fearnley IM, Skehel JM, Shannon RJ, Hirst J, chondrial disease came in 1988 (21,102), and since Walker JE. Bovine complex I is a complex of 45 different then the fi eld has expanded exponentially. The molec- subunits. J Biol Chem. 2006;281:32724– 7. ular pathways required for the synthesis and assem- 16. Berrisford JM, Sazanov LA. Structural basis for the mechanism bly of functional OXPHOS machinery are remarkably of respiratory complex I. J Biol Chem. 2009;284:29773– 83. Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 complex, requiring over a thousand genes in two sep- 17. Efremov RG, Baradaran R, Sazanov LA. The architecture of respiratory complex I. Nature. 2010;465:441– 5. arate genomes. New techniques for gene searching, 18. Hunte C, Zickermann V, Brandt U. Functional modules and such as whole-exome sequencing, are likely to expand structural basis of conformational coupling in mitochondrial rapidly the list of genes implicated in mitochondrial complex I. Science. 2010;329:448– 51. diseases, including those with strictly tissue-specifi c 19. Sazanov LA, Hinchliffe P. Structure of the hydrophilic manifestation. However, the real challenge will be domain of respiratory complex I from Thermus thermophilus. Science. 2006;311:1430– 6. to explain the molecular mechanisms responsible 20. Distelmaier F, Koopman WJ, van den Heuvel LP, Rodenburg RJ, for diversity of phenotypes, both on the level of the Mayatepek E, Willems PH, et al. Mitochondrial complex I individual cell and the entire organism. defi ciency: from organelle dysfunction to clinical disease. Brain. 2009;132(Pt 4):833– 42. 21. Wallace DC, Singh G, Lott MT, Hodge JA, Schurr TG, Declaration of interest: The authors state no con- Lezza AM, et al. Mitochondrial DNA mutation associated fl ict of interest and have received no payment in with Leber’ s hereditary optic neuropathy. Science. 1988;242: preparation of this manuscript. 1427– 30. 22. Antonicka H, Ogilvie I, Taivassalo T, Anitori RP, Haller RG, Vissing J, et al. Identifi cation and characterization of a com- References mon set of complex I assembly intermediates in mitochondria from patients with complex I defi ciency. J Biol Chem. 1. Schaefer AM, Taylor RW, Turnbull DM, Chinnery PF. The 2003;278:43081– 8. epidemiology of mitochondrial disorders— past, present and 23. Ugalde C, Vogel R, Huijbens R, Van Den Heuvel B, Smeitink J, future. Biochim Biophys Acta. 2004;1659:115– 20. Nijtmans L. Human mitochondrial complex I assembles 56 E. Ylikallio & A. Suomalainen

through the combination of evolutionary conserved mod- 41. Smith D, Gray J, Mitchell L, Antholine WE, Hosler JP. ules: a framework to interpret complex I defi ciencies. Hum Assembly of cytochrome-c oxidase in the absence of assem- Mol Genet. 2004;13:2461– 72. bly protein Surf1p leads to loss of the active site heme. J Biol 24. Vogel RO, Dieteren CE, van den Heuvel LP, Willems PH, Chem. 2005;280:17652– 6. Smeitink JA, Koopman WJ, et al. Identifi cation of mitochon- 42. Weraarpachai W, Antonicka H, Sasarman F, Seeger J, drial complex I assembly intermediates by tracing tagged Schrank B, Kolesar JE, et al. Mutation in TACO1, encoding NDUFS3 demonstrates the entry point of mitochondrial a translational activator of COX I, results in cytochrome c subunits. J Biol Chem. 2007;282:7582– 90. oxidase defi ciency and late-onset Leigh syndrome. Nat 25. Klein JA, Longo-Guess CM, Rossmann MP, Seburn KL, Genet. 2009;41:833– 7. Hurd RE, Frankel WN, et al. The harlequin mouse mutation 43. Ghezzi D, Saada A, D’ Adamo P, Fernandez-Vizarra E, downregulates apoptosis-inducing factor. Nature. 2002;419: Gasparini P, Tiranti V, et al. FASTKD2 nonsense mutation 367 – 74. in an infantile mitochondrial encephalomyopathy associated 26. Bourgeron T, Rustin P, Chretien D, Birch-Machin M, with cytochrome c oxidase defi ciency. Am J Hum Genet. Bourgeois M, Viegas-Pequignot E, et al. Mutation of a 2008;83:415– 23. nuclear succinate dehydrogenase gene results in mitochon- 44. Holt IJ, Harding AE, Petty RK, Morgan-Hughes JA. A new drial respiratory chain defi ciency. Nat Genet. 1995;11: mitochondrial disease associated with mitochondrial DNA 144 – 9. heteroplasmy. Am J Hum Genet. 1990;46:428– 33. 27. Astuti D, Latif F, Dallol A, Dahia PL, Douglas F, George E, 45. Houstek J, Pickova A, Vojtiskova A, Mracek T, Pecina P, et al. Gene mutations in the succinate dehydrogenase subu- Jesina P. Mitochondrial diseases and genetic defects of ATP nit SDHB cause susceptibility to familial pheochromocy- synthase. Biochim Biophys Acta. 2006;1757:1400– 5. toma and to familial paraganglioma. Am J Hum Genet. 46. Wang ZG, White PS, Ackerman SH. Atp11p and Atp12p are 2001;69:49– 54. assembly factors for the F(1)-ATPase in human mitochon- 28. Baysal BE, Ferrell RE, Willett-Brozick JE, Lawrence EC, dria. J Biol Chem. 2001;276:30773– 8. Myssiorek D, Bosch A, et al. Mutations in SDHD, a mito- 47. De Meirleir L, Seneca S, Lissens W, De Clercq I, Eyskens F, chondrial complex II gene, in hereditary paraganglioma. Sci- Gerlo E, et al. Respiratory chain complex V defi ciency due ence. 2000;287:848– 51. to a mutation in the assembly gene ATP12. J Med Genet. 29. Niemann S, Muller U. Mutations in SDHC cause autosomal 2004;41:120– 4. dominant paraganglioma, type 3. Nat Genet. 2000;26:268– 70. 48. Mayr JA, Havlickova V, Zimmermann F, Magler I, Kaplanova V, 30. Eng C, Kiuru M, Fernandez MJ, Aaltonen LA. A role for Jesina P, et al. Mitochondrial ATP synthase defi ciency due mitochondrial enzymes in inherited neoplasia and beyond. to a mutation in the ATP5E gene for the F1 epsilon subunit. Nat Rev Cancer. 2003;3:193– 202. Hum Mol Genet. 2010;19:3430– 9. 31. Benit P, Lebon S, Rustin P. Respiratory-chain diseases 49. Copeland WC. Inherited mitochondrial diseases of DNA related to complex III defi ciency. Biochim Biophys Acta. replication. Annu Rev Med. 2008;59:131– 46. 2009;1793:181– 5. 50. Luoma P, Melberg A, Rinne JO, Kaukonen JA, Nupponen NN, 32. Crofts AR. The cytochrome bc1 complex: function in the Chalmers RM, et al. Parkinsonism, premature menopause, For personal use only. context of structure. Annu Rev Physiol. 2004;66:689– 733. and mitochondrial DNA polymerase gamma mutations: 33. Acin-Perez R, Bayona-Bafaluy MP, Fernandez-Silva P, clini cal and molecular genetic study. Lancet. 2004;364: Moreno-Loshuertos R, Perez-Martos A, Bruno C, et al. Res- 875 – 82. piratory complex III is required to maintain complex I in 51. Ylikallio E, Tyynismaa H, Tsutsui H, Ide T, Suomalainen A. mammalian mitochondria. Mol Cell. 2004;13:805– 15. High mitochondrial DNA copy number has detrimental effects 34. McKenzie M, Lazarou M, Thorburn DR, Ryan MT. Mito- in mice. Hum Mol Genet. 2010;19:2695– 705. chondrial respiratory chain supercomplexes are destabilized 52. Wanrooij S, Falkenberg M. The human mitochondrial rep- in Barth Syndrome patients. J Mol Biol. 2006;361:462– 9. lication fork in health and disease. Biochim Biophys Acta. 35. Visapaa I, Fellman V, Vesa J, Dasvarma A, Hutton JL, Kumar V, 2010;1797:1378– 88.

Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 et al. GRACILE syndrome, a lethal metabolic disorder with 53. Rampazzo C, Miazzi C, Franzolin E, Pontarin G, Ferraro P, iron overload, is caused by a point mutation in BCS1L. Am Frangini M, et al. Regulation by degradation, a cellular J Hum Genet. 2002;71:863– 76. defense against deoxyribonucleotide pool imbalances. Mutat 36. Hinson JT, Fantin VR, Schonberger J, Breivik N, Siem G, Res. 2010 28;703:2– 10. McDonough B, et al. Missense mutations in the BCS1L 54. Chan SS, Copeland WC. DNA polymerase gamma and mito- gene as a cause of the Bjornstad syndrome. N Engl J Med. chondrial disease: understanding the consequence of POLG 2007;356:809– 19. mutations. Biochim Biophys Acta. 2009;1787:312– 9. 37. Diaz F. Cytochrome c oxidase deﬁ ciency: patients and ani- 55. Hakonen AH, Heiskanen S, Juvonen V, Lappalainen I, mal models. Biochim Biophys Acta. 2010;1802:100– 10. Luoma PT, Rantamaki M, et al. Mitochondrial DNA polymer- 38. Antonicka H, Leary SC, Guercin GH, Agar JN, Horvath R, ase W748S mutation: a common cause of autosomal reces- Kennaway NG, et al. Mutations in COX10 result in a defect sive ataxia with ancient European origin. Am J Hum Genet. in mitochondrial heme A biosynthesis and account for mul- 2005;77:430– 41. tiple, early-onset clinical phenotypes associated with isolated 56. Van Goethem G, Dermaut B, Lofgren A, Martin JJ, COX deﬁ ciency. Hum Mol Genet. 2003;12:2693– 702. Van Broeckhoven C. Mutation of POLG is associated with 39. Antonicka H, Mattman A, Carlson CG, Glerum DM, progressive external ophthalmoplegia characterized by mtDNA Hoffbuhr KC, Leary SC, et al. Mutations in COX15 pro- deletions. Nat Genet. 2001;28:211– 2. duce a defect in the mitochondrial heme biosynthetic path- 57. Lee YS, Kennedy WD, Yin YW. Structural insight into proces- way, causing early-onset fatal hypertrophic cardiomyopathy. sive human mitochondrial DNA synthesis and disease-related Am J Hum Genet. 2003;72:101– 14. polymerase mutations. Cell. 2009;139:312– 24. 40. Zhu Z, Yao J, Johns T, Fu K, De Bie I, Macmillan C, et al. 58. Longley MJ, Clark S, Yu Wai Man C, Hudson G, Durham SE, SURF1, encoding a factor involved in the biogenesis of cyto- Taylor RW, et al. Mutant POLG2 disrupts DNA polymerase chrome c oxidase, is mutated in Leigh syndrome. Nat Genet. gamma subunits and causes progressive external ophthalmo- 1998;20:337– 43. plegia. Am J Hum Genet. 2006;78:1026– 34. Mitochondrial diseases 57

59. Walter MC, Czermin B, Muller-Ziermann S, Bulst S, down-regulation and transcriptional compensation. Hum Stewart JD, Hudson G, et al. Late-onset ptosis and myopa- Mol Genet. 2010;20:155– 64. thy in a patient with a heterozygous insertion in POLG2. 76. Nishino I, Spinazzola A, Hirano M. Thymidine phosphory- J Neurol. 2010;257:1517– 23. lase gene mutations in MNGIE, a human mitochondrial 60. Spelbrink JN, Li FY, Tiranti V, Nikali K, Yuan QP, Tariq M, disorder. Science. 1999;283:689– 92. et al. Human mitochondrial DNA deletions associated with 77. Hirano M, Nishigaki Y, Marti R. Mitochondrial neurogas- mutations in the gene encoding Twinkle, a phage T7 gene trointestinal encephalomyopathy (MNGIE): a disease of two 4-like protein localized in mitochondria. Nat Genet. genomes. Neurologist. 2004;10:8– 17. 2001;28:223– 31. 78. Ylikallio E, Page JL, Xu X, Lampinen M, Bepler G, Ide T, 61. Hakonen AH, Isohanni P, Paetau A, Herva R, Suomalainen et al. Ribonucleotide reductase is not limiting for mitochon- A, Lonnqvist T. Recessive Twinkle mutations in early onset drial DNA copy number in mice. Nucleic Acids Res. encephalopathy with mtDNA depletion. Brain. 2007;130(Pt 2010;38:8208– 18. 11):3032– 40. 79. Smits P, Smeitink J, van den Heuvel L. Mitochondrial trans- 62. Sarzi E, Goffart S, Serre V, Chretien D, Slama A, Munnich A, lation and beyond: processes implicated in combined oxida- et al. Twinkle helicase (PEO1) gene mutation causes mito- tive phosphorylation defi ciencies. J Biomed Biotechnol. 2010; chondrial DNA depletion. Ann Neurol. 2007;62:579– 87. 2010:737385. 63. Hakonen AH, Goffart S, Marjavaara S, Paetau A, Cooper H, 80. Spremulli LL, Coursey A, Navratil T, Hunter SE. Initiation Mattila K, et al. Infantile-onset spinocerebellar ataxia and and elongation factors in mammalian mitochondrial protein mitochondrial recessive ataxia syndrome are associated with biosynthesis. Prog Nucleic Acid Res Mol Biol. 2004;77: neuronal complex I defect and mtDNA depletion. Hum Mol 211 – 61. Genet. 2008;17:3822– 35. 81. Smits P, Smeitink JA, van den Heuvel LP, Huynen MA, 64. Tyynismaa H, Mjosund KP, Wanrooij S, Lappalainen I, Ettema TJ. Reconstructing the evolution of the mitochon- Ylikallio E, Jalanko A, et al. Mutant mitochondrial helicase drial ribosomal proteome. Nucleic Acids Res. 2007;35: Twinkle causes multiple mtDNA deletions and a late-onset 4686– 703. mitochondrial disease in mice. Proc Natl Acad Sci U S A. 82. Bykhovskaya Y, Casas K, Mengesha E, Inbal A, Fischel- 2005;102:17687– 92. Ghodsian N. Missense mutation in pseudouridine synthase 65. Goffart S, Cooper HM, Tyynismaa H, Wanrooij S, 1 (PUS1) causes mitochondrial myopathy and sideroblastic Suomalainen A, Spelbrink JN. Twinkle mutations associated anemia (MLASA). Am J Hum Genet. 2004;74:1303– 8. with autosomal dominant progressive external ophthalmo- 83. Bykhovskaya Y, Mengesha E, Fischel-Ghodsian N. plegia lead to impaired helicase function and in vivo mtDNA Pleiotropic effects and compensation mechanisms deter- replication stalling. Hum Mol Genet. 2009;18:328– 40. mine tissue specifi city in mitochondrial myopathy and 66. Wanrooij S, Luoma P, van Goethem G, van Broeckhoven C, sideroblastic anemia (MLASA). Mol Genet Metab. 2007;91: Suomalainen A, Spelbrink JN. Twinkle and POLG defects 148 – 56. enhance age-dependent accumulation of mutations in the 84. Zeharia A, Shaag A, Pappo O, Mager-Heckel AM, Saada A, control region of mtDNA. Nucleic Acids Res. 2004;32: Beinat M, et al. Acute infantile liver failure due to mutations For personal use only. 3053– 64. in the TRMU gene. Am J Hum Genet. 2009;85:401– 7. 67. Srivastava S, Moraes CT. Double-strand breaks of mouse 85. Guan MX, Yan Q, Li X, Bykhovskaya Y, Gallo-Teran J, Hajek P, muscle mtDNA promote large deletions similar to multiple et al. Mutation in TRMU related to transfer RNA modifi ca- mtDNA deletions in humans. Hum Mol Genet. 2005;14: tion modulates the phenotypic expression of the deafness- 893 – 902. associated mitochondrial 12S ribosomal RNA mutations. 68. Moslemi AR, Melberg A, Holme E, Oldfors A. Clonal Am J Hum Genet. 2006;79:291– 302. expansion of mitochondrial DNA with multiple deletions in 86. Miller C, Saada A, Shaul N, Shabtai N, Ben-Shalom E, autosomal dominant progressive external ophthalmoplegia. Shaag A, et al. Defective mitochondrial translation caused Ann Neurol. 1996;40:707– 13. by a ribosomal protein (MRPS16) mutation. Ann Neurol.

Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 69. Fukui H, Moraes CT. Mechanisms of formation and accu- 2004;56:734– 8. mulation of mitochondrial DNA deletions in aging neurons. 87. Saada A, Shaag A, Arnon S, Dolfi n T, Miller C, Fuchs-Telem D, Hum Mol Genet. 2009;18:1028– 36. et al. Antenatal mitochondrial disease caused by mitochon- 70. Reichard P. Interactions between deoxyribonucleotide and drial ribosomal protein (MRPS22) mutation. J Med Genet. DNA synthesis. Annu Rev Biochem. 1988;57:349– 74. 2007;44:784– 6. 71. Mandel H, Szargel R, Labay V, Elpeleg O, Saada A, Shalata A, 88. Coenen MJ, Antonicka H, Ugalde C, Sasarman F, Rossi R, et al. The deoxyguanosine kinase gene is mutated in indi- Heister JG, et al. Mutant mitochondrial elongation factor viduals with depleted hepatocerebral mitochondrial DNA. G1 and combined oxidative phosphorylation defi ciency. N Nat Genet. 2001;29:337– 41. Engl J Med. 2004;351:2080– 6. 72. Saada A, Shaag A, Mandel H, Nevo Y, Eriksson S, Elpeleg O. 89. Valente L, Tiranti V, Marsano RM, Malfatti E, Mutant mitochondrial thymidine kinase in mitochondrial Fernandez-Vizarra E, Donnini C, et al. Infantile encepha- DNA depletion myopathy. Nat Genet. 2001;29:342– 4. lopathy and defective mitochondrial DNA translation in 73. Bourdon A, Minai L, Serre V, Jais JP, Sarzi E, Aubert S, et al. patients with mutations of mitochondrial elongation factors Mutation of RRM2B, encoding p53-controlled ribonucle- EFG1 and EFTu. Am J Hum Genet. 2007;80:44– 58. otide reductase (p53R2), causes severe mitochondrial DNA 90. Antonicka H, Sasarman F, Kennaway NG, Shoubridge EA. depletion. Nat Genet. 2007;39:776– 80. The molecular basis for tissue specifi city of the oxidative 74. Tyynismaa H, Ylikallio E, Patel M, Molnar MJ, Haller RG, phosphorylation defi ciencies in patients with mutations in Suomalainen A. A heterozygous truncating mutation in the mitochondrial translation factor EFG1. Hum Mol Genet. RRM2B causes autosomal-dominant progressive external oph- 2006;15:1835– 46. thalmoplegia with multiple mtDNA deletions. Am J Hum 91. Smeitink JA, Elpeleg O, Antonicka H, Diepstra H, Saada A, Genet. 2009;85:290– 5. Smits P, et al. Distinct clinical phenotypes associated with a 75. Dorado B, Area E, Akman HO, Hirano M. Onset and mutation in the mitochondrial translation elongation factor organ specificity of Tk2 deficiency depends on Tk1 EFTs. Am J Hum Genet. 2006;79:869– 77. 58 E. Ylikallio & A. Suomalainen

92. Edvardson S, Shaag A, Kolesnikova O, Gomori JM, Tarassov I, 110. Roesch K, Curran SP, Tranebjaerg L, Koehler CM. Human Einbinder T, et al. Deleterious mutation in the mitochondrial deafness dystonia syndrome is caused by a defect in assem- arginyl-transfer RNA synthetase gene is associated with bly of the DDP1/TIMM8a-TIMM13 complex. Hum Mol pontocerebellar hypoplasia. Am J Hum Genet. 2007;81: Genet. 2002;11:477– 86. 857 – 62. 111. Di Fonzo A, Ronchi D, Lodi T, Fassone E, Tigano M, 93. Scheper GC, van der Klok T, van Andel RJ, van Berkel CG, Lamperti C, et al. The mitochondrial disulfi de relay system Sissler M, Smet J, et al. Mitochondrial aspartyl-tRNA syn- protein GFER is mutated in autosomal-recessive myopathy thetase defi ciency causes leukoencephalopathy with brain with cataract and combined respiratory-chain defi ciency. stem and spinal cord involvement and lactate elevation. Nat Am J Hum Genet. 2009;84:594– 604. Genet. 2007;39:534– 9. 112. Casari G, De Fusco M, Ciarmatori S, Zeviani M, Mora M, 94. Riley LG, Cooper S, Hickey P, Rudinger-Thirion J, Fernandez P, et al. Spastic paraplegia and OXPHOS McKenzie M, Compton A, et al. Mutation of the mitochon- impairment caused by mutations in paraplegin, a nuclear- drial tyrosyl-tRNA synthetase gene, YARS2, causes myopathy, encoded mitochondrial metalloprotease. Cell. 1998;93:973– 83. lactic acidosis, and sideroblastic anemia— MLASA syndrome. 113. Rugarli EI, Langer T. Translating m-AAA protease function Am J Hum Genet. 2010;87:52– 9. in mitochondria to hereditary spastic paraplegia. Trends 95. Belostotsky R, Ben-Shalom E, Rinat C, Becker-Cohen R, Mol Med. 2006;12:262– 9. Feinstein S, Zeligson S, et al. Mutations in the mitochon- 114. Ghezzi D, Sevrioukova I, Invernizzi F, Lamperti C, Mora M, drial seryl-tRNA synthetase cause hyperuricemia, pul- D ’ Adamo P, et al. Severe X-linked mitochondrial encepha- monary hypertension, renal failure in infancy and alkalosis, lomyopathy associated with a mutation in apoptosis-inducing HUPRA syndrome. Am J Hum Genet. 2011;88:193– 200. factor. Am J Hum Genet. 2010;86:639– 49. 96. Gotz A, Tyynismaa H, Euro L, Ellonen P, Hyotylainen T, 115. Tiranti V, Viscomi C, Hildebrandt T, Di Meo I, Mineri R, Ojala T, et al. Exome sequencing identifi es mitochondrial Tiveron C, et al. Loss of ETHE1, a mitochondrial dioxy- alanyl-tRNA synthetase mutations in infantile mitochon- genase, causes fatal sulfi de toxicity in ethylmalonic enceph- drial cardiomyopathy. Am J Hum Genet. 2011;88:635– 42. alopathy. Nat Med. 2009;15:200– 5. 97. Pierce SB, Chisholm KM, Lynch ED, Lee MK, Walsh T, 116. Smeitink JA, Zeviani M, Turnbull DM, Jacobs HT. Mito- Opitz JM, et al. Mutations in mitochondrial histidyl tRNA chondrial medicine: a metabolic perspective on the pathol- synthetase HARS2 cause ovarian dysgenesis and sen- ogy of oxidative phosphorylation disorders. Cell Metab. sorineural hearing loss of Perrault syndrome. Proc Natl Acad 2006;3:9– 13. Sci U S A. 2011;108:6543– 8. 117. Balaban RS, Nemoto S, Finkel T. Mitochondria, oxidants, 98. DiMauro S, Davidzon G. Mitochondrial DNA and disease. and aging. Cell. 2005;120:483– 95. Ann Med. 2005;37:222– 32. 118. Willems PH, Valsecchi F, Distelmaier F, Verkaart S, Visch HJ, 99. Scaglia F, Wong LJ. Human mitochondrial transfer RNAs: Smeitink JA, et al. Mitochondrial Ca2 ϩ homeostasis in role of pathogenic mutation in disease. Muscle Nerve. 2008; human NADH:ubiquinone oxidoreductase defi ciency. Cell 37:150– 71. Calcium. 2008;44:123– 33. 100. Jacobs HT. Disorders of mitochondrial protein synthesis. 119. Tyynismaa H, Carroll CJ, Raimundo N, Ahola-Erkkila S, For personal use only. Hum Mol Genet. 2003;12 Spec No 2:R293– 301. Wenz T, Ruhanen H, et al. Mitochondrial myopathy induces 101. Prezant TR, Agapian JV, Bohlman MC, Bu X, Oztas S, a starvation-like response. Hum Mol Genet. 2010;19:3948– 58. Qiu WQ, et al. Mitochondrial ribosomal RNA mutation 120. Narendra D, Tanaka A, Suen DF, Youle RJ. Parkin is associated with both antibiotic-induced and non-syndromic recruited selectively to impaired mitochondria and pro- deafness. Nat Genet. 1993;4:289– 94. motes their autophagy. J Cell Biol. 2008;183:795– 803. 102. Holt IJ, Harding AE, Morgan-Hughes JA. Deletions of 121. Twig G, Elorza A, Molina AJ, Mohamed H, Wikstrom JD, muscle mitochondrial DNA in patients with mitochondrial Walzer G, et al. Fission and selective fusion govern mito- myopathies. Nature. 1988;331:717– 9. chondrial segregation and elimination by autophagy. EMBO 103. Detmer SA, Chan DC. Functions and dysfunctions of mito- J. 2008;27:433– 46.

Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 chondrial dynamics. Nat Rev Mol Cell Biol. 2007;8:870– 9. 122. Ahola-Erkkilä S, Carroll CJ, Peltola-Mjosund K, Tulkki V, 104. Zuchner S, Mersiyanova IV, Muglia M, Bissar-Tadmouri N, Mattila I, Seppanen-Laakso T, et al. Ketogenic diet slows Rochelle J, Dadali EL, et al. Mutations in the mitochondrial down mitochondrial myopathy progression in mice. Hum GTPase mitofusin 2 cause Charcot-Marie-Tooth neuropa- Mol Genet. 2010;19:1974– 84. thy type 2A. Nat Genet. 2004;36:449– 51. 123. Zhu X, Peng X, Guan MX, Yan Q. Pathogenic mutations 105. Detmer SA, Chan DC. Complementation between mouse of nuclear genes associated with mitochondrial disorders. Mfn1 and Mfn2 protects mitochondrial fusion defects Acta Biochim Biophys Sin (Shanghai). 2009;41:179– 87. caused by CMT2A disease mutations. J Cell Biol. 2007;176: 124. Haack TB, Danhauser K, Haberberger B, Hoser J, Strecker 405 – 14. V, Boehm D, et al. Exome sequencing identifi es ACAD9 106. Alexander C, Votruba M, Pesch UE, Thiselton DL, Mayer S, mutations as a cause of complex I defi ciency. Nat Genet. Moore A, et al. OPA1, encoding a dynamin-related GTPase, 2010;42:1131– 4. is mutated in autosomal dominant optic atrophy linked to 125. Ghezzi D, Goffrini P, Uziel G, Horvath R, Klopstock T, chromosome 3q28. Nat Genet. 2000;26:211– 5. Lochmuller H, et al. SDHAF1, encoding a LYR complex- 107. Delettre C, Lenaers G, Griffoin JM, Gigarel N, Lorenzo C, II specifi c assembly factor, is mutated in SDH-defective Belenguer P, et al. Nuclear gene OPA1, encoding a mito- infantile leukoencephalopathy. Nat Genet. 2009;41:654– 6. chondrial dynamin-related protein, is mutated in dominant 126. Hao HX, Khalimonchuk O, Schraders M, Dephoure N, optic atrophy. Nat Genet. 2000;26:207– 10. Bayley JP, Kunst H, et al. SDH5, a gene required for fl a- 108. Quinzii CM, Hirano M. Coenzyme Q and mitochondrial vination of succinate dehydrogenase, is mutated in paragan- disease. Dev Disabil Res Rev. 2010;16:183– 8. glioma. Science. 2009;325:1139– 42. 109. Jin H, May M, Tranebjaerg L, Kendall E, Fontan G, Jackson J, 127. Barel O, Shorer Z, Flusser H, Ofi r R, Narkis G, Finer G, et al. A novel X-linked gene, DDP, shows mutations in fam- et al. Mitochondrial complex III defi ciency associated with ilies with deafness (DFN-1), dystonia, mental defi ciency a homozygous mutation in UQCRQ. Am J Hum Genet. and blindness. Nat Genet. 1996;14:177– 80. 2008;82:1211– 6. Mitochondrial diseases 59

128. Ghezzi D, Arzuffi P, Zordan M, Da Re C, Lamperti C, translocator 1 in mtDNA maintenance. Science. Benna C, et al. Mutations in TTC19 cause mitochondrial 2000;289:782– 5. complex III defi ciency and neurological impairment in 134. Elpeleg O, Miller C, Hershkovitz E, Bitner-Glindzicz M, humans and fl ies. Nat Genet. 2011;43:259– 63. Bondi-Rubinstein G, Rahman S, et al. Defi ciency of the 129. Shteyer E, Saada A, Shaag A, Al-Hijawi FA, Kidess R, ADP-forming succinyl-CoA synthase activity is associated Revel-Vilk S, et al. Exocrine pancreatic insuffi ciency, dys- with encephalomyopathy and mitochondrial DNA deple- erythropoeitic anemia, and calvarial hyperostosis are caused tion. Am J Hum Genet. 2005;76:1081– 6. by a mutation in the COX4I2 gene. Am J Hum Genet. 135. Ostergaard E, Christensen E, Kristensen E, Mogensen B, 2009;84:412– 7. Duno M, Shoubridge EA, et al. Defi ciency of the alpha 130. Huigsloot M, Nijtmans LG, Szklarczyk R, Baars MJ, van subunit of succinate-coenzyme A ligase causes fatal infan- den Brand MA, Hendriksfranssen MG, et al. A mutation tile lactic acidosis with mitochondrial DNA depletion. Am in c2orf64 causes impaired cytochrome C oxidase assembly J Hum Genet. 2007;81:383– 7. and mitochondrial cardiomyopathy. Am J Hum Genet. 136. Amati-Bonneau P, Valentino ML, Reynier P, Gallardo ME, 2011;88:488– 93. Bornstein B, Boissiere A, et al. OPA1 mutations induce 131. Jonckheere AI, Hogeveen M, Nijtmans LG, van den mitochondrial DNA instability and optic atrophy ‘ plus ’ Brand MA, Janssen AJ, Diepstra JH, et al. A novel mitochon- phenotypes. Brain. 2008;131(Pt 2):338– 51. drial ATP8 gene mutation in a patient with apical hyper- 137. Spinazzola A, Viscomi C, Fernandez-Vizarra E, Carrara F, trophic cardiomyopathy and neuropathy. J Med Genet. D ’ Adamo P, Calvo S, et al. MPV17 encodes an inner mito- 2008;45:129– 33. chondrial membrane protein and is mutated in infantile 132. Cizkova A, Stranecky V, Mayr JA, Tesarova M, Havlickova V, hepatic mitochondrial DNA depletion. Nat Genet. 2006;38: Paul J, et al. TMEM70 mutations cause isolated ATP syn- 570 – 5. thase defi ciency and neonatal mitochondrial encephalocar- 138. Antonicka H, Ostergaard E, Sasarman F, Weraarpachai W, diomyopathy. Nat Genet. 2008;40:1288– 90. Wibrand F, Pedersen AM, et al. Mutations in C12orf65 in 133. Kaukonen J, Juselius JK, Tiranti V, Kyttala A, patients with encephalomyopathy and a mitochondrial Zeviani M, Comi GP, et al. Role of adenine nucleotide translation defect. Am J Hum Genet. 2010;87:115– 22. For personal use only. Ann Med Downloaded from informahealthcare.com by K U Leuven on 03/12/14 J Neurol DOI 10.1007/s00415-013-7225-3

ORIGINAL COMMUNICATION

The m.3243A>G mitochondrial DNA mutation and related phenotypes. A matter of gender?

Michelangelo Mancuso • Daniele Orsucci • Corrado Angelini • Enrico Bertini • Valerio Carelli • Giacomo Pietro Comi • Alice Donati • Carlo Minetti • Maurizio Moggio • Tiziana Mongini • Serenella Servidei • Paola Tonin • Antonio Toscano • Graziella Uziel • Claudio Bruno • Elena Caldarazzo Ienco • Massimiliano Filosto • Costanza Lamperti • Michela Catteruccia • Isabella Moroni • Olimpia Musumeci • Elena Pegoraro • Dario Ronchi • Filippo Maria Santorelli • Donato Sauchelli • Mauro Scarpelli • Monica Sciacco • Maria Lucia Valentino • Liliana Vercelli • Massimo Zeviani • Gabriele Siciliano

Received: 13 November 2013 / Revised: 16 December 2013 / Accepted: 17 December 2013 Ó Springer-Verlag Berlin Heidelberg 2013

Abstract The m.3243A[G ‘‘MELAS’’ (mitochondrial Hearing loss and diabetes were the most frequent clinical encephalopathy with lactic acidosis and stroke-like epi- features, followed by stroke-like episodes. ‘‘MIDD’’ sodes) mutation is one of the most common point muta- (maternally-inherited diabetes and deafness) and ‘‘PEO’’ tions of the mitochondrial DNA, but its phenotypic (progressive external ophthalmoplegia) are nosographic variability is incompletely understood. The aim of this terms without any real prognostic value, because these study was to revise the phenotypic spectrum associated patients may be even more prone to the development of with the mitochondrial m.3243A[G mutation in 126 Italian multisystem complications such as stroke-like episodes and carriers of the mutation, by a retrospective, database-based heart involvement. The ‘‘MELAS’’ acronym is convincing study (‘‘Nation-wide Italian Collaborative Network of and useful to denote patients with histological, biochemical Mitochondrial Diseases’’). Our results conﬁrmed the high and/or molecular evidence of mitochondrial disease who clinical heterogeneity of the m.3243A[G mutation. experience stroke-like episodes. Of note, we observed for

M. Mancuso (&) Á D. Orsucci Á E. C. Ienco Á G. Siciliano A. Donati Neurological Clinic, University of Pisa, Via Roma 67, A. Meyer Children’s Hospital, University of Florence, Florence, 56100 Pisa, Italy Italy e-mail: [email protected] C. Minetti Á C. Bruno C. Angelini Á E. Pegoraro Neuropediatric and Muscle Disorders Unit, University of Genoa, Neurological Clinic, University of Padova, Padua, Italy G. Gaslini Institute, Genoa, Italy

C. Angelini Á E. Pegoraro M. Moggio Á M. Sciacco IRCCS S. Camillo, Venice, Italy Neuromuscular Unit, Dino Ferrari Centre, Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, University of Milan, E. Bertini Á M. Catteruccia Milan, Italy Laboratory of Molecular Medicine, Bambino Gesu` Hospital, Rome, Italy T. Mongini Á L. Vercelli Department of Neuroscience, University of Turin, Turin, Italy V. Carelli Á M. L. Valentino IRCCS Istituto Delle Scienze Neurologiche di Bologna, S. Servidei Á D. Sauchelli Bologna, Italy Institute of Neurology, Catholic University, Rome, Italy

V. Carelli Á M. L. Valentino P. Tonin Á M. Scarpelli Department of Biomedical and Neuromotor Sciences, University Neurological Clinic, University of Verona, Verona, Italy of Bologna, Bologna, Italy A. Toscano Á O. Musumeci G. P. Comi Á D. Ronchi Department of Neurosciences, University of Messina, Messina, Neuroscience Section, Neurology Unit, Dino Ferrari Centre, Italy Department of Pathophysiology and Transplantation (DEPT), IRCCS Foundation Ca’ Granda Ospedale Maggiore Policlinico, University of Milan, Milan, Italy 123 J Neurol the first time that male gender could represent a risk factor these patients? and (4) Which clinical features may direct for the development of stroke-like episodes in Italian clinicians toward this molecular diagnosis? m.3243A[G carriers. Gender effect is not a new concept in mitochondrial medicine, but it has never been observed in MELAS. A better elucidation of the complex network Methods linking mitochondrial dysfunction, apoptosis, estrogen effects and stroke-like episodes may hold therapeutic We reviewed the clinical, morphological, and laboratory promises. features of all carriers of the m.3243A[G substitution enrolled in the database of the ‘‘Nation—wide Italian Keywords A3243G Á MELAS Á MIDD Á Mitochondrial Collaborative Network of Mitochondrial Diseases’’. In DNA Á PEO Á Stroke-like episodes those patients, the diagnosis of mitochondrial disease was supported by clinical, histological, biochemical, and/or molecular findings [3]. Introduction Data were expressed as mean ± standard deviation. The numeric data were compared by unpaired, two-tailed The m.3243A[G mutation is one of the most common t testing (or one-way ANOVA when the groups were [2) point mutations of the mitochondrial genome (mtDNA). or correlated by Spearman’s coefficient of rank correlation. The clinical syndromes that have been historically ascribed Proportions were compared by Fisher’s exact test. Cate- to this substitution include mitochondrial encephalopathy gorical data were associated by means of the Fisher’s exact with lactic acidosis and stroke-like episodes (MELAS), test. Bonferroni’s correction for multiple tests was utilized maternally inherited deafness and diabetes (MIDD), and when appropriate. A P value \0.05 was considered as progressive external ophthalmoplegia (PEO) [1], but het- significant. Data analysis was carried out using MedCalcÒ erogeneity is high [2]. Other reported features include ans SPSSÒ. isolated myopathy, cardiomyopathy, seizures, migraine, ataxia, cognitive impairment, gastro-intestinal dysmotility, Standard protocol approval, registration, and patient and short stature [1]. This phenotypic variability is consent incompletely understood; at least in part it may be due to heteroplasmy, with varying proportions of mutant and The establishment of the database, and its use for scientific wild-type mtDNA molecules in different tissues [2]. purposes, was approved by the local Ethical Committees of However, other factors, environmental and/or genetic, must all the involved centers, who obtained written consent from be involved. each patient, in accordance with the ethical standards of the Here, we revise the phenotypic spectrum associated with 1964 Declaration of Helsinki. The database creation was the m.3243A[G mutation based on a cohort of 126 carriers supported by a Telethon grant (GUP09004). of the mutation from the database of the ‘‘Nation-wide Italian Collaborative Network of Mitochondrial Diseases’’, in order to answer the following questions: (1) Is the distinction in three phenotypes (MELAS; PEO; MIDD) fully Results justified or somehow arbitrary? (2) Are some of the most frequent clinical features mutually associated? (3) Which Relative frequency of m.3243A[G mutation in our factors can explain the marked clinical heterogeneity of database

A total of 133 patients harboring the m.3243A[G mutation G. Uziel Á I. Moroni were identiﬁed among the 1,160 mitochondrial patients Child Neurology Unit, The Foundation ‘‘Carlo Besta’’ Institute of Neurology, IRCCS, Milan, Italy (11.5 %) enlisted in our database (last accession July 1st, 2013). They represented the 36.9 % (133/360) of all indi- M. Filosto viduals with mtDNA point mutations. The clinical features Neurological Clinic, University Hospital Spedali Civili, Brescia, were not available for seven patients, who therefore were Italy not considered for the following analysis, performed on the C. Lamperti Á M. Zeviani remaining 126 individuals. Unit of Molecular Neurogenetics, The Foundation ‘‘Carlo Besta’’ Patients’ mean age at the last evaluation was Institute of Neurology, IRCCS, Milan, Italy 36.0 ± 20.7 years. Men were 65/126 (51.6 %). Eight of F. M. Santorelli 126 (6.3 %) subjects were asymptomatic carriers (age at IRCCS Stella Maris, Pisa, Italy last evaluation was 28.4 ± 27.9 years; range 1–77).

123 J Neurol

Clinical features % 100 90 Table 1 and Fig. 1 summarize the clinical features at onset 80 and at the last evaluation. The mean age at onset of the 118 70 symptomatic patients was 23.4 ± 15.6 years, with 44.1 % 60 of the cases having a childhood (\16 years) onset. Hearing 50 loss was the most common complaint at the onset, followed 40 by generalized seizures and diabetes (see Table 1). 30 At the last evaluation, mean age and disease duration 20 were 36.0 ± 20.7 (range 1–77) and 18.4 ± 16.6 years, 10 respectively. Considering our 126 patients, at the mean age 0 of &36 years, the clinical picture was characterized by the following signs/symptoms, starting from the most frequent: Ataxia Seizures Diabetes Migraine Hypotonia

Ptosis/PEO Neuropathy Muscle pain Retinopathy Hearing loss hearing loss ([50 % of patients); diabetes, stroke-like Cognitive inv. Increased CK Exercise intol. Heart disease Stroke-like ep. Muscle weakn. Muscle wasting Pyramidal signs

Gastroint dysmotil. Thrive fail./short st.

Table 1 Clinical features of the m.3243A[G carriers (n = 126) Fig. 1 Clinical features of the m.3243A[G patients. In the figure are shown the features present in C10 % of patients at the last evaluation. Onset Last evaluation White onset; black last evaluation. For details, see text and Table 1 23.4 ± 15.6 36.0 ± 20.7 yearsa (%) years (%) episodes (40–49.9 %); muscle weakness, generalized seizures, exercise intolerance, heart disease (30–39.9 %); Hearing loss 39 (31.0) 73 (57.9) ptosis/ophthalmoparesis, migraine, cognitive impairment, Generalized seizures 23 (18.3) 47 (37.3) muscle wasting (20–29.9 %); ataxia, increased CK levels, Diabetes 22 (17.5) 51 (40.5) failure to thrive/short stature (15–19.9 %); gastrointestinal Ptosis/ophthalmoparesis 16 (12.7) 35 (27.8) dysmotility, hypotonia, pyramidal signs, peripheral neu- Migraine 16 (12.7) 35 (27.8) ropathy, muscle pain, retinopathy (10–14.9 %). Stroke-like episodes 14 (11.1) 51 (40.5) Seventeen patients, all with central nervous system Muscle weakness 14 (11.1) 50 (39.7) (CNS) involvement (stroke-like episodes reported in 12 Exercise intolerance 14 (11.1) 41 (32.5) cases) died at a mean age of 37.2 ± 22.3 years (range Heart disease 11 (8.7) 40 (31.7) 6–76) because of cardiocirculatory failure (four cases), Cognitive involvement 11 (8.7) 31 (24.6) stroke (three cases), status epilepticus or intractable lactic Failure to thrive/short st. 11 (8.7) 21 (16.7) acidosis (each in one case). The cause of death remained Increased CK 7 (5.6) 25 (19.8) unknown for eight patients. Muscle pain 7 (5.6) 13 (10.3) Muscle wasting 6 (4.8) 29 (23.0) Stroke-like episodes Vomiting 5 (4.0) 7 (5.6) Gastrointestinal dysmotil. 4 (3.2) 16 (12.7) Stroke-like episodes are crucial for the syndromic diag- Neuropathy 4 (3.2) 13 (10.3) nosis of MELAS. Here, we define as ‘‘MELAS’’ the group Ataxia 3 (2.4) 25 (19.8) of patients with clinical and or radiological evidence of Hypotonia 3 (2.4) 15 (11.9) stroke-like episodes; on the other hand, ‘‘non-MELAS’’ Retinopathy 3 (1.8) 13 (10.3) patients are defined as individuals carrying the Myoclonus 3 (2.4) 8 (6.3) m.3243A[G who have not experienced stroke-like Hypothyroidism 2 (1.6) 5 (4.0) episodes. Psychiatric involvement 1 (0.8) 8 (6.3) Fifty-one out of 126 (40.5 %) of m.3243A[G carriers, Optic neuropathy 1 (0.8) 6 (4.8) at the mean age of 36 years, had suffered stroke-like epi- Hypogonadism 1 (0.8) 5 (4.0) sodes (see Table 1). Age at onset, age at last control, and Pyramidal signs – 14 (11.1) disease duration were not different between ‘‘MELAS’’ and Respiratory impairment – 6 (4.8) ‘‘non-MELAS’’ groups. Furthermore, heteroplasmy levels Status epilepticus – 5 (4.0) could not predict stroke-like episodes, and no difference in the proportion of patients with ragged red fibers and COX- The ten most frequent features are shown in bold. Swallowing impairment, tremor, anemia, cataract, dyskinesia, hepatopathy, kid- negative fibers was observed between the two groups. ney inv. \3% Lactate increase was strongly associated with MELAS a The symptomatic patients (P = 0.0003), confirming the validity of the acronym.

123 J Neurol

Among the other nine most frequent clinical features (see with heart disease (‘‘HL’’ with heart disease 32/73, 43.8 %; Table 1, in bold—significance level after Bonferroni’s ‘‘non-HL’’ with heart disease 8/53, 15.1 %; P = 0.00086) correction: 0.0056), stroke-like episodes were strongly and exercise intolerance (‘‘HL’’ with exercise intolerance associated with generalized seizures (‘‘MELAS’’ with sei- 32/73, 43.8 %; ‘‘non-HL’’ with exercise intolerance 9/53, zures 35/51, 68.6 %; ‘‘non-MELAS’’ with seizures 12/75, 17.0 %; P = 0.0019). A non-significant trend was 16.0 %; P \ 0.000001), cognitive involvement observed for the association with cognitive involvement (‘‘MELAS’’ with cognitive impairment 20/51, 39.2 %; (P = 0.012) and muscle weakness (P = 0.015). ‘‘non-MELAS’’ with cognitive impairment 11/75, 14.7 %; On the contrary, diabetes did not result associated with P = 0.0028) and hearing loss (‘‘MELAS’’ with hearing any of the most frequent clinical features (except hearing loss 38/51, 74.5 %; ‘‘non-MELAS’’ with hearing loss loss). 35/75, 46.7 %; P = 0.0030). Stroke-like episodes were not Noteworthy, ‘‘pure’’ MIDD was very rare in our cohort associated with migraine. (3/126, 2.4 %). Therefore, ‘‘MIDD’’ may be useful to denote the very strong association between diabetes and Is there a gender effect in MELAS? hearing loss, but less to represent a well-defined, pure clinical picture in m.3243A[G patients. The ‘‘MELAS’’ group was enriched in males (33/51, 64.7 %) if compared with the ‘‘non-MELAS’’ group (men Progressive external ophthalmoplegia (PEO) 32/75, 42.7 %). This difference, which is statistically significant with a P = 0.019 (Table 2), was not explained by As already seen, ptosis/ophthalmoparesis was not associ- possible confounding factors such as onset age, age at the ated with stroke-like episodes, hearing loss, or diabetes. last control, disease duration, and levels of heteroplasmy in Among the other six most common clinical features (see tissues (muscle, blood, and urine), which did not signifi- Table 1—significance level after Bonferroni’s correction cantly differ between the two groups. 0.0083), PEO was significantly associated with heart disease (‘‘PEO’’ with heart disease 18/35, 51.4 %; ‘‘non- ‘‘MIDD syndrome’’ PEO’’ with heart disease 22/91, 24.2 %; P = 0.0051). A non-significant trend was observed for the association with Hearing loss and diabetes were associated with a high muscle weakness (P = 0.044). statistical significance (P = 0.0002) in m.3243A[G As was the case for the pure MIDD, ‘‘pure’’ PEO was patients (Table 3), thus confirming the validity of the rare in our cohort (4/126, 3.2 %). acronym MIDD at least from this point of view. Apart from stroke-like episodes and diabetes, among the Comparison with the m.8344A[G mutation other seven most frequent clinical features (see Table 1,in bold—significance level after Bonferroni’s correction: Table 4 shows the clinical features of our patients with the 0.0071) hearing loss (‘‘HL’’) was significantly associated m.3243A[G mutation compared with the subjects harboring the m.8344A[G ‘‘MERRF’’ mutation (the second most common encephalomyopathy-associated mtDNA muta- Table 2 Male gender is associated with stroke-like episodes in m.3243A[G carriers tion), which were recently reported [4]. Noteworthy, stroke-like episodes and diabetes (and to a lesser extent, ‘‘MELAS’’ ‘‘non-MELAS’’ Total hearing loss, migraine, and cognitive impairment) strongly Males 33 32 65 support the molecular diagnosis of the m.3243A[G Females 18 43 61 mutation, whereas multiple lipomatosis and less stringently 51 75 myoclonus and increased CK levels are all predictors of the m.8344A[G mutation. n = 126; P = 0.01856 (Fisher’s exact test)

Neuroradiological features Table 3 Diabetes and hearing loss are strictly associated in m.3243A[G carriers Recent (\5 years before the last examination) magnetic Diabetes: yes Diabetes: no Total resonance imaging (MRI) data were available for 84 patients with the m.3243A[G mutation. Scans were normal Hearing loss: yes 40 33 73 in eleven patients (13.1 %, signiﬁcantly different from the Hearing loss: no 11 42 53 58.8 % of m.8344A[G patients; [4], P = 0.01). 51 75 Stroke-like episodes were observed in 46/84 (54.8 %) n = 126; P = 0.000119 (Fisher’s exact test) m.3243A[G mutation carriers. Cortical (36/84, 42.9 %), 123 J Neurol

Table 4 Clinical features of the m.3243A[G(n = 126) and m.8344A[G(n = 39) carriers m.3243A[G m.8344A[G P 36.0 ± 26.7 years (%) 45.6 ± 15.3 years (%)

Hearing loss 73 (57.9) 12 (30.8) 0.0034 Generalized seizures 47 (37.3) 12 (30.8) n.s. Diabetes 51 (40.5) 4 (10.3) 0.0004 Ptosis/ophthalmoparesis 35 (27.8) 10 (25.6) n.s. Migraine 35 (27.8) 3 (7.7) 0.009 Stroke-like episodes 51 (40.5) 1 (2.6) 0.000001 Muscle weakness 50 (39.7) 20 (51.3) n.s. Exercise intolerance 41 (32.5) 15 (38.5) n.s. Heart disease 40 (31.7) 6 (15.4) n.s. Cognitive involvement 31 (24.6) 3 (7.7) 0.02 Increased CK 25 (19.8) 15 (38.5) 0.03 Muscle wasting 29 (23.0) 7 (17.9) n.s. Ataxia 25 (19.8) 8 (20.5) n.s. Myoclonus 8 (6.3) 8 (20.5) 0.02 Multiple lipomatosis 0 11 (28.2) \0.000001 The table shows only the clinical features present in C20 % of m.3243A[G and/or m.8344A[G patients. Significance levels after Bonferroni’s correction: P = 0.0033. Significant values are italicized, non-significant trends are in bold subcortical (18/84, 21.4 %) and cerebellar atrophy (20/84, P = 0.0034), meaning that subjects with earlier onset had 23.8 %) were also common. White matter abnormalities higher mutation levels in blood. No significant correlation were observed in 22/84 (26.2 %) patients and calcifications was observed with muscle and urinary levels (significance in 17/84 (20.2 %) patients. level after Bonferroni’s correction 0.017). Heteroplasmy levels could not predict stroke-like epi- Histological findings sodes; the same for other clinical signs such as hearing loss, diabetes, and PEO. Muscle biopsy findings were available for 65 patients. Ragged red fibers (RRFs) were present in 60 cases (92.3 %), COX-negative fibers in 53 (81.54 %). Lipid Discussion storage was noted in 22 biopsies (33.8 %). Strongly succinate dehydrogenase-reactive blood vessels (SSVs) were Our study presents a retrospective characterization of 126 seen in ten patients (15.4 %): five of them had a MELAS Italian carriers of the mtDNA m.3243A[G mutation. We phenotype whereas the other five did not have stroke-like showed that the m.3243A[G-associated phenotypes are a episodes (not significant). continuum from asymptomatic to lethal multisystem diseases; between these extremes lie all the possible expres- Heteroplasmy levels sivity degrees. Stroke-like episodes and diabetes (and, to a lesser Heteroplasmy levels of the m.3243A[G mutation were extent, hearing loss, migraine, and cognitive involvement) quantified in muscle tissue for 39 patients (mutation load support the molecular diagnosis of the m.3243A[G was on average 61.9 ± 18.6 %), in peripheral blood for 66 mutation, whereas multiple lipomatosis, and to a lesser patients (mutation load 27.0 ± 19.9 %), and in urinary extent myoclonus and high CK levels, were associated with sediment for 29 patients (mutation load 42.9 ± 27.7 %), the m.8344A[G mutation [4]. A normal MRI supports the being lower in blood than in muscle and urine (P \ 0.01). latter [4], whereas it is a rare finding in m.3243A[G Heteroplasmy levels in blood and urinary sediment were patients. directly correlated (q = 0.782, P \ 0.0001), whereas no Heteroplasmy levels could not predict stroke-like epi- significant correlation was observed between the levels in sodes nor other clinical features such as hearing loss, dia- muscle and/or urinary sediment (significance level after betes, and PEO. Subjects with earlier onset had higher Bonferroni’s correction 0.017). mutation levels in blood. Mutation levels were lower in A negative correlation was observed between age at blood than in muscle and urine, confirming that the latter two onset and mutation load in blood (q =-0.447, tissues are more useful for informative genetic analysis [5]. 123 J Neurol

An earlier revision [6] reported 111 published subjects, data were not specifically designed to explore associations with the following distribution for clue clinical features: between gender and phenotypes. myopathy 53 %; epilepsy 50 %; recurrent strokes 48 %; Here, we observed that hearing loss and diabetes were deafness 44 %; CPEO 28 %; dementia 27 %; ataxia 24 %; mutually associated with a high statistical significance. diabetes mellitus 15 %; pigmentary retinopathy 15 %; Therefore, the acronym MIDD may be useful to describe short stature 15 %; myoclonus 8 %; neuropathy 5 %; the strong association between hearing loss and diabetes in gastrointestinal involvement, cardiomyopathy, extrapyra- these patients. However, pure MIDD is very rare and this midal features 3 % each; lipomatosis 1 %; optic atrophy acronym should not be used in contrast to MELAS: in fact, 1 %. Our results partly diverge from these data. For hearing loss was associated with the presence of stroke-like instance, about 6 % of our m.3243A[G-positive subjects episodes and may be a clinical marker of multisystem were asymptomatic (mean age at last evaluation 28 years), impairment. PEO was associated with heart involvement and hearing loss and diabetes (two common clinical sig- and, less, with muscle weakness. Therefore, ‘‘MIDD’’ and natures of mitochondrial disorders) [5] were the most fre- ‘‘PEO’’ should not be considered reassuring phenotypic quent clinical features, followed by stroke-like episodes. labels, because in fact these patients may develop multi- As somehow expected, CNS involvement (and especially system complications. stroke-like episodes) could represent a negative prognostic Stroke-like episodes were present, at the mean age of factor, since it was a feature shared by the deceased 36 years, in about 40 % of our patients, who were therefore patients. Heart involvement occurred in more than 30 % of defined ‘‘MELAS’’. Stroke-like episodes were strongly cases, confirming the need for complete cardiac screening associated with generalized seizures, cognitive involve- in these patients. ment, and hearing loss; therefore, these features might be Three recent surveys are also available [1, 2, 7]. Ka- considered possible adjunctive manifestations of MELAS. uffman and coworkers studied 123 matrilineal relatives Lactate increase was associated with MELAS, confirming from 45 families, including 45 fully symptomatic patients the validity of the acronym. Heteroplasmy levels, muscle with MELAS and 78 carrier relatives. Mutation carriers’ histology (including the presence of SSVs), and other clinical and laboratory results were frequently abnormal, clinical features such as migraine could not predict stroke- confirming that the m.3243A[G mutation carriers have like episodes. There is strong need for a better under- multiple medical problems [2]. De Laat and coworkers [7] standing of the genetic background and environmental studied 34 m.3243A[G families, observing a wide variety factors influencing the clinical picture and the prognosis in of signs and symptoms, MIDD being far more prevalent mtDNA mutation carriers. than MELAS [7]. Finally, Nesbitt and coworkers [1] We observed, for the first time, that male gender could recently reported that 10 % of patients exhibited a classical represent a risk factor for the development of stroke-like MELAS phenotype, 30 % had MIDD, 6 % MELAS/ episodes in m.3243A[G patients in the Italian population. MIDD, 2 % MELAS/PEO and 5 % MIDD/PEO overlap Possible confounding factors (onset age, age at the last syndromes; 6 % had PEO and other features of mito- control, disease duration, heteroplasmy levels) were chondrial disease not consistent with another recognized excluded. Even if this finding must be confirmed by spe- syndrome, whereas isolated sensorineural hearing loss cifically designed longitudinal studies, gender effect is not occurred in 3 % of the cases [1]. Many patients harboring a new concept in mitochondrial medicine. The higher this mutation exhibited a clinical phenotype that did not prevalence of Leber hereditary optic neuropathy (LHON) fall within accepted criteria for the currently recognized in males is known [12]. This was recently ascribed to classical mitochondrial syndromes [1]; our data reinforce multilayer cytoprotective effects induced by estrogens, this concept. Furthermore, whereas the ‘‘MELAS’’ acro- which could reduce the production of reactive oxygen nym is convincing and useful to denote patients with his- species, restore membrane potential, limit apoptotic cell tological, biochemical, and/or molecular evidence of death, activate mitochondrial biogenesis, and improve mitochondrial disease who experience stroke-like episodes, energetic metabolism in LHON cybrids [12]. Estrogen pure MIDD and PEO are very rare in our cohort of patients receptor b is localized to the mitochondrial network of with the m.3243A[G mutation. human retinal ganglion cells with the unmyelinated portion Association analyses of the different clinical features of their axons in the retinal nerve fiber layer, and their were not attempted in the above considered studies [1, 2, 6, expression is retained in the surviving retinal ganglion cells 7], nor in other previous series [8–11]. Moreover, in order of patients with LHON [12]. Interestingly, in some to confirm our observation of male prevalence in MELAS, instances MELAS is also associated with point mutations we have tried to meta-analyze our data with those of the in ND subunits of complex I, as with LHON, and the large surveys mentioned above [1, 2, 6, 7]. Unfortunately, complex I defect seems to be a prevalent feature in this was not possible, because in those series the reported MELAS, as recently shown in induced pluripotent stem 123 J Neurol cells derived from fibroblasts carrying different hetero- 4. Mancuso M, Orsucci D, Angelini CI, Bertini E, Carelli V, Comi plasmic loads of m.3243A[G[13]. Noteworthy, in GP, Minetti C, Moggio M, Mongini T, Servidei S, Tonin P, Toscano A, Uziel G, Bruno C, Caldarazzo Ienco E, Filosto M, MELAS patients, the highest proportion of mutated Lamperti C, Martinelli D, Moroni I, Musumeci O, Pegoraro E, mtDNA was observed in the walls of the leptomeningeal Ronchi D, Santorelli FM, Sauchelli D, Scarpelli M, Sciacco M, and cortical blood vessels (in all brain regions), supporting Spinazzi M, Valentino ML, Vercelli L, Zeviani M, Siciliano G the hypothesis of vascular mitochondrial dysfunction in the (2013) Phenotypic heterogeneity of the 8344A[G mtDNA ‘‘MERRF’’ mutation. Neurology 80:2049–2054 pathogenesis of stroke-like episodes [14]. Estrogen recep- 5. Mancuso M, Orsucci D, Coppede F, Nesti C, Choub A, Siciliano tors have been localized to multiple cell types within the G (2009) Diagnostic approach to mitochondrial disorders: the CNS, including neurons, astrocytes, microglia, and endo- need for a reliable biomarker. Curr Mol Med 9:1095–1107 thelial cells [15]. Estrogens, particularly 17b-estradiol, are 6. Chinnery PF, Howell N, Lightowlers RN, Turnbull DM (1997) Molecular pathology of MELAS and MERRF. The relationship powerful neuroprotective agents in animal models of between mutation load and clinical phenotypes. Brain 120(Pt cerebral ischemia [15]. A better elucidation of the complex 10):1713–1721 network linking mitochondrial dysfunction, apoptosis, 7. de Laat P, Koene S, van den Heuvel LP, Rodenburg RJ, Janssen estrogen effects, and stroke-like episodes may hold prom- MC, Smeitink JA (2012) Clinical features and heteroplasmy in blood, urine and saliva in 34 Dutch families carrying the ises for a therapeutic use for estrogen-like molecules in this m.3243A[G mutation. J Inherit Metab Dis 35:1059–1069 devastating disorder. 8. Chae JH, Hwang H, Lim BC, Cheong HI, Hwang YS, Kim KJ (2004) Clinical features of A3243G mitochondrial tRNA muta- Acknowledgments This work was supported by Telethon (grant tion. Brain Dev 26:459–462 number GUP09004). The authors are grateful to the Italian patient 9. Jeppesen TD, Schwartz M, Frederiksen AL, Wibrand F, Olsen association ‘‘Mitocon’’ for the informatic support. The work of the DB, Vissing J (2006) Muscle phenotype and mutation load in 51 ‘‘Besta’’ group of Milan was supported by the Pierfranco and Luisa persons with the 3243A[G mitochondrial DNA mutation. Arch Mariani Foundation Italy, Ricerca 2000; Fondazione Giuseppe Neurol 63:1701–1706 Tomasello ONLUS and Fondazione Telethon-Italy grants GGP07019 10. Karppa M, Herva R, Moslemi AR, Oldfors A, Kakko S, Majamaa and GPP10005. The work of the University of Milan group was K (2005) Spectrum of myopathic findings in 50 patients with the supported by Associazione Amici del Centro Dino Ferrari, by the 3243A[G mutation in mitochondrial DNA. Brain 128:1861–1869 Telethon project GTB07001ER, and by a Telethon grant ‘‘Network of 11. Koga Y, Akita Y, Takane N, Sato Y, Kato H (2000) Heteroge- Genetic Biobanks’’ no GTB07001. neous presentation in A3243G mutation in the mitochondrial tRNA(Leu(UUR)) gene. Arch Dis Child 82:407–411 Conflicts of interest The authors declare no conflicts of interest. 12. Giordano C, Montopoli M, Perli E, Orlandi M, Fantin M, Ross- Cisneros FN, Caparrotta L, Martinuzzi A, Ragazzi E, Ghelli A, Sadun AA, d’Amati G, Carelli V (2011) Oestrogens ameliorate mitochondrial dysfunction in Leber’s hereditary optic neuropa- References thy. Brain 134:220–234 13. Ha¨ma¨laïnen RH, Manninen T, Koivuma¨ki H, Kislin M, Oto- 1. Nesbitt V, Pitceathly RD, Turnbull DM, Taylor RW, Sweeney nkoski T, Suomalainen A (2013) Tissue- and cell-type-specific MG, Mudanohwo EE, Rahman S, Hanna MG, McFarland R manifestations of heteroplasmic mtDNA 3243A[G mutation in (2013) The UK MRC mitochondrial disease patient cohort study: human induced pluripotent stem cell-derived disease model. Proc clinical phenotypes associated with the m.3243A[G mutation— Natl Acad Sci USA 110:E3622–E3630 implications for diagnosis and management. J Neurol Neurosurg 14. Betts J, Jaros E, Perry RH, Schaefer AM, Taylor RW, Abdel-All Psychiatry 84:936–938 Z, Lightowlers RN, Turnbull DM (2006) Molecular neuropa- 2. Kaufmann P, Engelstad K, Wei Y, Kulikova R, Oskoui M, Bat- thology of MELAS: level of heteroplasmy in individual neurones tista V, Koenigsberger DY, Pascual JM, Sano M, Hirano M, and evidence of extensive vascular involvement. Neuropathol DiMauro S, Shungu DC, Mao X, De Vivo DC (2009) Protean Appl Neurobiol 32:359–373 phenotypic features of the A3243G mitochondrial DNA mutation. 15. Schreihofer DA, Ma Y (2013) Estrogen receptors and ischemic Arch Neurol 66:85–91 neuroprotection: who, what, where, and when? Brain Res 3. Bernier FP, Boneh A, Dennett X, Chow CW, Cleary MA, 1514:107–122 Thorburn DR (2002) Diagnostic criteria for respiratory chain disorders in adults and children. Neurology 59:1406–1411

123 Phenotypic heterogeneity of the 8344A.G mtDNA “MERRF” mutation

Michelangelo Mancuso, ABSTRACT MD, PhD Objectives: Myoclonic epilepsy with ragged-red fibers (MERRF) is a rare mitochondrial syndrome, Daniele Orsucci, MD mostly caused by the 8344A.G mitochondrial DNA mutation. Most of the previous studies have Corrado Angelini, MD, been based on single case/family reports or series with few patients. The primary aim of this study PhD was the characterization of a large cohort of patients with the 8344A.G mutation. The second- Enrico Bertini, MD, PhD ary aim was revision of the previously published data. Valerio Carelli, MD, PhD Methods: Retrospective, database-based study (Nation-wide Italian Collaborative Network of Giacomo Pietro Comi, Mitochondrial Diseases) and systematic revision. MD Carlo Minetti, MD Results: Forty-two patients carrying the mutation were identified. The great majority did not have Maurizio Moggio, MD, full-blown MERRF syndrome. Myoclonus was present in 1 of 5 patients, whereas myopathic signs PhD and symptoms, generalized seizures, hearing loss, eyelid ptosis, and multiple lipomatosis repre- Tiziana Mongini, MD, sented the most common clinical features. Some asymptomatic mutation carriers have also been PhD observed. Myoclonus was more strictly associated with ataxia than generalized seizures in adult . Serenella Servidei, MD, 8344A G subjects. Considering all of the 321 patients so far available, including our dataset PhD and previously published cases, at the mean age of approximately 35 years, the clinical picture Paola Tonin, MD, PhD was characterized by the following signs/symptoms, in descending order: myoclonus, muscle – – Antonio Toscano, MD, weakness, ataxia (35% 45% of patients); generalized seizures, hearing loss (25% 34.9%); – PhD cognitive impairment, multiple lipomatosis, neuropathy, exercise intolerance (15% 24.9%); Graziella Uziel, MD, PhD and increased creatine kinase levels, ptosis/ophthalmoparesis, optic atrophy, cardiomyopathy, – Claudio Bruno, MD, muscle wasting, respiratory impairment, diabetes, muscle pain, tremor, migraine (5% 14.9%). PhD Conclusions: Our results showed higher clinical heterogeneity than commonly thought. Moreover, Elena Caldarazzo Ienco, MERRF could be better defined as a myoclonic ataxia rather than a myoclonic epilepsy. MD Neurologyâ 2013;80:2049–2054 Massimiliano Filosto, MD, PhD GLOSSARY Costanza Lamperti, MD CK 5 creatine kinase; MELAS 5 mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes; MERRF 5 myoclonic 5 Diego Martinelli, MD epilepsy with ragged-red fibers; mtDNA mitochondrial DNA. Isabella Moroni, MD Myoclonic epilepsy with ragged-red fibers (MERRF) is a mitochondrial syndrome, originally Olimpia Musumeci, MD 1 Elena Pegoraro, MD described in 1980 and mostly characterized by generalized seizures, myoclonus, and ataxia, with Dario Ronchi, PhD variable onset and associated with various mitochondrial DNA (mtDNA) point mutations, the Filippo Maria Santorelli, most frequent of which is the 8344A.G change in the gene encoding transfer RNA lysine.2 Early MD reports showed that the 8344A.G transition was highly correlated to the MERRF phenotype,3 Donato Sauchelli, MD although it can also be associated with other phenotypes, for instance Leigh disease, or myopathy Mauro Scarpelli, MD with truncal lipomas.4 The absence of the mutation in some typical MERRF patients suggested

Author list continued on next page

From the Neurological Clinic (M. Mancuso, D.O., E.C.I., G.S.), University of Pisa; Neurological Clinic (C.A., E.P., M. Spinazzi), University of Padova, and IRCCS S. Camillo, Venice; Bambino Gesù Hospital (E.B., D.M.), Rome; IRCCS Istituto di Scienze Neurologiche and Department of Biomedical and Neuromotor Sciences (V.C., M.L.V.), University of Bologna; Dino Ferrari Centre (G.P.C., D.R.), Neuroscience Section, Department of Pathophysiology and Transplantation (DEPT), University of Milan, Neurology Unit, IRCCS Foundation Ca’ Granda Ospedale Maggiore Policlinico, Milan; Neuropediatric and Muscle Disorders Unit (C.M., C.B.), University of Genoa and G. Gaslini Institute, Genoa; Neuromuscular Unit, Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico (M. Moggio, M. Sciacco), Milano, Dino Ferrari Centre University of Milan; Department of Neuroscience (T.M., L.V.), University of Turin; Institute of Neurology (S.S., D.S.), Catholic University, Rome; Neurological Clinic (P.T., M. Scarpelli), University of Verona; Department of Neurosciences (A.T., O.M.), University of Messina; Child Neurology Unit (G.U., I.M.) and Unit of Molecular Neurogenetics (C.L., M.Z.), The Foundation “Carlo Besta” Institute of Neurology–IRCCS, Milan; University Hospital Spedali Civili (M.F.), Neurological Clinic, Brescia; and IRCCS Stella Maris (F.M.S.), Pisa, Italy. Go to Neurology.org for full disclosures. Funding information and disclosures deemed relevant by the authors, if any, are provided at the end of the article.

© 2013 American Academy of Neurology 2049 ª"NFSJDBO"DBEFNZPG/FVSPMPHZ6OBVUIPSJ[FESFQSPEVDUJPOPGUIJTBSUJDMFJTQSPIJCJUFE Monica Sciacco, MD that other mutations may produce the same of 42 (52.4%) were male, and 15 of 42 patients Marco Spinazzi, MD phenotype,4 including the 8356T.C, which (35.7%) had childhood onset (younger than 16 years). Maria Lucia Valentino, also affects the transfer RNA lysine gene.5 Of note, among the 17 subjects without molecularly MD MERRF is very rare, as is the 8344A.G confirmed relatives, only 5 had a family history poten- Liliana Vercelli, MD tially indicative of mtDNA-related disease. mutation (,0.5/100,000, 4% of all pathogenic Massimo Zeviani, MD, The clinical picture was not available for 3 patients, mtDNA mutations).6,7 Therefore, most of the PhD who have not been considered in the following analysis. Gabriele Siciliano, MD, previous studies describing the clinical features Four of 39 subjects (10.3%) were asymptomatic muta- PhD of MERRF patients and/or subjects carrying tion carriers (age at last evaluation 37.0 6 9.9 years; the 8344A.Gmutationhavebeenbasedon range 26–50). Heteroplasmy levels of asymptomatic single case/family reports8 or case series with carriers were 56.7% 6 11.5% in blood and 55.8% 6 Correspondence to very few patients.9 Some early reviews of liter- 25.1% in urine, which were not different from the Dr. Mancuso: 10 symptomatic patients. [email protected] ature are also available, but recent data are lacking, and clinical heterogeneity is probably At the last evaluation, 38 of 39 subjects were adult higher than previously suspected.11 (older than 16 years). The cardinal clinical feature “ The primary aim of this study was the clin- of MERRF syndrome is deemed to be myoclonic epilepsy.”12 However, Fisher exact test revealed no Supplemental data at ical characterization of a cohort of mitochon- www.neurology.org . association between myoclonus and generalized seiz- drial patients with the 8344A G mutation, ures in the 38 adult 8344A.G mutation carriers with registered in the database of the Nation-wide known clinical picture; contrariwise, myoclonus and Italian Collaborative Network of Mitochon- cerebellar ataxia were associated (table 1). drial Diseases. The secondary aim was the The mean age at onset of the 35 symptomatic pa- thorough revision of previously reported clin- tients was 30.1 6 18.4 years (range 0–66; 11/35 with ical data about this mutation. clinical onset before age 16). Table e-1 summarizes the clinical features at onset. METHODS We reviewed the clinical, morphologic, and labo- . ratory features of all the A8344A G-positive cases contained in Disease progression. At the last evaluation, mean age the database of the Nation-wide Italian Collaborative Network of and disease duration were 45.6 6 15.3 years (range Mitochondrial Diseases. 5–72), and 21.6 6 15.3 years (range 2–59), respec- A systematic revision of previously reported data has also been performed. Individuals harboring the 8344A.G mutation were tively. A 5-year-old boy had a complex syndrome identified through a PubMed search of the scientific literature characterized by consciousness disturbance, cognitive (September 2012). Additional articles were identified in other impairment, pyramidal signs, tremor, swallowing databases such as OMIM (http://www.ncbi.nlm.nih.gov/omim) impairment, lactic acidosis, facial dysmorphism, and and MITOMAP (http://www.mitomap.org). Studies with an cataract. The clinical features of the 34 adult patients incomplete clinical description, as well as those reporting Italian are summarized in the figure and described below. patients who could be included in our cohort, were excluded. Through this approach, we identified 75 articles (shown in the e-references on the Neurology® Web site at www.neurology.org). Data were expressed as means 6 SD. The numeric data were Table 1 Is myoclonus associated with epileptic seizure and/or ataxia in 8344A>G compared by unpaired 2-tailed Student t test, or correlated by adult carriers? Spearman rank correlation test; proportions were compared using the x2 test. Categorical data were associated by means of the Fisher Myoclonus: Myoclonus: exact test. Bonferroni correction for multiple tests was utilized when no (n 5 31) yes (n 5 7) Total appropriate. A p value ,0.05 was considered as significant. Data Seizuresa analysis was performed using MedCalc version 7.3.0.1. No 23 3 26 Standard protocol approvals, registrations, and patient consents. The establishment of the database, and its use for scien- Yes 84 12 tific purposes, was approved by the local ethical committees of all Ataxiab the involved centers, which obtained written consent from each No 27 3 30 patient, in accordance with the ethical standards of the 1964 Dec- laration of Helsinki. Yes 44 8

a RESULTS The 8344A>G mutation in our database. A No association between myoclonus and epilepsy in adult . . subjects with the 8344A G mutation (including asymp- total of 42 patients harboring the 8344A Gmutation tomatic subjects). Total n 5 38, p 5 0.176 (Fisher exact (25 patients from 10 families and 17 other subjects) test), which is not significant (significance level 0.025 after were identified among the 1,086 mitochondrial pa- Bonferroni correction). b tients (3.9%) present in our database (May 1, 2012). Relationship between myoclonus and ataxia in adult subjects with the 8344A.G mutation. Total n 5 38, p 5 They represented the 12.4% (42/340) of all indi- 0.0245 (Fisher exact test), which is significant after the viduals with mtDNA point mutations. Twenty-two correction (significance level 0.025).

2050 Neurology 80 May 28, 2013 ª"NFSJDBO"DBEFNZPG/FVSPMPHZ6OBVUIPSJ[FESFQSPEVDUJPOPGUIJTBSUJDMFJTQSPIJCJUFE pain 6/34 (17.6%), cardiomyopathy with arrhythmia Figure Clinical features of the symptomatic 8344A>G patients older than 16 years 4/34 (11.8%), arrhythmia without cardiomyopathy when evaluated 2/34 (5.9%), peripheral neuropathy 5/34 (14.7%), swallowing impairment 1/34 (2.9%), and respiratory (ventilatory) impairment 1/34 (2.9%). Neither age at onset, age at last evaluation, nor disease duration significantly differed between patients with or without clinically evident myopathic involvement. Moreover, at the last clinical evaluation, 12/34 patients had hearing loss (35.3%), 4/34 diabetes mellitus (11.8%), 3/34 migraine (8.8%), 2/34 hypothyroidism (5.9%), 1/34 cataract, 1/34 isolated hypogonadism, 1/34 psychiatric involvement, and 1/34 gastrointestinal dysmotility (2.9% each). Some patients with mild phenotypes were reported, including a 50-year-old patient with eyelid ptosis, 2 63- and 28-year-old subjects with isolated multiple lipomatosis, and a 27-year-old patient with isolated hypogonadism. Four patients, all with CNS involvement (including generalized seizures in all cases and myoclonus in 2 cases), are deceased (mean age 37.5 6 18.5 years, range 20–54; disease duration 9.8 6 4.6 years, range 5–15) because of heart failure (2 cases), respiratory failure, or intractable lactic acidosis (1 case each). Basal lactate levels were increased in 65.0% of the cases, but neither CNS involvement nor other clinical features, including age at onset, were related to this laboratory marker.

The 8344A>G mutation: Neurodiagnostic features. Recent (,5 years before the last examination) MRI data were available for 17 patients with the 8344A.Gmuta- tion, and were normal in 10 (58.8%). White matter For details, see text. CK 5 creatine kinase; imp 5 impair- abnormalities were present in 4 of 17 patients (23.5%), ment; intol 5 intolerance. one of whom had no clinically evident CNS involvement; 2 patients also had cortical/subcortical atrophy. Multiple lipomatosis was present in 11 of 34 patients Other MRI findings included periaqueductal lesions, (32.4%), only 2 of whom had isolated lipomatosis with cysts or vacuolated lesions, brainstem atrophy, and no myopathic complaints (6 cases) and/or CNS involve- stroke-like lesions (1/17 [5.9%] each). No definitive ment (5 cases). Of the 4 patients with isolated lipomato- data regarding proton spectroscopy MRI are available. sis at onset, 2 developed myopathy but none had CNS symptoms (mean follow-up 20.0 years, range 3–48). The 8344A>G mutation: Histologic findings. Muscle Nineteen of 34 patients (55.9%) showed clinical biopsy findings were available for 27 patients. Ragged- CNS involvement at the last evaluation (generalized seiz- red fibers were present in 26 patients (96.3%), including ures 12/34 [35.3%], cerebellar ataxia 8/34 [23.5%], 4 patients with no clinically evident myopathic involve- myoclonus 8/34 [23.5%], cognitive involvement 2/34 ment (one of whom was last seen at age 37). Cytochrome [5.9%], stroke-like episodes 1/34 [2.9%]). Fourteen of c oxidase-negative fibers were present in 20 cases these 19 patients also had myopathic complaints. Nei- (74.1%), but failed to predict neuromuscular involve- ther age at onset, age at last evaluation, nor disease dura- ment. Lipid storage was noted in 5 biopsies (18.5%), tion could predict the development of CNS symptoms. and was neither associated with multiple lipomatosis nor Signs and symptoms of neuromuscular dysfunction with other clinical features. Strongly succinate dehydro- were present in 26 of 34 patients (76.5%): muscle weak- genase-reactive blood vessels, more typical of MELAS ness 20/34 (58.8%), exercise intolerance 15/34 (44.1%), (mitochondrial encephalomyopathy, lactic acidosis, and increased creatine kinase (CK) levels 15/34 (44.1%), stroke-like episodes) syndrome, were found in one eyelid ptosis 10/34 (29.4%) with ophthalmoparesis in 8344A.G patient with myopathy, eyelid ptosis, and 2 cases (5.9%), muscle wasting 7/34 (20.6%), muscle migraine, but not in the patient with stroke-like episodes.

Neurology 80 May 28, 2013 2051 ª"NFSJDBO"DBEFNZPG/FVSPMPHZ6OBVUIPSJ[FESFQSPEVDUJPOPGUIJTBSUJDMFJTQSPIJCJUFE Heteroplasmy levels. Heteroplasmy levels of the with the following distribution for clue clinical features: 8344A.G were available in muscle for 22 patients recurrent strokes 1%, ophthalmoparesis 6%, diabetes (mutation load 67.0% 6 16.1%), in blood for 16 mellitus 3%, deafness 39%, dementia 25%, epilepsy patients (mutation load 57.6% 6 16.1%), and in 43%, myopathy 70%, lipomatosis 8%, optic atrophy urinary sediment for 11 patients (mutation load 13%, neuropathy 24%, ataxia 50%, and myoclonus 59.4% 6 16.3%). No correlation was observed 61%. Our results partly diverge from these data. For between these levels and age at onset. The hetero- instance, 10% of our 8344A.G-positive subjects were plasmy levels in muscle, blood, and urinary sediment asymptomatic (mean age at last evaluation 37 years), were not mutually related, but a positive trend was and myoclonus, which was deemed as the most fre- obtained by comparing the levels in blood and uri- quent feature (61%),10 was only about 20% in our nary sediment (r 5 0.734, p 5 0.052 [significance series. Other “typical” features, such as ataxia and gen- level after Bonferroni correction 0.017]). eralized epileptic seizures, were found in approximately Only a nonsignificant trend was obtained by asso- 20% and 30% in our cases. Generalized epilepsy seems ciating clinically evident myopathic involvement and to be a negative prognostic factor because it was a fea- muscle mutation load (69.6% 6 15.0% in 17 patients ture common to our 4 deceased patients. The frequency with clinical myopathy vs 58.0% 6 17.9% in 5 pa- of cognitive impairment and stroke-like episodes was tients without clinically evident myopathy [p 5 0.16]). lower in our series than in previous studies. Clinically evident myopathy was previously reported Systematic revision of the literature. Table e-2 shows the in approximately 70% of 8344A.G carriers,10 and this clinical data of our 39 mutation carriers with known was confirmed in our study. The most common fea- clinical features, as well as those of 282 previously tures were muscle weakness, exercise intolerance, and, reported 8344A.G-positive individuals (male/female unexpectedly, increased CK levels, which is different ratio 0.85; mean age at the last evaluation 34.2 6 19.1 from what is commonly thought for the great majority years) (see e-references). The asymptomatic subjects of mitochondrial diseases.13 Eyelid ptosis occurred in were included for both groups. 25% of our cases, whereas ophthalmoparesis was rarer Considering all 321 patients so far available, includ- (5%). Heart involvement occurred in about 15% of ing our dataset and previously published cases, at the cases, confirming the need for complete cardiac screen- mean age of approximately 35 years, the clinical picture ing in these patients. Peripheral neuropathy was less was characterized by the following signs/symptoms, in frequent in our cohort (,15%) than previously descending order: myoclonus, muscle weakness, ataxia observed for the 8344A.Gmutations10 or for other (35%–45% of patients); generalized seizures, hearing loss mitochondrial diseases.14,15 Multiple lipomatosis was (25%–34.9%); cognitive impairment, multiple lipoma- common (30%) in our cohort, far more than previ- tosis, neuropathy, exercise intolerance (15%–24.9%); ously reported,10 as were hearing loss and diabetes and increased CK levels, ptosis/ophthalmoparesis, optic mellitus, 2 common clinical signatures of mitochon- atrophy, cardiomyopathy, muscle wasting, respiratory drial multisystemic disorders.13 impairment, diabetes, muscle pain, tremor, migraine The MERRF acronym suggests that myoclonus and (5%–14.9%). epilepsy are tightly associated, occurring together in the Increased CK levels and exercise intolerance were same individual in most of the cases.12 However, in our more frequently reported in our patients than in the adult 8344A.G carriers “myoclonus” was more fre- published cases (p , 0.0001 and p , 0.0005, respec- quently linked to “ataxia” than to “generalized seizures,” tively). However, in the great majority of the previous supporting the idea that the cerebellum may have an reports, CK was only mentioned when increased, but it important role in the genesis of cortical reflex myoclo- is unclear in how many cases this test was performed nus.16 Of note, Purkinje cells and neurons of the den- and found normal or was not performed at all. More- tate nucleus and inferior olivary nuclei seem to have a over, exercise intolerance is a subtle symptom that special vulnerability to the effects of the A8344A.G could be missed if not specifically assessed. Again, it mutation (and to POLG mutations)17 as compared with is unclear whether this sign was systematically searched other mtDNA mutations (i.e., 3243A.G).17 Based on for in the previous studies. Ataxia and myoclonus were our results, MERRF could be better defined as a myo- less frequent in our own series (p , 0.005). clonic ataxia16 rather than a myoclonic epilepsy. This conclusion could not be reached in previous studies DISCUSSION We present here a retrospective study because the clinical picture of each and every case was on 42 8344A.G carriers registered in the Italian not available in each and every report. Furthermore, in nationwide database of mitochondrial disease patients. some cases the clinical features were unclear; for in- Although most of the previous studies were based on stance, the term myoclonic epilepsy can be confounding single or small series of cases/families,8,9 an early system- if a detailed clinical description is missing (i.e., gener- atic literature revision10 reported 55 published subjects, alized seizures are present or not, etc.).

2052 Neurology 80 May 28, 2013 ª"NFSJDBO"DBEFNZPG/FVSPMPHZ6OBVUIPSJ[FESFQSPEVDUJPOPGUIJTBSUJDMFJTQSPIJCJUFE Table 2 Suggested follow-up scheme for the 8344A>G patients

Time interval between assessments

Neurologic examination with CK and lactate 6mo

Cardiologic evaluation with echocardiography and ECG 12 mo (or 3–6 mo after the development of heart disease)

Ophthalmologic evaluation with fundoscopy 18 mo (or less in symptomatic patients)

Respiratory function tests 24 mo (or 3–6 mo after the development of respiratory involvement)

Swallowing evaluation 24 mo (or 6 mo after the development of swallowing impairment)

Thyroid hormones, glucose, liver and kidney function, 24–36 mo (or less in some instances, e.g., treatment with new complete blood count antiepileptic drugs)

Audiologic assessment 24–36 mo (or less in symptomatic patients)

Psychiatric evaluation 24–36 mo (or less in patients with clinically apparent psychiatric involvement)

Neuropsychological tests 36–48 mo (or less in patients with clinically apparent cognitive impairment)

We failed to find clear predictive factors, including more than with generalized epilepsy, so that the MERRF age at onset, disease duration, age at last evaluation, lac- acronym could well be replaced by MARRF. Although tate levels, biopsy findings, or heteroplasmy levels, for larger prospective studies are needed to obtain a complete the development of CNS or myopathic symptoms and picture of the natural history of this disease, the data signs in our cohort, possibly reflecting the well-known presented in table e-2 led us to propose a new flowchart variability of the mtDNA-related diseases. Further- for the follow-up of 8344A.Gpatients(table2). more, heteroplasmy levels of asymptomatic carriers were not significantly different from the symptomatic AUTHOR CONTRIBUTIONS patients. This on one hand precluded further analysis All the authors made substantive intellectual contributions to the data- (e.g., threshold estimates), and on the other highlights base development, data collection, and interpretation. the strong need for a better understanding of the ACKNOWLEDGMENT genetic background and environmental factors capable The authors are grateful to the Italian patient association Mitocon for the of influencing the clinical picture and the prognosis in informatic support. The work of the Besta group of Milan was supported mtDNA mutation carriers. Useful biomarkers by the Pierfranco and Luisa Mariani Foundation Italy, Ricerca 2000; Fon- are strongly needed as well.13 Ragged-red fibers were dazione Giuseppe Tomasello ONLUS and Fondazione Telethon–Italy present in most of our patients as were cytochrome c grants GGP07019 and GPP10005. The work of the group of University of Milan was supported by Associazione Amici del Centro Dino Ferrari, by oxidase-negative fibers. Lipid storage was not associated the Telethon project GTB07001ER, and by a Telethon grant “Network of with multiple lipomatosis, disproving the idea that pro- Genetic Biobanks” no. GTB07001. liferation of adipose tissue and lipid storage myopathy are correlated.18 Therewasonlyanonsignificanttrend STUDY FUNDING for the association between clinically evident myopathic This work was supported by Telethon (grant GUP09004). involvement and muscle mutation load. Importantly, differently from what has been previously reported in a DISCLOSURE series of 9 patients,19 muscle and blood heteroplasmy The authors report no disclosures relevant to the manuscript. Go to Neurology.org for full disclosures. levels did not correlate. Herein we showed that 8344A.Gphenotypes Received December 10, 2012. Accepted in final form February 15, 2013. are a continuum from asymptomatic to lethal multisystem diseases; between these extremes there are REFERENCES all the possible expressivity degrees. This multicenter 1. FukuharaN,TokiguchiS,ShirakawaK,TsubakiT.Myoc- lonus epilepsy associated with ragged-red fibres (mitochon- study provides new information about clinical phe- drial abnormalities): disease entity or a syndrome? Light- and . notype, natural history, and outcome of 8344A G electron-microscopic studies of two cases and review of liter- carriers that can be useful in their counseling. Inter- ature. J Neurol Sci 1980;47:117–133. estingly, the majority of our patients (approximately 2. Noer AS, Sudoyo H, Lertrit P, et al. A tRNA(Lys) muta- 80%) did not show a full-blown MERRF clinical tion in the mtDNA is the causal genetic lesion underlying picture. Myoclonus was present in 1 of 5 patients, myoclonic epilepsy and ragged-red fiber (MERRF) syndrome. Am J Hum Genet 1991;49:715–722. whereas common clinical features included myopathic 3. Shoffner JM, Lott MT, Lezza AM, Seibel P, Ballinger SW, signs and symptoms, generalized seizures, hearing loss, Wallace DC. Myoclonic epilepsy and ragged-red fiber disease eyelid ptosis, and multiple lipomatosis. Interestingly, (MERRF) is associated with a mitochondrial DNA tRNA in adult patients, myoclonus was linked with ataxia (Lys) mutation. Cell 1990;61:931–937.

Neurology 80 May 28, 2013 2053 ª"NFSJDBO"DBEFNZPG/FVSPMPHZ6OBVUIPSJ[FESFQSPEVDUJPOPGUIJTBSUJDMFJTQSPIJCJUFE 4. Silvestri G, Ciafaloni E, Santorelli FM, et al. Clinical fea- ragged-red fiber disease point mutation in mitochondrial tures associated with the A/G transition at nucleotide DNA. Ann Neurol 1993;33:640–645. 8344 of mtDNA (“MERRF mutation”). Neurology 1993; 12. DiMauro S, Hirano M, Kaufmann P, et al. Clinical fea- 43:1200–1206. tures and genetics of myoclonic epilepsy with ragged red 5. Silvestri G, Moraes CT, Shanske S, Oh SJ, DiMauro S. A fibers. Adv Neurol 2002;89:217–229. new mtDNA mutation in the tRNA(Lys) gene associated 13. Mancuso M, Orsucci D, Coppede F, Nesti C, Choub A, with myoclonic epilepsy and ragged-red fibers (MERRF). Siciliano G. Diagnostic approach to mitochondrial disorders: Am J Hum Genet 1992;51:1213–1217. the need for a reliable biomarker. Curr Mol Med 2009;9: 6. Remes AM, Karppa M, Moilanen JS, et al. Epidemiology of 1095–1107. the mitochondrial DNA 8344A.G mutation for the myoc- 14. Girlanda P, Toscano A, Nicolosi C, et al. Electrophysiological lonus epilepsy and ragged red fibres (MERRF) syndrome. study of neuromuscular system involvement in mitochondrial J Neurol Neurosurg Psychiatry 2003;74:1158–1159. cytopathy. Clin Neurophysiol 1999;110:1284–1289. 7. Schaefer AM, McFarland R, Blakely EL, et al. Prevalence of 15. Mancuso M, Piazza S, Volpi L, et al. Nerve and muscle mitochondrial DNA disease in adults. Ann Neurol 2008;63: involvement in mitochondrial disorders: an electrophysio- 35–39. logical study. Neurol Sci 2012;33:449–452. 8. Wiedemann FR, Bartels C, Kirches E, Mawrin C, 16. Shibasaki H, Thompson PD. Milestones in myoclonus. Wallesch CW. Unusual presentations of patients with Mov Disord 2011;26:1142–1148. the mitochondrial MERRF mutation A8344G. Clin Neu- 17. Lax NZ, Hepplewhite PD, Reeve AK, et al. Cerebellar rol Neurosurg 2008;110:859–863. ataxia in patients with mitochondrial DNA disease: a molec- 9. Lorenzoni PJ, Scola RH, Kay CS, Arndt RC, Silvado CE, ular clinicopathological study. J Neuropathol Exp Neurol Werneck LC. MERRF: clinical features, muscle biopsy 2012;71:148–161. and molecular genetics in Brazilian patients. Mitochon- 18. Munoz-Malaga A, Bautista J, Salazar JA, et al. Lipomatosis, drion 2011;11:528–532. proximal myopathy, and the mitochondrial 8344 mutation: 10. Chinnery PF, Howell N, Lightowlers RN, Turnbull DM. a lipid storage myopathy? Muscle Nerve 2000;23:538–542. Molecular pathology of MELAS and MERRF: the rela- 19. Larsson NG, Tulinius MH, Holme E, et al. Segregation tionship between mutation load and clinical phenotypes. and manifestations of the mtDNA tRNA(Lys) A/G Brain 1997;120(pt 10):1713–1721. (8344) mutation of myoclonus epilepsy and ragged-red 11. Graf WD, Sumi SM, Copass MK, et al. Phenotypic het- fibers (MERRF) syndrome. Am J Hum Genet 1992;51: erogeneity in families with the myoclonic epilepsy and 1201–1212.

Neurology® Launches Subspecialty Alerts by E-mail! Customize your online journal experience by signing up for e-mail alerts related to your subspecialty or area of interest. Access this free service by visiting http://www.neurology.org/site/subscriptions/ etoc.xhtml or click on the “E-mail Alerts” link on the home page. An extensive list of subspecialties, methods, and study design choices will be available for you to choose from—allowing you priority alerts to cutting-edge research in your field!

Commenting Online is Easier Now with WriteClick™ HaveacommentonarecentNeurology® article you would like to share? Now it is easier and more convenient. Neurology.org has launched WriteClick on the home page and sidebars of each article to encourage remarks and debate among users.

WriteClick is restricted to comments about studies published in Neurology within the last eight weeks.

Learn more at http://www.neurology.org/letters

2054 Neurology 80 May 28, 2013 ª"NFSJDBO"DBEFNZPG/FVSPMPHZ6OBVUIPSJ[FESFQSPEVDUJPOPGUIJTBSUJDMFJTQSPIJCJUFE REVIEWS

DISEASE MECHANISMS Human mitochondrial DNA: roles of inherited and somatic mutations

Eric A. Schon1,2, Salvatore DiMauro1 and Michio Hirano1 Abstract | Mutations in the human mitochondrial genome are known to cause an array of diverse disorders, most of which are maternally inherited, and all of which are associated with defects in oxidative energy metabolism. It is now emerging that somatic mutations in mitochondrial DNA (mtDNA) are also linked to other complex traits, including neurodegenerative diseases, ageing and cancer. Here we discuss insights into the roles of mtDNA mutations in a wide variety of diseases, highlighting the interesting genetic characteristics of the mitochondrial genome and challenges in studying its contribution to pathogenesis.

Microarray-based Mitochondria — from the Greek mitos (thread-like) escalating pace initially on the basis of linkage analysis sequencing and khondros (grain or granule) — are bacterium-sized and homozygosity mapping, then on monochromosomal DNA sequencing based on the organelles found in all nucleated cells. They have a myr- transfer techniques, gene complementation studies and ability of the target DNA to iad of functions, but it is fair to say that what sets them sequencing of candidate genes, and more recently hybridize to an ordered set of defined oligonucleotides apart is their role in energy production. To reiterate an on scanning entire patient genomes through whole- 3 immobilized on a chip. oft-used cliché, mitochondria are the ‘powerhouses exome sequencing . These studies have revealed that of the cell’ because they generate more than 90% of a mitochondrial disorders can result from mutations Monochromosomal transfer typical cell’s ATP, which is the ‘energy currency’ of the not only in genes encoding subunits of the OXPHOS Typically, the transfer cell. Mitochondria contain their own DNA (mitochon- complexes but also in genes required for their trans- of individual human chromosomes (or parts drial DNA (mtDNA)), which is linked to their origin lation and assembly, for providing the proper lipid 1 of chromosomes) to rodent as eukaryotic endosymbionts . Unlike nuclear DNA milieu and for determining the spatial and temporal cells in order to identify and (nDNA), mtDNAs are maternally inherited and are relationships of the organelles to their subcellular envi- map human genes responsible present in multiple copies per cell; the number varies ronment (‘mitodynamics’). However, as mtDNA muta- for disease. according to the bioenergetic needs of each particular tions are now being linked to several complex traits, we Mitodynamics tissue and can range over three orders of magnitude, need to improve our understanding of mitochondrial The morphological properties depending on the cell type2. As such, mitochondrial dis- genetics at the same time as learning more about the of mitochondria (for example, eases caused by mutations in mtDNA follow the laws of nuclear genome. fusion, fission, distribution, population genetics. This is a crucial distinction from In addition to being of interest to scientists, mtDNA- anchorage, positioning). These properties can change both in diseases that follow Mendelian genetics and underlies related diseases may pose a public health concern. space and in time within cells. many of the unique, and often perplexing, features of Epidemiological studies of mtDNA mutations in adults these disorders. have shown a minimum prevalence of approximately Over the past 25 years, the identification of patho- 1 in 5,000, making mitochondrial diseases among the 1Department of Neurology, genic mtDNA mutations has evolved in parallel with most common genetic disorders and a major burden for Columbia University Medical advances in sequencing and cell biology technologies. society4. Center, 630 West 168th The first decade was mainly devoted to identifying There have been several recent excellent reviews Street, New York, New York 5–7 10032, USA. new pathogenic mutations associated with various describing the role of mtDNA mutations in disease , 2Department of Genetics and syndromes (BOX 1) using standard sequencing tech- and so we discuss primary pathogenic mtDNA mutations Development, Columbia niques. This effort, which is now based on automated only in broad outline to demonstrate some of the University Medical Center, microarray-based sequencing and high-throughput unique aspects of mitochondrial genetics and func- 701 West 168th Street, New sequencing strategies, was aided enormously by the tion. We focus on more speculative roles of mtDNA York, New York 10032, USA. (BOX 2) Correspondence to E.A.S. use of cybrid technology . Beginning in 1995, mutations — both germline and somatic — in complex e‑mail: [email protected] mutations in nuclear genes affecting oxidative phos- phenotypes, such as ageing, neurodegenerative diseases doi:10.1038/nrg3275 phorylation (OXPHOS) function were identified at an and cancer.

878 | DECEMBER 2012 | VOLUME 13 www.nature.com/reviews/genetics

Primary pathogenic mtDNA Mitochondrial function and dysfunction resulting in respiratory chain deficiency can arise from 9 mutations The human mitochondrial genome is a tiny 16.6 kb circle mutations in either genome . In addition to these struc- Mutations that can containing only 37 genes: 13 of these genes encode pro- tural subunits, there are more than 50 nDNA-encoded compromise OXPHOS function teins and the remaining 24 — consisting of 2 ribosomal ancillary gene products required for the proper assem- and cause disease. They arise (FIG. 1b) in mtDNA through processes RNAs (rRNAs) and 22 tRNAs — are used for transla- bly and functioning of the OXPHOS system . 8 such as random errors during tion of those 13 polypeptides (FIG. 1a). Remarkably, all 13 Although mitochondrial OXPHOS disorders are quite normal mtDNA replication. polypeptides are components of a single metabolic entity: varied, they typically display a number of ‘canonical’ the OXPHOS system (FIG. 1b). Pathogenic mutations biochemical and morphological features (BOX 3).

Box 1 | Primary mitochondrial DNA-related diseases Leber’s hereditary optic neuropathy (LHON). This is the most common which is a key signalling molecule for vasoconstriction (via the conversion mitochondrial DNA (mtDNA)-related disorder, causing subacute loss of of l‑arginine to NO by nitric oxide synthase and the subsequent binding of central vision in young adults, predominantly men. LHON is usually due to NO to soluble guanylate cyclase129), it could be that in MELAS (but not in homoplasmic mutations in one of three genes encoding complex I subunits MERRF), NO is titrated out by supernormal levels of COX after a (m.11778G→A in NADH dehydrogenase 4 (ND4), m.3460G→A in ND1 and NO‑mediated signal to dilate blood vessels. This could thereby prevent m.14484T→C in ND6). Although mutations are predominantly homoplasmic, vasodilation and precipitate the strokes126. If this possibility is true, agents the retinal ganglion cells are affected selectively. The marked predominance that increase compensatory NO levels to allow more normal vasodilation of LHON in men, which is not accounted for by differences in mitochondrial might be of therapeutic value. Indeed, treatment of patients with MELAS genetics between the sexes, has been attributed to the relative abundance with l‑arginine has been reported to mitigate the frequency and severity of of oestrogen receptors120 and may be the first example of the role of strokes in this disorder130. epigenetics in the expression of mtDNA-related diseases. Neuropathy, ataxia and retinitis pigmentosa, and maternally inherited Leigh’s syndrome. This disease is more commonly due to nuclear DNA Leigh’s syndrome (NARP and MILS, respectively). These are two possible (nDNA) mutations than to mtDNA mutations. The mutations are most clinical outcomes of mutations at the same nucleotide (m.8993T→G or, less frequently in subunits of complex I or in assembly factors of complex IV. frequently, m.8993T→C). In the family in which these were originally Despite the striking variety of specific aetiologies, Leigh’s syndrome has identified, three adults had one or more of the acronymic features, whereas common clinical features (developmental delay or regression, respiratory a maternally related child had severe developmental delay, pyramidal signs, abnormalities, recurrent vomiting, nystagmus, ataxia, dystonia and early retinitis pigmentosa, ataxia and cerebellar and brainstem atrophy, features death) and characteristic radiological changes (bilateral symmetrical that are characteristic of Leigh’s syndrome. We now know that onset and lesions affecting mostly basal ganglia and the brainstem), a reflection of severity depend on the mutation load: patients with NARP harbour ~70% the devastating effects of energy shortage on the developing nervous mutant mtDNAs, whereas those with MILS harbour >90%. system. Reversible respiratory chain deficiency. Although it is rare, mutation in Mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes another tRNA — a homoplasmic m.14674T→C mutation in the discriminator (MELAS). This is a multisystem disorder in which brain, muscle and the base of tRNAGlu — deserves to be mentioned. This mutation causes a highly endocrine system are predominantly involved and is often fatal in childhood unusual disorder, namely a ‘reversible’ form of OXPHOS deficiency in which or in young adulthood121. Unique to MELAS are the transient eponymous infants are severely ill but, if sustained vigorously during the perinatal stroke-like episodes, which are most often due to infarcts in the temporal period, recover full mitochondrial function spontaneously within 2 years131. and occipital lobes and are associated with hemiplegia and cortical Interestingly, the disease can also be caused by mutations in TRMU132, a blindness. Although we still do not understand the cause, their occurrence nucleus-encoded mitochondrial protein that catalyses the 2‑thiolation of highlights the fact that MELAS is also an angiopathy, making it almost uridine at the wobble position of three mt-tRNAs133, including tRNAGlu. unique among the mitochondrial diseases122. Although the most common These mutations may also modify the expression of a deafness-associated causal mutation is m.3243A→G in tRNALeu(UUR), more than a dozen other mutation at nucleotide 1,555 in 12S ribosomal RNA134. mutations have been associated with MELAS, affecting both tRNA and Sporadic deletions of mtDNA. Kearns–Sayre syndrome (KSS)25 is defined by protein-coding genes. the onset before age 20 of ophthalmoplegia (that is, paralysis of the muscles Myoclonus epilepsy and ragged red fibres (MERRF). For unknown reasons, that move the eyeballs), ptosis (that is, droopy eyelids), pigmentary MERRF is due almost exclusively to mutations in tRNALys. It is associated retinopathy and at least one of the following: complete heart block, with a rather different set of signs and symptoms from the other diseases, cerebrospinal fluid protein levels above 100 mg dL–1 and cerebellar ataxia. often including cervical lipomas as well as myoclonus and epilepsy123. As in In this multisystemic disorder, partially deleted mtDNAs (Δ‑mtDNAs) are MELAS, the pathogenic cause seems to be a post-transcriptional failure to present in all examined tissues (implying that the deletion event occurred modify the tRNAs with taurine, thereby affecting translational efficiency124. in the germ line or soon after fertilization). In chronic progressive external Moreover, in MERRF and MELAS, there is mitochondrial proliferation not ophthalmoplegia (CPEO)26 — a myopathy with the defining features only in muscle (that is, the ragged red fibres (RRFs)) but also in blood vessels of ophthalmoplegia and ptosis — Δ‑mtDNAs are found only in muscle (strongly SDH-positive vessels (SSVs))125. Although blood vessel involvement (implying that the deletion event occurred after fertilization in the can be found in patients with both disorders, angiopathy is less prevalent in muscle lineage of mesoderm). In Pearson’s syndrome27, which is MERRF. Interestingly, both the RRFs and SSVs in MERRF are negative for characterized by sideroblastic anaemia and exocrine pancreas dysfunction, cytochrome c oxidase (COX) histochemical activity, whereas those in Δ‑mtDNAs are initially abundant in haematopoietic cells. Fascinatingly, MELAS are typically COX-positive125,126 (BOX 3). Herein lies a paradox: why patients with Pearson’s syndrome who survive their anaemia often develop is it that MERRF, which has COX-negative SSVs, is not primarily an KSS as teenagers: as the Δ‑mtDNA load declines in blood (a rapidly dividing angiopathy, whereas MELAS, which has ostensibly ‘more normal’ tissue), the Δ‑mtDNA load increases in more terminally differentiated tissues COX-positive SSVs, is an angiopathy? One possible explanation is that it (for example, in the muscles or brain). This phenomenon demonstrates two is the COX positivity that triggers the stroke-like episodes in MELAS, other features of mitochondrial genetics: namely, the different thresholds because the absolute amount of COX in these mitochondria-laden SSVs is for dysfunction in various tissues and the autonomy of mitochondrial far greater than normal126. As COX is known to bind nitric oxide (NO)127,128, division (and mtDNA replication) even within terminally differentiated cells.

NATURE REVIEWS | GENETICS VOLUME 13 | DECEMBER 2012 | 879

Pathogenic mtDNA mutations: distribution and have been described, affecting every mtDNA gene threshold effects. Primary mtDNA-related diseases may (examples are provided in TABLE 1). Remarkably, more be defined as those disorders that arise directly from a than half of these mutations are located in tRNA mutation in mtDNA — either a point mutation or genes, even though tRNAs comprise only about 10% a DNA rearrangement (that is, a deletion, duplication of the total coding capacity of the genome. Conversely, or inversion) — that directly compromises OXPHOS the polypeptide-coding genes, comprising almost function. Since 1988, more than 270 point mutations 70% of the genome, account for only about 40% of the

Box 2 | Cybrids Because there is currently no technology available for introducing exogenous DNA into mammalian mitochondria stably and heritably, the pathogenicity of many primary mtDNA mutations discussed in this Review has been established using cytoplasmic hybrid, or cybrid, technology. In this approach, patient mitochondria and mitochondrial DNAs (mtDNAs) are transferred to a host ρ0 cell containing mitochondria that are devoid of endogenous mtDNAs135 (see the figure). Thus, cybrids can be assayed for donor mitochondrial function in a ‘standard’ nuclear background93. In the most common approach for making ρ0 cells, a transformed cell line that is deficient in thymidine kinase activity (TK–) is exposed to ethidium bromide (EtBr), which is an inhibitor of mtDNA replication (mitochondria have a high membrane potential and take up EtBr, as it is ionizable). The ρ0 line is auxotrophic for uridine and pyruvate (U–, P–). The ρ0 cells are repopulated by forming hybrids with cytoplasts (cells that lack nuclei but still contain mitochondria) from a patient cell line. After fusion, cells are plated in media containing bromodeoxyuridine (+BrdU) and lacking either pyruvate or uridine (–U or –P), which permits only the growth of ρ0 cells that have fused with cytoplasts containing functional mitochondria (TK+ donor cells are not able to grow in the presence of BrdU). If heteroplasmic cells are used as donors, it is possible to isolate cybrid clones that harbour varying proportions of mutated mtDNAs, ranging from 0% mutant (that is, 100% wild type) to 100% mutant (that is, 0% wild type). Both the parental ρ0 line and homoplasmic cybrid lines harbouring nonsense- or frameshift-mutated mtDNAs must be grown in media supplemented with uridine (+U; ~200 μM) and pyruvate (+P; ~1 mM)136.

U+, P+ U+, P+

TK+ TK– Patient cell ρ+ cell

Enucleate EtBr

U+, P+ U–, P–

TK– Cytoplast ρ0 cell

Cytoplast fusion: Nystagmus –U or –P, +BrdU An involuntary, quick, rhythmic U+, P+ movement of the eyeball, which can be horizontal, TK– vertical or rotary. Cybrid

Hemiplegia Paralysis of the left or right side of the body owing to a brain lesion affecting motor Repopulate individual cellular clones pathways.

Strongly SDH-positive U–, P– U+, P+ U+, P+ U–, P– vessels (SSVs). Abnormal, massive TK– TK– TK– TK– accumulation of mitochondria in blood vessels, as visualized by enzyme histochemistry to detect the activity of succinate dehydrogenase (SDH; complex II of the respiratory chain). ρ0 Heteroplasmic Homoplasmic normal Homoplasmic mutant

Nature Reviews | Genetics 880 | DECEMBER 2012 | VOLUME 13 www.nature.com/reviews/genetics

Figure 1 | Mitochondrial DNA and the human respiratory chain/oxidative phosphorylation system. a | The human mitochondrial genome. The 37 mitochondrial DNA (mtDNA)- encoded genes include seven subunits of complex I (ND1, 2, 3, 4, 4L, 5 and 6), one subunit of complex III (cytochrome b a HSP OH (Cyt b)), three subunits of complex IV (Cyt c oxidase (COX) I, II and III), two subunits of complex V (A6 and A8), two rRNAs 12S F D loop (12S and 16S) and 22 tRNAs (one‑letter code). Also shown V are the origins of replication of the heavy strand (O ) and the T H light strand (OL), and the promoters of transcription of 16S Cyt b the heavy strand (HSP) and light strand (LSP). b | Oxidative phosphorylation (OXPHOS) complexes. The system is P LSP comprised of complex I (NADH dehydrogenase-CoQ reductase), complex II (succinate dehydrogenase), L1 complex III (ubiquinone-Cyt c oxidoreductase), complex IV E (COX) and complex V (ATP synthase; F0 and F1 denote the ND1 ND6 proton-transporting and catalytic subcomplexes, respectively), plus two electron carriers, coenzyme Q (CoQ; also called ubiquinone) and Cyt c. Complexes I–IV I pump NADH- and FADH -derived protons (produced by the M Q 2 tricarboxylic acid (TCA) cycle and the β‑oxidation ‘spiral’) ND5 from the matrix across the mitochondrial inner membrane ND2 A to the intermembrane space to generate a proton gradient N O while at the same time transferring electrons to molecular W C L oxygen to produce water. The proton gradient, which Y L1 makes up most of the mitochondrial transmembrane S2 H potential (Δψm), is used to do work by being dissipated across the inner membrane in the opposite direction S1 through the fifth complex (ATP synthase), thereby COX I ND4 generating ATP from ADP and free phosphate. Complexes I, III, IV and V contain both mtDNA- and nuclear DNA D (nDNA)-encoded subunits, whereas complex II, which is ND4L R also part of the TCA cycle, has only nDNA-encoded COX II ND3 subunits. Note that CoQ also receives electrons from K G A8 A6 COX III dihydroorotate dehydrogenase (DHOD), an enzyme of pyrimidine synthesis. Polypeptides encoded by nDNA are in blue (except for DHOD, which is in pink); those encoded by mtDNA are in colours corresponding to the colours of the polypeptide-coding genes (shown in a). The ‘assembly’ proteins are all nDNA-encoded. IMS, intermembrane space; MIM, mitochondrial inner membrane. Part a is modified from REF. 149 © (2006) Wiley. b ADP ATP H+ Dihydroorotate Orotate H+ H+ H+

Succinate Fumarate

O2 2H2O F1

Matrix DHOD ND1 ND2 – ND6 ND3 e– e Cyt b COX I A8 MIM – – F0 ND5 ND4 e e COX II A6 ND4L CoQ COX III IMS e– Cyt c e–

Polypeptides Complex I Complex II Complex III Complex IV Complex V mtDNA-encoded 7 0 1 3 2 subunits nDNA-encoded ~39 4 10 10 ~14 subunits Assembly ~11 ~2 ~9 ~30 ~3 proteins

Nature Reviews | Genetics NATURE REVIEWS | GENETICS VOLUME 13 | DECEMBER 2012 | 881

Heteroplasmic mutations, and the two rRNA genes (15% of coding of normal and mutated mtDNAs. Moreover, with one 10 A term that describes the capacity) account for only about 2%. exception , all of these heteroplasmic mtDNA mutations presence of two or more This unexpected distribution is likely to be due to are ‘recessive’: an extremely high amount of mutation mtDNA genotypes within a the fact that most patients with mtDNA mutations are is required before a clinical phenotype evinces itself. cell, tissue or organism. heteroplasmic, which means that they harbour a mixture For unknown reasons, this ‘threshold effect’ varies among mutation types, and in skeletal muscle the mutation load for any particular tRNA (~90%)11 is typically Box 3 | Biochemical and morphological features of mitochondrial disease higher than that for large-scale partial deletions of 12 Although mitochondrial oxidative phosphorylation (OXPHOS) disorders are quite mtDNA (~70–80%) . The threshold for mutation load varied, they typically display a number of ‘canonical’ biochemical and morphological in polypeptide-coding genes can be similarly broad, features. An obvious feature is respiratory chain deficiency, which typically manifests with low levels of mutation causing one type of clini- itself as reduced enzymatic function in one or more respiratory chain complexes, with a cal presentation and higher levels causing another. An concomitant reduction in cellular oxygen consumption and ATP synthesis. In addition, excellent example of this behaviour is the m.8993T→G patients often have increased resting lactic acid levels in the blood and cerebrospinal mutation in the ATP synthase 6 (ATP6) gene: at muta- 9 fluid . Under normal conditions, pyruvate — the end product of anaerobic glycolysis — tion loads above 90%, patients present with maternally is transported into mitochondria for further oxidation in the tricarboxylic acid (TCA) inherited Leigh’s syndrome (MILS), which is a fatal cycle to produce the reducing equivalents (namely, NADH and FADH ) that are required 2 encephalopathy13 (BOX 1), whereas at mutation loads in for proton pumping by the respiratory chain. However, if the respiratory chain is compromised, NADH and pyruvate accumulate in the cytosol. Excess cytosolic pyruvate the range of 70–90% patients present with neuropathy, 14 is converted to lactate by lactate dehydrogenase, thereby accounting for the increased ataxia and retinitis pigmentosa (NARP) , which is a late- lactic acid found in many mitochondrial diseases and especially in those affecting onset, debilitating but non-fatal disorder. By contrast, a infants or young children9. patient with 70% mutation in a tRNA will rarely display A prominent morphological feature of OXPHOS disease is the ragged red fibre (RRF), overt disease. Thus, tRNA mutations are ‘tolerated’ over which reflects a massive proliferation of OXPHOS-defective mitochondria29 in muscle; a broader range of mutant load than are mutations in this can be visualized with the modified Gomori trichrome stain137. The accumulation polypeptide-coding genes. Of course, after the mutation can also be observed using nitro-blue tetrazolium to detect the activity of succinate load has risen above 90–95%, no matter what the type 138 dehydrogenase (SDH; that is, complex II) , which contains only nuclear DNA of mutation is, OXPHOS deficiency occurs, usually with (nDNA)-encoded subunits. In this case, the RRFs appear dark blue (see the figure). The devastating results. figure shows RRFs and strongly SDH-positive vessels (SSVs) in serial sections of skeletal muscle from patients with mitochondrial encephalomyopathy, lactic acidosis and These high thresholds for pathogenicity also mask stroke-like episodes (MELAS) and myoclonus epilepsy and ragged red fibres (MERRF) the actual frequency of potentially pathogenic mtDNA visualized by histochemistry to detect the activities of SDH (left) and cytochrome c mutations in the population. Although the prevalence oxidase (COX; right). Note that RRFs and SSVs are COX-negative in MERRF, whereas they of mtDNA-related disease is about 1 in 5,000, the popu- are COX-positive in MELAS. RRFs are a sufficient but not necessary feature for determining lation frequency of the ten most common pathogenic mitochondrial disease (as is increased lactate in the blood or cerebrospinal fluid). mtDNA mutations is much higher — approximately The vast majority of OXPHOS mutations impair the cell’s ability to produce ATP in 1 in 200 — suggesting that many normal individuals amounts that are sufficient for maintaining viability, but sometimes OXPHOS problems carry subthreshold levels of potentially harmful mtDNA can leave ATP synthesis intact and yet can be deleterious by, for example, stimulating mutations15. the overproduction of reactive oxygen species (ROS)139 or inducing an autoimmune The skewed distribution of mutations towards tRNA response140. errors initially implies that maternally inherited muta- SDH COX tions in structural subunits of the respiratory chain are selected against, presumably during embryogenesis, whereas mutations in tRNAs are somehow less ‘severe’ during embryogenesis. Indeed, maternally inherited mutations in tRNAs might be under less-stringent puri- SSV SSV fying selection through the germ line than are muta- MERRF tions in polypeptide-coding genes16. However, it is easy RRF RRF to imagine that the reverse might also hold true: namely, that mutations in rRNA and tRNA genes that disrupt global protein synthesis would have a greater deleterious effect than mutations in single respiratory chain sub units. The paucity of mutations in rRNA genes supports RRF this alternative view: there is only one known mutation RRF in 16S rRNA associated with a primary mitochondrial disease, and none of the five known mutations in the 12S rRNA gene is lethal, but they do cause non-syndromic 17 MELAS deafness for reasons related to an effect on 12S rRNA methylation and subsequent nuclear E2F1‑mediated SSV SSV transcription18 rather than to the role that 12S rRNA has in protein synthesis. Thus, in addition to differential degrees of purifying selection, the predilection of Photographs are provided courtesy of Eduardo Bonilla and Kurenai Tanji, Columbia University, mutations for tRNA genes may be due to other, currently Nature Reviews | Genetics New York, USA. unknown reasons.

882 | DECEMBER 2012 | VOLUME 13 www.nature.com/reviews/genetics

Examples of point mutations in mtDNA. Among the to translate mt‑mRNAs occurs even in heteroplasmic point mutations (TABLE 1), the most common are: an cells but only if the fraction of Δ‑mtDNA within each cell A→G transition at position 3,243 in the tRNALeu(UUR) (or muscle segment) is above ~80% and the amount gene, which causes mitochondrial encephalopathy, lactic of normal mtDNAs is insufficient to complement the acidosis and stroke-like episodes (MELAS); an A→G defect by providing the ‘missing’ tRNAs20,29,30. If transition at position 8,344 in tRNALys, which causes the mutation load is below this threshold, complemen- myoclonus epilepsy and ragged red fibres (MERRF) syn- tation will occur20, as normal mRNAs and polypep- drome; and the aforementioned T→G transversion at tides can move fairly freely, not only within individual position 8,993 in ATP6, which causes NARP and MILS organelles but also as a result of the constant fusion (BOX 1). These three disorders highlight the diversity of and fission of mitochondria. By contrast, the mtDNAs biochemical, morphological and clinical presentations themselves are more ‘confined’, as they are bound in that are a hallmark of mitochondrial disorders and that mtDNA–protein complexes called nucleoids that are not only challenge the diagnostic capabilities of clini- attached to the inner face of the inner membrane and cians but also pose fundamental questions regarding operate as semi-autonomous genetic elements20. basic mitochondrial biology. NARP and MILS highlight additional aspects of mito- Secondary mtDNA defects: multiple deletions and chondrial disease and behaviour. These disorders are depletion of mtDNA. Secondary mtDNA-related dis- due to mutations in the membrane-spanning (so‑called orders are those in which mtDNA integrity is compro- (FIG. 1b) F0) portion of ATP synthase that compromise mised but not via a ‘direct hit’ on the mitochondrial ATP synthesis. Whereas all of the mutations described genome. Rather, mtDNA mutations in these disorders above affect respiratory chain integrity, thereby (secondary mtDNA mutations) are caused ‘indirectly’ as reducing the mitochondrial transmembrane potential a consequence of a Mendelian-inherited mutation in a 19,20 (Δψm) , ATP synthase mutations typically leave the nuclear gene that encodes a protein required for the respiratory chain intact but decouple proton flow from proper replication and/or maintenance of the mito- 21 ATP generation . As such, Δψm in NARP or MILS is chondrial genome, ultimately resulting in mtDNA either unchanged or is actually higher than normal21. instability. This instability can manifest itself through This crucial difference in transmembrane potential will the generation of multiple point mutations or large- render cells from patients with NARP or MILS refractory scale Δ‑mtDNAs that arise over the lifetime of the to treatment strategies that are predicated on selectively patient31; loss of the entire mitochondrial genome Lactic acidosis (REFS 19,20) 32 eliminating mitochondria with a low Δψm . (that is, mtDNA depletion ) can also occur. Often, all The abnormal accumulation of three types of error coexist within tissues of the same lactic acid causing lower pH in 33 blood in a resting individual Examples of large-scale deletions of mtDNA. The most patient . Strictly speaking, these syndromes are not (that is, not during or easily observable mtDNA mutations are the large-scale considered to be primary mtDNA diseases. However, immediately after exercise), partial deletions: mtDNAs with these deletions are des- because at a basic level these diseases are defects in the which is seen in many patients ignated Δ‑mtDNAs. Discovered in 1988 (REFS 22,23), dialogue between the nucleus and the mitochondria, with mitochondrial disease. these mutations remove ~2–10 kb of mtDNA, and the they share many of the features of the primary disor- Myoclonus deletion breakpoints are often flanked by short ders, including their population-genetic behaviour (for 24 Involuntary jerky movement (5–13 bp) direct repeats . The deletions are typically example, heteroplasmy and threshold effects). of an area of the body sporadic (that is, only the proband has the mutation; There are various mutations that can cause mtDNA (usually a limb). mothers and siblings do not), and although they vary instability, including those in nDNA-encoded proteins Mitochondrial among patients, each patient harbours only a single required for maintenance of mitochondrial nucleo- 34 35 transmembrane potential species of deletion. These facts imply that the deletion tide pools , nucleotide transport , DNA replica- 36 37 (Δψm). This is the electrical event occurred either in the germ line of the mother tion and RNA transcription . For example, PEO can potential generated across the or in early embryogenesis of the proband; the deletion occur with Mendelian inheritance owing to mutations mitochondrial inner membrane event arose randomly in a single mtDNA molecule, and in a nucleus-encoded mitochondrial DNA helicase due to differences in the 37 distribution of ions (for this single molecule of Δ‑mtDNA was massively ampli- called Twinkle ; these mutations result in the genera- example, H+, Ca2+, Na+, K+ fied during pre- and postnatal development through tion and accumulation in muscle of multiple large- and ionized ATP species) clonal expansion. The deletions can be located almost scale Δ‑mtDNAs that are structurally similar to the between the matrix and the anywhere in the mitochondrial genome24, but they all ‘clonal’ Δ‑mtDNAs observed in patients with sporadic intermembrane space. cause one of three pathogenically similar disorders, PEO and KSS. Depending on the loads of depleted 9 Secondary mtDNA as distinguished by their tissue proclivities : Kearns– and mutated mtDNAs and their tissue distributions, mutations Sayre syndrome (KSS)25; chronic progressive external secondary mtDNA-related disorders can have various Mutations that can ophthalmoplegia (CPEO, or simply PEO)26; or Pearson’s presentations. Examples of syndromes include mito- compromise OXPHOS function syndrome27 (BOX 1). chondrial neurogastrointestinal encephalomyopathy and cause disease and that 34 38 arise in mtDNA owing to a In all three syndromes, the deleted region encom- (MNGIE) , Alpers’ sydrome and PEO in isolation mutation in the nuclear passes at least one tRNA gene. Indeed, this is the basis or as a part of syndromes that include PEO plus other genome that compromises for the underlying pathogenesis of these syndromes features. mtDNA integrity (for example, and demonstrates two additional aspects of mitochon- a mutation in mitochondrial drial behaviour. First, the loss of a single tRNA gene Ageing and neurodegeneration DNA polymerase‑γ causing systemic errors in mtDNA is sufficient to compromise the translation of all 13 Accumulation of mtDNA mutations in normal ageing. replication). mtDNA-encoded polypeptides28. Second, this failure The mutation load of the clonal Δ‑mtDNAs found in

NATURE REVIEWS | GENETICS VOLUME 13 | DECEMBER 2012 | 883

Table 1 | mtDNA mutations in human primary respiratory chain disorders sporadic KSS, PEO and Pearson’s syndrome is extremely high (>80% in affected issues)39. Interestingly, these Gene product Number of mutations Main disorder mutations also accumulate during the lifetime of normal rRNAs people, albeit at extremely low levels that are detectable 12S rRNA 5 Deafness only by PCR40 and with different amounts in different 41 16S rRNA 1 Atypical MELAS tissues . It appears that these Δ‑mtDNAs accumulate during our lifetimes, especially in postmitotic tissues tRNAs such as the brain, heart and muscle42–44. Although they tRNAAla 3 Myopathy arise spontaneously as the result of somatic muta- tRNAArg 2 Various tion, each individual species of Δ‑mtDNA has the 45 tRNAAsn 5 Myopathy capacity to expand clonally ; this expansion is particularly noticeable in muscle from aged normal individuals46 Asp tRNA 2 Various (and in patients with Mendelian PEO)47. Although each tRNACys 3 Various individual species of Δ‑mtDNA may represent less than 43,44 tRNAGln 3 Various 0.1% of total mtDNA , sufficient numbers of different Δ‑mtDNA species accumulate so that, depending on their tRNAGlu 7 Reversible respiratory chain deficiency tissue distribution and concentration48, they can have Gly tRNA 3 Various deleterious consequences49. tRNAHis 4 Various Although Δ‑mtDNAs clearly accumulate in ageing, tRNAIle 14 PEO the evidence that the same holds for point mutations is weaker43. There are many ongoing studies aimed at tRNALeu(CUN) 8 Myopathy detecting somatic mtDNA mutations, but it still remains tRNALeu(UUR) 23 MELAS uncertain whether these mutations cause overt disease tRNALys 14 MERRF or whether they have a major role in normal ageing. tRNAMet 2 Various Perhaps studies of experimental models that age more rapidly than humans (for example, flies, worms and even tRNAPhe 14 Myopathy yeast) will shed light on this question. tRNAPro 5 Multisystem tRNASer(AGY) 4 Myopathy mtDNA mutations in late-onset neurodegenerative dis- tRNASer(UCN) 12 Myopathy; deafness ease. There is a growing interest in the potential role of mitochondrial dysfunction in general, and of mtDNA Thr tRNA 2 Various mutations in particular, in late-onset neurodegen- tRNATrp 12 Encephalomyopathy erative diseases, such as Alzheimer’s, Parkinson’s and tRNATyr 4 Myopathy Huntington’s diseases, amyotrophic lateral sclerosis 50 tRNAVal 6 Multisystem and hereditary spastic paraplegias . Although there seems to be little doubt of a mitochondrial connection, Polypeptides it seems to relate more to problems of mitochondrial ATP synthase 6 13 NARP or MILS dynamics (for example, fission, fusion, distribution and ATP synthase 8 2 Various anchorage) or quality control (for example, autophagy) than to mutations in mtDNA50. However, there is one COX I 10 Various neurodegenerative disorder in which mtDNA mutations COX II 8 Various may have a role (albeit probably a secondary one), and COX III 6 Myopathy that is Parkinson’s disease. Studies of proteins mutated Cytochrome b 21 Sporadic myopathy in familial Parkinson’s disease — for example, PINK1, a mitochondrially targeted kinase51, and parkin, a cyto- ND1 16 MELAS; LHON solic ubiquitin ligase that translocates to low-Δψm dys- ND2 3 Various functional mitochondria52 — have implicated altered ND3 5 Leigh’s syndrome mitochondrial quality control as an underlying element ND4 5 LHON in the pathogenesis of both the familial and sporadic forms of the disease. However, it has also been found ND4L 1 LHON that the substantia nigra — the brain region that is ND5 12 MELAS most affected in Parkinson’s disease (and the main site ND6 11 LHON of dopaminergic neuron degeneration in patients with This is a ‘minimal’ list that was compiled by the authors. A more comprehensive list (>300 Parkinson’s disease) — harbours substantial levels of the mutations) is available at MITOMAP, which contains confirmed pathogenic mutations types of Δ‑mtDNAs found in KSS and in normal age- (including those selected for this table), those that are possibly associated with pathology and ing53,54. This finding has led to the hypothesis that these those that appear to confer a higher risk of developing disease or are modifiers of disease presentation. COX, cytochrome c oxidase; LHON, Leber’s hereditary optic neuropathy; somatically produced Δ‑mtDNAs may eventually cause MELAS, mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes; MERRF, bioenergetic deficit, leading to the disease. This hypoth- myoclonus epilepsy and ragged red fibres; MILS, maternally inherited Leigh’s syndrome; mtDNA, mitochondrial DNA; NARP, neuropathy, ataxia and retinitis pigmentosa; ND, esis has received indirect support from studies of mice NADH-ubiquinone oxidoreductase; PEO, progressive external ophthalmoplegia; rRNA, in which mtDNA deficiency was induced specifically in ribosomal RNA. the substantia nigra and that displayed many of the

884 | DECEMBER 2012 | VOLUME 13 www.nature.com/reviews/genetics

pathological features of Parkinson’s disease55. We note, sclerosis, frontotemporal dementia, hereditary spastic however, that patients with KSS who have high levels of paraplegia, Huntington’s disease, ischaemic stroke, Δ‑mtDNAs do not, as a rule, have features of Parkinson’s metabolic syndrome, myocardial infarction, psychi- disease and that only one mutation in mtDNA has been atric disorders, Parkinson’s disease, sarcopaenia and associated with such features56. Further analysis in model type 2 diabetes, among others71–83. Although it has been systems, including mice harbouring clonal57 or multi- argued that those studies in which associations were ple58 Δ‑mtDNAs, or analysis of PINK1- or PARK2 (also not observed typically had a low statistical power owing known as parkin)-mutated mice for the presence of to small sample sizes and the genotypic complexity of Δ‑mtDNAs, may help to resolve this issue. mtDNA lineages and sublineages, the fact remains that very few ‘primary’ mtDNA mutations (which have been Inherited mtDNA variants in complex traits found on diverse mtDNA haplotypic backgrounds) are In addition to the potential roles of somatic mtDNA associated with these disorders, and they are far fewer mutations in ageing and neurodegenerative diseases, are in number than are nuclear mutations found in these there mtDNA haplotypes or specific polymorphisms that conditions50. Moreover, most of these studies were are associated with predisposion to neurodegenerative either correlative, descriptive or both and were also sus- diseases or that are associated with other complex traits? ceptible to technical difficulties that were unique to the Different ethnic groups have distinct mitochondrial hap- analysis of mtDNA polymorphisms84. These included lotypes that have resulted from the accumulation of vari- problems in determining the functional consequences ations from the mtDNA of our ancestral ‘mitochondrial of one haplotype as compared to another85 and in Eve’59. Some of these haplotypes may confer vulnerabil- the misattribution of mutations to mtDNA resulting ity to, or protection from, various common diseases. In from the co‑amplification of authentic mtDNA with addition, the genetic variation might be responsible for nucleus-embedded mtDNA pseudogenes (described subtle biochemical differences among haplogroups. below). Taken together, we feel that although there may For example, it has been postulated that mtDNA hap- be important contributions of mtDNA haplotypes to lotypes that favour a looser coupling between oxidation complex traits and disorders, the evidence to date is and phosphorylation — thereby generating a surplus of too weak to support such a conclusion. heat at the expense of ATP — may have favoured the set- tling of human populations in colder climates60; however, mtDNA mutations in cancer this hypothesis is controversial61,62. Perhaps nowhere is the role of mtDNA mutations in pathology more contentious than in cancer. Moreover, Mitochondrial haplotypes as modifiers. It is clear that the discovery of mtDNA mutations in tumours has bona fide pathogenic mtDNA mutations can cause also contributed to the recent resurgence of inter- common disorders such as diabetes mellitus63, hearing est in the Warburg hypothesis of cancer, which states loss64,65 or exercise intolerance66, but such mutations that tumours rely on ‘aerobic glycolysis’ rather than on account for less than 2% of patients with these complex OXPHOS in normoxic conditions to survive and even traits. What is less clear is the role of mtDNA haplo to thrive86. type variants in such common disorders. Theoretically, In 1998, Bert Vogelstein’s group reported that colo- an mtDNA variant with mild functional consequences rectal cancers harbour numerous mtDNA mutations could interact with other polymorphisms in mtDNA (typically, point mutations, not rearrangements, with or nDNA to produce complex traits synergistically67. many in the homoplasmic state); adjacent non-cancer- A well-documented example is the effect of mtDNA ous tissues had only normal mtDNAs87. Since then, this haplotype on the expressivity of Leber’s hereditary optic result has been replicated numerous times88 but, given neuropathy (LHON) mutations. The variable penetrance our understanding of mitochondrial behaviour, espe- of these mutations cannot be accounted for by hetero- cially in primary mitochondrial disease, these findings plasmy, because the mtDNA defect is homoplasmic in raise many questions. Why are there so many mutations, most patients. Haplotype analyses of LHON mutations and why are many of the mutations in cis (that is, on the have revealed an increased risk of vision loss in the set- same mtDNA circle)? How do they arise rapidly? Why ting of haplotypes J1, J2 and K68,69. Analyses in vitro of do some tumours have nonsense mutations, whereas cybrids (BOX 2) and fibroblast cells that harbour either others have synonymous or missense mutations, many the m.11778G→A or m.14484T→C mutations confirmed of which are apparently functionally neutral? Why is Homoplasmic that haplogroup J conferred sensitivity to the neurotoxin there no apparent difference in tumour biology between A term that describes the n-hexane70, an environmental toxin that, like smoke and those tumours that harbour homoplasmic mutations presence of a single mtDNA pesticides, has been implicated as an environmental and those that harbour heteroplasmic mutations (some- genotype within a cell, tissue, 70 or organism. trigger of optic neuropathy in patients with LHON . times below the threshold level typical of primary mitochondrial disease)? Fundamentally, these questions are Aerobic glycolysis Susceptibility to complex disorders. Evidence for really asking the same thing: what is the relationship of The conversion of glucose to mtDNA susceptibility polymorphisms and/or haplo mtDNA mutations and OXPHOS function to cancer lactate (and the production groups in complex disorders is highly controversial. biology (BOX 4)? of ATP by substrate level phosphorylation) even in the There is evidence for and against such links in a num- Although there are dozens of studies document- presence of oxygen, especially ber of diseases, including age-related macular degen- ing mtDNA mutations in cancer, almost none of them in tumours. eration, Alzheimer’s disease, amyotrophic lateral has asked whether a specific mtDNA genotype affects

NATURE REVIEWS | GENETICS VOLUME 13 | DECEMBER 2012 | 885

Box 4 | Mitochondrial function in cancer An alternative idea is that mtDNA mutations result in downregulation of OXPHOS function, and this pro- Mitochondrial function is altered in numerous ways in tumours, allowing them to cess somehow promotes tumour survival. One idea in 141 survive and to circumvent cell-death pathways . Some of these changes are support of this view is that defects in OXPHOS lead to summarized below. activation of the AKT cell survival pathway, including Loss of p53 function. Among its numerous functions, the tumour suppressor downregulation of apoptosis via a mechanism mediated p53 regulates respiratory chain function and glycolysis via positive transcriptional by cellular NADH, which is increased when mitochon- regulation of synthesis of cytochrome oxidase 2 (SCO2), which encodes a complex IV drial respiration is blocked90. However, defective bioen- assembly protein, and negative regulation of TP53‑induced glycolysis regulator ergetics in tumours, either through mtDNA mutation (TIGAR; also known as C12orf5). When TP53 (the gene that encodes p53) is mutated or reduction in mtDNA copy number91 (but the issue or lost in tumours, glycolysis (and the mitochondrial tricarboxylic acid (TCA) cycle) is 92 stimulated142 and the respiratory chain is depressed. This phenomenon is known as the of copy number is contentious ), raises a conceptual Crabtree effect. problem: mitochondrial respiratory chain function is indispensable for the synthesis of the pyrimidines that Evasion of hypoxia-mediated cell death. Poorly vascularized, rapidly dividing tumour cells — especially highly proliferating tumour cells cells become hypoxic, stimulating cell-death pathways mediated by the transcription factor hypoxia-inducible factor 1 (HIF1). Among other effects, this change promotes — need to divide, and in the absence of a functioning 93 vascularization, cell survival and invasion. HIF1 subunit‑α is normally degraded by the respiratory chain, cells eventually die . This is because proteasome after hydroxylation by prolyl hydroxylase and subsequent ubiquitylation by a key reaction in de novo pyrimidine synthesis — the the von Hippel–Lindau E3 ubiquitin ligase, but increased levels of TCA-derived conversion of dihydroorotate to orotate (a precursor succinate in tumours inhibit the hydroxylase, thus stabilizing HIF1. Notably, mutations of uridine monophosphate (UMP)) — is catalysed by in nuclear genes encoding two TCA cycle enzymes — namely, succinate the mitochondrial enzyme dihydroorotate dehydroge- dehydrogenase (SDH) and fumarase, both of which result in increased cytosolic nase, which depends on an intact respiratory chain for succinate levels — can give rise to cancer. These cancers are pheochromocytomas and its function94; more specifically, the electron acceptor 143 144 paragangliomas in the case of SDH and leiomyomas in the case of fumarase . These for this redox reaction is reduced ubiquinone (that is, observations lend support to the idea that HIF1 has a role in tumorigenesis and to the α CoQ) and, through complexes III and IV, molecular oxy- conceptual underpinnings of the Warburg hypothesis145. gen (FIG. 1b). If a similar effect operates in tumours that Evasion of apoptosis. Cell death by apoptosis is regulated by a balance between contain homoplasmic loss‑of‑function mtDNA muta- interacting pro-apoptotic factors (for example, BAX and the truncated form of tions, it would mitigate against, not for, the generation of BH3‑interacting domain death agonist (tBID)) and anti-apoptotic factors (for example, mtDNA mutations. We note in this regard that cells that BCL‑2). In cancer, this balance is shifted towards anti-apoptotic factors. For 0 (BOX 2) example, the glycolytic enzyme hexokinase, which binds to voltage-dependent are completely devoid of mtDNA (called ρ cells ) anion-selective channel (VDAC1) on the mitochondrial outer membrane, is upregulated do not form tumours when they are injected into mice 95,96 in tumours; this prevents the interaction of VDAC1 with tBID146,147. subcutaneously , but they are tumorigenic when injected intramuscularly96. This is perhaps because the Role in DNA replication. In addition to the requirement of a respiratory chain to support pyrimidine synthesis (see text), it was recently shown that purine biosynthesis subcutaneous site is less vascularized than the muscle in tumours is also mediated by mitochondria via pathways requiring glycine. In and cannot take up uridine from the circulation (uridine 97 mitochondria, glycine is converted to tetrahydrofolate (by the glycine cleavage is ~5 μM in plasma ). system), which provides one‑carbon units for incorporation into the purine ring. Although glycine is made both in the cytosol (de novo from carbon dioxide and Are tumour mtDNA mutations artefacts? If some base- ammonia and salvaged by serine and tetrahydrofolate) and in mitochondria (also from line level of normal OXPHOS function is required for serine and tetrahydrofolate), tumours (but not rapidly dividing normal cells) consume tumours to be viable, why have so many mtDNA muta- glycine that is metabolized specifically by the mitochondrial pathway148. Thus, DNA tions been detected? One possibility is that at least some replication using both purine and pyrimidine precursors — the sine qua non of tumour of these could be technical artefacts. If a low-stringency growth — rely on mitochondrial function. BLAST of mtDNA is run against the human genome, This brief overview vastly understates the complicated interplay between mitochondrial it is possible to detect ~1,000 nucleus-embedded mito- and tumour biology141 but gives some sense of the potential effects of a possible role chondrial sequences (NUMTs), ranging in size from that mitochondria and mitochondrial DNA mutations might have in cancer. ~50 bp to >15 kb (that is, almost full-length)98,99. These NUMTs have been relocalized from the mitochondria to the nucleus in evolutionary time98 and have subse- mitochondrial function and whether such dysfunc- quently been subjected to genetic drift, with individual tion has a role in tumorigenesis. There have been a few NUMTs picking up polymorphic mutations in differ- reports of tumours that are, for example, cytochrome c ent human lineages100,101 (that is, they are essentially oxidase (COX)-deficient5,89, but it is not clear whether mtDNA-derived pseudogenes). What is less appreci- the deficiency is due to a mutation in an mtDNA- ated is that NUMTs can also enter the nucleus during encoded COX gene, or whether this is the result of a the lifetime of an individual, especially under conditions general downregulation of respiratory chain function of stress. This rapid relocalization of mtDNA sequences or even the result of reduced mtDNA copy number. has been documented in plants102, yeast103, rodents104 and Moreover, it is noteworthy that of the known patho- humans105–107. Of course, in these cases, the sequences of genic point mutations causing primary mitochondrial authentic mtDNA and of recently relocalized NUMTs disease (TABLE 1), none is unequivocally associated with will be extremely similar or possibly identical. cancer. Thus, mtDNA mutations seem more likely to be Chromosomal instability in tumours has the poten- a marker of cancer and/or to arise as a secondary effect tial to increase the NUMT copy number in several ways: of altered tumour biology than to be a cause of cancer. the NUMTs could be located in unstable regions that

886 | DECEMBER 2012 | VOLUME 13 www.nature.com/reviews/genetics

Forward mtDNA: CAGCCGCTATTAAAGGTTCG tttgttcaacgatta a agtccta c gtgatc 3066 NUMT: CAGCCGCTATTAAAGGTTCG tttgttcaacgatta g agtccta t gtgatc 22023821

Reverse 1 mtDNA: tgagtTCAGACCGGAGTAATCCAGG t c ggtttctatctacctt caa a t tc 3116 NUMT: tgagtTCAGACCGGAGTAATCCAGG t t ggtttctatctattct aca t ttc 22023871

mtDNA: c tcc c t gtacgaaagga c aagagaaat a a ggcc t acttca c aaag c gcc t 3166 NUMT: t tcca-gtacgaaagga t aagagaaat g g ggcc c acttca t aaag t gcc c 22023920

mtDNA: -tc cccc g t a a atgatat c atctca a c t t a g t a t t a tacccacacccacc 3215 NUMT: ctg cccca t a g atgatat t atctca g c a t t t t a c t g tacccacacccacc 22023970

Reverse 2 mtDNA: caagaacagggtTTGTTAAGATGGCAGA G CCC 3247 NUMT: caagaacagggtTTGTTAAGATGGCAGA C CCC 22024002

Figure 2 | Example of the potential to amplify inadvertently a nucleus-embedded mitochondrialNature Reviews sequence. | Genetics Comparison of a region of the 16S rRNA gene within authentic mitochondrial DNA (mtDNA) (top lines; numbering according to the standard ‘Cambridge’ mtDNA sequence8) to that of a nucleus-embedded mitochondrial sequence (NUMT) located on chromosome 17p11.2 (bottom lines; genome numbering according to the February 2009 release of the human genome (GRCh37/hg19)). The primer pairs used (Forward and Reverse 1, and Forward and Reverse 2)112 have the potential to amplify both mtDNA and the NUMT. Sequence differences between mtDNA (black) and NUMT DNA (red) are shown in bold.

lead to aneuploidy; they could be located in homo mitochondria were purified before PCR amplification, geneously staining regions (HSRs), which are tandemly no pathogenic mtDNA mutations were found in mouse repeated regions of the genome with increased copy brain tumours113, and the number of mtDNA mutations number; and they can be selectively amplified within in human colorectal tumours was actually lower than small regions of the chromosome as double-minute DNAs that in the surrounding tissue114. (dmDNAs)108. In the cases of HSRs and dmDNAs, the These caveats are speculative, and for that reason copy number in the repeated regions can vary, rang- they should not be allowed to obscure the very real ing from ~3 to ~30 repeats, with a median value of possibility that authentic mtDNAs are indeed mutated ~10 repeats108,109. Because the typical dmDNA is about in tumours (especially as the rapid cellular division in 1–3 Mb in size, it will contain on average one NUMT cancers may allow for the accumulation and fixation of (on the basis of there being ~1,000 NUMTs in a human spontaneous mtDNA mutations115). Moreover, even if genome) and will be amplified selectively by approxi- the mutated DNAs are artefacts derived from amplified mately tenfold over its pre-cancerous level110,111. We NUMTs116 and are less biologically informative, they are therefore speculate that NUMT targets can increase in nevertheless still extremely useful as early markers of tumours in ways that vary from individual to individual cancer117,118, and thus they may have clinical use. and from tumour to tumour. When using PCR of total cellular DNA to analyse Concluding remarks mtDNA in normal tissues, the number of authen- The notion that mutations in mtDNA, and the subse- tic mtDNA molecules far exceeds the number of quent alterations in mitochondrial oxidative energy NUMTs detectable by any particular pair of PCR prim- metabolism, are confined to a small group of pathologies ers, and the PCR preferentially amplifies the normal no longer holds true. Together, primary mtDNA-related mtDNA. However, in tumours, these PCR reactions diseases, which were previously deemed to be extremely might amplify one or more NUMTs along with (or even rare, have now been shown to be as frequent as some in preference to) authentic mtDNA owing to a reduc- Mendelian disorders, such as Duchenne’s muscular tion in the mtDNA/NUMT target DNA ratio. There dystrophy or cystic fibrosis. Moreover, mtDNA muta- are at least three possible reasons for this: a reduction tions — either partial deletions or point mutations — in mtDNA copy number91; the presence of large num- that are present at high levels in primary mitochondrial Double minute DNAs bers of potentially highly polymorphic and diverged disorders have now been identified at low levels in infant (dmDNAs). Tiny fragments of NUMTs in tumours; and the potential to amplify cord blood15, at somewhat higher levels in the ageing extrachromosomal nuclear specific NUMTs selectively in dmDNAs. Therefore, population49,54 and at fairly high levels within target tis- DNA found in many tumours, (FIG. 2) derived from the amplification depending on the choice of primers , mutations sues in some of the most common pathologies that afflict 53 of small regions of in tumour NUMT DNA may be misattributed to those in humankind . Although we have made some progress in chromosomal DNA. authentic tumour mtDNA112. We note that when using the basic concepts of mitochondrial biology and

NATURE REVIEWS | GENETICS VOLUME 13 | DECEMBER 2012 | 887

genetics to deduce the pathogenesis of primary mito- no proven technology that will allow us to introduce chondrial OXPHOS disease, we are only now begin- exogenous mtDNA into mammalian mitochondria in ning to identify and to understand the role of secondary a stable and heritable way. Thus, we cannot make tar- mtDNA mutations in ageing, in Parkinson’s disease and geted mtDNA mutations to study basic issues in mito- perhaps in other disorders as well. chondrial biogenesis (for example, dissecting mtDNA Two technological issues will determine the pace elements controlling replication, transcription or trans- of further progress in the field. With respect to under- lation) nor can we introduce targeted mutations into standing the relationship of underlying mtDNA hap- mitochondria to generate cellular or animal models of lotypes to complex traits, the application of recent mtDNA-based disorders, be they primary, secondary technological advances — such as whole-exome or complex. However, after this major technical hurdle sequencing, whole-genome sequencing, high-through- has been overcome, the field will be poised to enter a put whole-transcriptome shotgun sequencing and revolutionary new phase in our understanding of mito- various ‘omics’ approaches (especially proteomics, chondrial biology and disease. To the question posed lipidomics and metabolomics) — to this problem may in 2000 regarding the phenotypic consequences of enable us to understand more clearly the relationship mtDNA mutations — ‘are we scraping the bottom of the of genotype to phenotype. However, there is currently barrel?’119 — the answer is a definite ‘no’.

1. Sagan, L. On the origin of mitosing cells. J. Theor. Biol. 17. Prezant, T. R. et al. Mitochondrial ribosomal RNA 32. Moraes, C. T. et al. Mitochondrial DNA depletion with 14, 255–274 (1967). mutation associated with both antibiotic-induced and variable tissue expression: a novel genetic abnormality 2. Garcia-Rodriguez, L. J. Appendix 1. Basic properties non-syndromic deafness. Nature Genet. 4, 289–294 in mitochondrial diseases. Am. J. Hum. Genet. 48, of mitochondria. Methods Cell Biol. 80, 809–812 (1993). 492–501 (1991). (2007). 18. Raimundo, N. et al. Mitochondrial stress engages This was the first description of a quantitative 3. Calvo, S. E. et al. Molecular diagnosis of infantile E2F1 apoptotic signaling to cause deafness. Cell 148, defect in mtDNA copy number causing disease. mitochondrial disease with targeted next-generation 716–726 (2012). 33. Nishigaki, Y., Marti, R., Copeland, W. C. & Hirano, M. sequencing. Sci. Transl. Med. 4, 118ra10 (2012). 19. Gilkerson, R. W. et al. Mitochondrial autophagy in cells Site-specific somatic mitochondrial DNA point This was one of the first applications of sequencing with mtDNA mutations results from synergistic loss of mutations in patients with thymidine phosphorylase the ‘mitochondrial exome’ (that is, ~1,500 nuclear transmembrane potential and mTORC1 inhibition. deficiency. J. Clin. Invest. 111, 1913–1921 (2003). genes encoding mitochondrial-targeted proteins) to Hum. Mol. Genet. 21, 978–990 (2012). This was the first description of a secondary identify pathogenic mutations causing 20. Gilkerson, R. W., Schon, E. A., Hernandez, E. & mitochondrial disorder causing mtDNA point mitochondrial disease. Davidson, M. M. Mitochondrial nucleoids maintain mutations. 4. Schaefer, A. M. et al. Prevalence of mitochondrial genetic autonomy but allow for functional 34. Nishino, I., Spinazzola, A. & Hirano, M. DNA disease in adults. Ann. Neurol. 63, 35–39 complementation. J. Cell Biol. 181, 1117–1128 Thymidine phosphorylase gene mutations in (2008). (2008). MNGIE, a human mitochondrial disorder. Science 5. Greaves, L. C., Reeve, A. K., Taylor, R. W. & 21. Sgarbi, G. et al. Inefficient coupling between proton 283, 689–692 (1999). Turnbull, D. M. Mitochondrial DNA and disease. transport and ATP synthesis may be the pathogenic 35. Kaukonen, J. et al. Role of adenine nucleotide J. Pathol. 226, 274–286 (2012). mechanism for NARP and Leigh syndrome resulting translocator 1 in mtDNA maintenance. Science 289, 6. Koopman, W. J., Willems, P. H. & Smeitink, J. A. from the T8993G mutation in mtDNA. Biochem. J. 782–785 (2000). Monogenic mitochondrial disorders. N. Engl. J. Med. 395, 493–500 (2006). 36. Van Goethem, G., Dermaut, B., Lofgren, A., Martin, J. J. 366, 1132–1141 (2012). 22. Holt, I. J., Harding, A. E. & Morgan-Hughes, J. A. & Van Broeckhoven, C. Mutation of POLG is associated 7. Ylikallio, E. & Suomalainen, A. Mechanisms of Deletions of muscle mitochondrial DNA in patients with progressive external ophthalmoplegia mitochondrial diseases. Ann. Med. 44, 41–59 (2012). with mitochondrial myopathies. Nature 331, characterized by mtDNA deletions. Nature Genet. 28, This is a comprehensive overview of mitochondrial 717–719 (1988). 211–212 (2001). respiratory chain disorders. 23. Lestienne, P. & Ponsot, G. Kearns-Sayre syndrome 37. Spelbrink, J. N. et al. Human mitochondrial DNA 8. Anderson, S. et al. Sequence and organization of the with muscle mitochondrial DNA deletion. Lancet 331, deletions associated with mutations in the gene human mitochondrial genome. Nature 290, 457–465 885–886 (1988). encoding Twinkle, a phage T7 gene 4‑like protein (1981). 24. Damas, J. et al. Mitochondrial DNA deletions are localized in mitochondria. Nature Genet. 28, 9. DiMauro, S. & Schon, E. A. Mitochondrial respiratory- associated with non‑B DNA conformations. Nucleic 223–231 (2001). chain diseases. N. Engl. J. Med. 348, 2656–2668 Acids Res. 40, 7606–7621 (2012). 38. Naviaux, R. K. & Nguyen, K. V. POLG mutations (2003). 25. Kearns, T. P. & Sayre, G. P. Retinitis pigmentosa, associated with Alpers’ syndrome and mitochondrial 10. Sacconi, S. et al. A functionally dominant external ophthalmophegia, and complete heart DNA depletion. Ann. Neurol. 55, 706–712 (2004). mitochondrial DNA mutation. Hum. Mol. Genet. 17, block: unusual syndrome with histologic study 39. Moraes, C. T. et al. Phenotype-genotype correlations 1814–1820 (2008). in one of two cases. AMA Arch. Ophthalmol. 60, in skeletal muscle of patients with mtDNA deletions. 11. Yoneda, M., Miyatake, T. & Attardi, G. Heteroplasmic 280–289 (1958). Muscle Nerve 3, S150–S153 (1995). mitochondrial tRNALys mutation and its 26. Moraes, C. T. et al. Mitochondrial DNA deletions 40. Cortopassi, G. A., Shibata, D., Soong, N. W. & complementation in MERRF patient-derived in progressive external ophthalmoplegia and Arnheim, N. A pattern of accumulation of a somatic mitochondrial transformants. Muscle Nerve 3, Kearns–Sayre syndrome. N. Engl. J. Med. 320, deletion of mitochondrial DNA in aging human S95–S101 (1995). 1293–1299 (1989). tissues. Proc. Natl Acad. Sci. USA 89, 7370–7374 12. Sciacco, M., Bonilla, E., Schon, E. A., DiMauro, S. & 27. Pearson, H. A. et al. A new syndrome of refractory (1992). Moraes, C. T. Distribution of wild-type and common sideroblastic anemia with vacuolization of marrow This was among the first reports that called deletion forms of mtDNA in normal and respiration- precursors and exocrine pancreatic dysfunction. attention to the accumulation of somatic mtDNA deficient muscle fibers from patients with J. Pediatr. 95, 976–984 (1979). deletions in normal ageing. mitochondrial myopathy. Hum. Mol. Genet. 3, 13–19 28. Nakase, H. et al. Transcription and translation of 41. Corral-Debrinski, M. et al. Mitochondrial DNA (1994). deleted mitochondrial genomes in Kearns–Sayre deletions in human brain: regional variability and 13. Santorelli, F. M., Shanske, S., Macaya, A., DeVivo, D. C. syndrome: implications for pathogenesis. Am. J. Hum. increase with advanced age. Nature Genet. 2, & DiMauro, S. The mutation at nt 8993 of Genet. 46, 418–427 (1990). 324–329 (1992). mitochondrial DNA is a common cause of Leigh’s This was one of the first studies providing insight 42. Meissner, C. et al. The 4977 bp deletion of syndrome. Ann. Neurol. 34, 827–834 (1993). into the pathomechanism of mtDNA deletion mitochondrial DNA in human skeletal muscle, heart 14. Holt, I. J., Harding, A. E., Petty, R. K. & disorders. and different areas of the brain: a useful biomarker or Morgan-Hughes, J. A. A new mitochondrial disease 29. Mita, S., Schmidt, B., Schon, E. A., DiMauro, S. & more? Exp. Gerontol. 43, 645–652 (2008). associated with mitochondrial DNA heteroplasmy. Bonilla, E. Detection of “deleted” mitochondrial 43. Pallotti, F., Chen, X., Bonilla, E. & Schon, E. A. Am. J. Hum. Genet. 46, 428–433 (1990). genomes in cytochrome‑c oxidase-deficient muscle Evidence that specific mtDNA point mutations may 15. Elliott, H. R., Samuels, D. C., Eden, J. A., Relton, C. L. fibers of a patient with Kearns-Sayre syndrome. not accumulate in skeletal muscle during normal & Chinnery, P. F. Pathogenic mitochondrial DNA Proc. Natl Acad. Sci. USA 86, 9509–9513 (1989). human aging. Am. J. Hum. Genet. 59, 591–602 mutations are common in the general population. 30. Moraes, C. T. et al. Molecular analysis of the (1996). Am. J. Hum. Genet. 83, 254–260 (2008). muscle pathology associated with mitochondrial 44. Simonetti, S., Chen, X., DiMauro, S. & Schon, E. A. This was the first large-scale epidemiological survey DNA deletions. Nature Genet. 1, 359–367 Accumulation of deletions in human mitochondrial of the prevalence of common pathological mtDNA (1992). DNA during normal aging: analysis by quantitative mutations in the normal population. 31. Ashley, N. et al. Defects in maintenance of PCR. Biochim. Biophys. Acta 1180, 113–122 (1992). 16. Stewart, J. B. et al. Strong purifying selection in mitochondrial DNA are associated with 45. Oldfors, A. et al. Mitochondrial DNA deletions and transmission of mammalian mitochondrial DNA. PLoS intramitochondrial nucleotide imbalances. Hum. Mol. cytochrome c oxidase deficiency in muscle fibres. Biol. 6, e10 (2008). Genet. 16, 1400–1411 (2007). J. Neurol. Sci. 110, 169–177 (1992).

888 | DECEMBER 2012 | VOLUME 13 www.nature.com/reviews/genetics

46. Bodyak, N. D., Nekhaeva, E., Wei, J. Y. & Khrapko, K. 68. Carelli, V. et al. Haplogroup effects and recombination 92. Bai, R. K. et al. Mitochondrial DNA content varies with Quantification and sequencing of somatic deleted of mitochondrial DNA: novel clues from the analysis pathological characteristics of breast cancer. J. Oncol. mtDNA in single cells: evidence for partially duplicated of Leber hereditary optic neuropathy pedigrees. 2011, 496189 (2011). mtDNA in aged human tissues. Hum. Mol. Genet. 10, Am. J. Hum. Genet. 78, 564–574 (2006). 93. King, M. P., Koga, Y., Davidson, M. & Schon, E. A. 17–24 (2001). This paper provieds a good example of the Defects in mitochondrial protein synthesis and 47. Vu, T. H. et al. Analysis of mtDNA deletions in muscle ‘synergistic’ relationship between specific mtDNA respiratory chain activity segregate with the by in situ hybridization. Muscle Nerve 23, 80–85 haplotypes and the severity of pathogenic tRNALeu(UUR) mutation associated with mitochondrial (2000). mtDNA point mutations. myopathy, encephalopathy, lactic acidosis, and 48. Petruzzella, V. et al. Extremely high levels of mutant 69. Hudson, G. et al. Clinical expression of Leber strokelike episodes. Mol. Cell. Biol. 12, 480–490 mtDNAs co‑localize with cytochrome c oxidase- hereditary optic neuropathy is affected by the (1992). negative ragged-red fibers in patients harboring a mitochondrial DNA-haplogroup background. 94. Miller, R. W. Dihydroorotate-quinone reductase of point mutation at nt‑3243. Hum. Mol. Genet. 3, Am. J. Hum. Genet. 81, 228–233 (2007). Neurospora crassa mitochondria. Arch. Biochem. 449–454 (1994). 70. Ghelli, A. et al. The background of mitochondrial DNA Biophys. 146, 256–270 (1971). 49. Bua, E. et al. Mitochondrial DNA-deletion mutations haplogroup J increases the sensitivity of Leber’s 95. Hayashi, J., Takemitsu, M. & Nonaka, I. Recovery of accumulate intracellularly to detrimental levels in aged hereditary optic neuropathy cells to 2,5‑hexanedione the missing tumorigenicity in mitochondrial DNA-less human skeletal muscle fibers. Am. J. Hum. Genet. 79, toxicity. PLoS ONE 4, e7922 (2009). HeLa cells by introduction of mitochondrial DNA from 469–480 (2006). 71. Anderson, C. D. et al. Common mitochondrial normal human cells. Somat. Cell. Mol. Genet. 18, 50. Schon, E. A. & Przedborski, S. Mitochondria: sequence variants in ischemic stroke. Ann. Neurol. 69, 123–129 (1992). the next (neurode)generation. Neuron 70, 471–480 (2011). 96. Morais, R. et al. Tumor-forming ability in athymic nude 1033–1053 (2011). 72. Arning, L. et al. Mitochondrial haplogroup H correlates mice of human cell lines devoid of mitochondrial DNA. 51. Vives-Bauza, C. et al. Control of mitochondrial with ATP levels and age at onset in Huntington disease. Cancer Res. 54, 3889–3896 (1994). integrity in Parkinson’s disease. Prog. Brain Res. 183, J. Mol. Med. 88, 431–436 (2010). 97. Peters, G. J. et al. In vivo inhibition of the pyrimidine 99–113 (2010). 73. Ingram, C. J. et al. Analysis of European case-control de novo enzyme dihydroorotic acid dehydrogenase 52. Narendra, D. P. & Youle, R. J. Targeting mitochondrial studies suggests that common inherited variation in by brequinar sodium (DUP‑785; NSC 368390) in dysfunction: role for PINK1 and Parkin in mitochondrial DNA is not involved in susceptibility to mice and patients. Cancer Res. 50, 4644–4649 mitochondrial quality control. Antioxid. Redox Signal. amyotrophic lateral sclerosis. Amyotroph. Lateral (1990). 14, 1929–1938 (2011). Scler. 13, 341–346 (2012). 98. Mourier, T., Hansen, A. J., Willerslev, E. & Arctander, P. 53. Bender, A. et al. High levels of mitochondrial 74. Hiona, A. & Leeuwenburgh, C. The role of The Human Genome Project reveals a continuous DNA deletions in substantia nigra neurons in mitochondrial DNA mutations in aging and sarcopenia: transfer of large mitochondrial fragments to the aging and Parkinson disease. Nature Genet. 38, implications for the mitochondrial vicious cycle theory nucleus. Mol. Biol. Evol. 18, 1833–1837 (2001). 515–517 (2006). of aging. Exp. Gerontol. 43, 24–33 (2008). 99. Ramos, A. et al. Nuclear insertions of mitochondrial This was the first report of correlating a 75. Khusnutdinova, E. et al. A mitochondrial etiology of origin: database updating and usefulness in cancer neurodegenerative disease with the accumulation neurodegenerative diseases: evidence from studies. Mitochondrion 11, 946–953 (2011). of mtDNA mutations in the clinically relevant Parkinson’s disease. Ann. NY Acad. Sci.1147, 1–20 100. Hazkani-Covo, E., Zeller, R. M. & Martin, W. Molecular target tissue. (2008). poltergeists: mitochondrial DNA copies (numts) in 54. Kraytsberg, Y. et al. Mitochondrial DNA deletions are 76. Mancuso, M., Filosto, M., Orsucci, D. & Siciliano, G. sequenced nuclear genomes. PLoS Genet. 6, abundant and cause functional impairment in aged Mitochondrial DNA sequence variation and e1000834 (2010). human substantia nigra neurons. Nature Genet. 38, neurodegeneration. Hum. Genom. 3, 71–78 (2008). 101. Lang, M. et al. Polymorphic Numts trace human 518–520 (2006). 77. Nishigaki, Y., Fuku, N. & Tanaka, M. Mitochondrial population relationships. Hum. Genet. 131, 757–771 55. Ekstrand, M. I. et al. Progressive parkinsonism haplogroups associated with lifestyle-related diseases (2012). in mice with respiratory-chain-deficient dopamine and longevity in the Japanese population. Geriatr. 102. Wang, D., Lloyd, A. H. & Timmis, J. N. Environmental neurons. Proc. Natl Acad. Sci. USA 104, Gerontol. Int. 10, S221–S235 (2010). stress increases the entry of cytoplasmic organellar 1325–1330 (2007). 78. Rose, G. et al. No evidence of association between DNA into the nucleus in plants. Proc. Natl Acad. Sci. 56. De Coo, I. F. et al. A 4‑base pair deletion in the frontotemporal dementia and major European mtDNA USA 109, 2444–2448 (2012). mitochondrial cytochrome b gene associated with haplogroups. Eur. J. Neurol. 15, 1006–1008 (2008). 103. Cheng, X. & Ivessa, A. S. The migration of parkinsonism/MELAS overlap syndrome. Ann. Neurol. 79. SanGiovanni, J. P. et al. Mitochondrial DNA variants of mitochondrial DNA fragments to the nucleus affects 45, 130–133 (1999). respiratory complex I that uniquely characterize the chronological aging process of Saccharomyces 57. Inoue, K. et al. Generation of mice with mitochondrial haplogroup T2 are associated with increased risk of cerevisiae. Aging Cell 9, 919–923 (2010). dysfunction by introducing mouse mtDNA carrying a age-related macular degeneration. PLoS ONE 4, This is a fascinating example of how mtDNA deletion into zygotes. Nature Genet. 26, 176–181 e5508 (2009). fragments can be transferred to the nucleus in (2000). 80. Sanchez-Ferrero, E. et al. Mitochondrial DNA ‘real time’ (that is, during the lifetime of an 58. Tyynismaa, H. et al. Mutant mitochondrial helicase polymorphisms/haplogroups in hereditary spastic individual). Twinkle causes multiple mtDNA deletions and a late- paraplegia. J. Neurol. 259, 246–250. 104. Caro, P. et al. Mitochondrial DNA sequences are onset mitochondrial disease in mice. Proc. Natl Acad. 81. Santoro, A. et al. Evidence for sub-haplogroup h5 of present inside nuclear DNA in rat tissues and increase Sci. USA 102, 17687–17692 (2005). mitochondrial DNA as a risk factor for late onset with age. Mitochondrion 10, 479–486 (2010). 59. Cann, R. L., Stoneking, M. & Wilson, A. C. Alzheimer’s disease. PLoS ONE 5, e12037 (2012). 105. Goldin, E. et al. Transfer of a mitochondrial DNA Mitochondrial DNA and human evolution. Nature 82. Sequeira, A. et al. Mitochondrial mutations and fragment to MCOLN1 causes an inherited case of 325, 31–36 (1987). polymorphisms in psychiatric disorders. Front. Genet. mucolipidosis IV. Hum. Mutat. 24, 460–465 (2004). 60. Ruiz-Pesini, E., Mishmar, D., Brandon, M., Procaccio, V. 3, 103 (2012). 106. Turner, C. et al. Human genetic disease caused by & Wallace, D. C. Effects of purifying and adaptive 83. Tranah, G. J. Mitochondrial-nuclear epistasis: de novo mitochondrial-nuclear DNA transfer. Hum. selection on regional variation in human mtDNA. implications for human aging and longevity. Ageing Genet. 112, 303–309 (2003). Science 303, 223–226 (2004). Res. Rev. 10, 238–252 (2012). 107. Willett-Brozick, J. E., Savul, S. A., Richey, L. E. & 61. Amo, T. & Brand, M. D. Were inefficient mitochondrial 84. McRae, A. F., Byrne, E. M., Zhao, Z. Z., Baysal, B. E. Germ line insertion of mtDNA at the haplogroups selected during migrations of modern Montgomery, G. W. & Visscher, P. M. Power and SNP breakpoint junction of a reciprocal constitutional humans? A test using modular kinetic analysis of tagging in whole mitochondrial genome association translocation. Hum. Genet. 109, 216–223 (2001). coupling in mitochondria from cybrid cell lines. studies. Genome Res. 18, 911–917 (2008). 108. Storlazzi, C. T. et al. Gene amplification as double Biochem. J. 404, 345–351 (2007). 85. Battersby, B. J. & Shoubridge, E. A. Selection of a minutes or homogeneously staining regions in solid 62. Saxena, R. et al. Comprehensive association mtDNA sequence variant in hepatocytes of tumors: origin and structure. Genome Res. 20, testing of common mitochondrial DNA variation in heteroplasmic mice is not due to differences in 1198–1206 (2010). metabolic disease. Am. J. Hum. Genet. 79, 54–61 respiratory chain function or efficiency of replication. 109. Valsesia, A. et al. Network-guided analysis of genes (2006). Hum. Mol. Genet. 10, 2469–2479 (2001). with altered somatic copy number and gene 63. Kadowaki, T. et al. A subtype of diabetes mellitus 86. Warburg, O., Wind, F. & Negelein, E. The metabolism expression reveals pathways commonly perturbed in associated with a mutation of mitochondrial DNA. N. of tumors in the body. J. Gen. Physiol. 8, 519–530 metastatic melanoma. PLoS ONE 6, e18369 (2011). Engl. J. Med. 330, 962–968 (1994). (1927). 110. Hirano, T. et al. Co‑localization of mitochondrial and This was an important survey that demonstrated 87. Polyak, K. et al. Somatic mutations of the double minute DNA in the nuclei of HL‑60 cells but the importance of a specific mtDNA mutation as a mitochondrial genome in human colorectal tumours. not normal cells. Mutat. Res. 425, 195–204 (1999). cause of diabetes mellitus. Nature Genet. 20, 291–293 (1998). 111. Lee, J. H., Ryu, T. Y., Cho, C. H. & Kim, D. K. 64. Bitner-Glindzicz, M. et al. Prevalence of mitochondrial 88. Yu, M. Generation, function and diagnostic value of Different characteristics of mitochondrial 1555A→G mutation in European children. N. Engl. mitochondrial DNA copy number alterations in human microsatellite instability between uterine leiomyomas J. Med. 360, 640–642 (2009). cancers. Life Sci. 89, 65–71 (2011). and leiomyosarcomas. Pathol. Oncol. Res. 17, 65. Vandebona, H. et al. Prevalence of mitochondrial 89. Melnick, P. J. Enzyme patterns of tumors 201–205 (2011). 1555A→G mutation in adults of European descent. demonstrated histochemically in cryostat sections. 112. Ellinger, J. et al. Circulating mitochondrial DNA in N. Engl. J. Med. 360, 642–644 (2009). Ann. NY Acad. Sci.125, 689–715 (1965). serum: A universal diagnostic biomarker for patients 66. Andreu, A. L. et al. Exercise intolerance due 90. Pelicano, H. et al. Mitochondrial respiration defects in with urological malignancies. Urol. Oncol. 30, to mutations in the cytochrome b gene of cancer cells cause activation of Akt survival pathway 509–515 (2012). mitochondrial DNA. N. Engl. J. Med. 341, through a redox-mediated mechanism. J. Cell Biol. 113. Kiebish, M. A. & Seyfried, T. N. Absence of pathogenic 1037–1044 (1999). 175, 913–923 (2006). mitochondrial DNA mutations in mouse brain tumors. 67. Elson, J. L., Majamaa, K., Howell, N. & Chinnery, P. F. 91. Yu, M. et al. Reduced mitochondrial DNA copy BMC Cancer 5, 102 (2005). Associating mitochondrial DNA variation with complex number is correlated with tumor progression and 114. Ericson, N. G. et al. Decreased mitochondrial DNA traits. Am. J. Hum. Genet. 80, 378–382; author reply prognosis in Chinese breast cancer patients. IUBMB mutagenesis in human colorectal cancer. PLoS Genet. 382–383 (2007). Life 59, 450–457 (2007). 8, e1002689 (2012).

NATURE REVIEWS | GENETICS VOLUME 13 | DECEMBER 2012 | 889

115. Chinnery, P. F., Samuels, D. C., Elson, J. & 129. Rodriguez-Juarez, F., Aguirre, E. & Cadenas, S. 141. Gogvadze, V., Orrenius, S. & Zhivotovsky, B. Turnbull, D. M. Accumulation of mitochondrial DNA Relative sensitivity of soluble guanylate cyclase and Mitochondria in cancer cells: what is so special about mutations in ageing, cancer, and mitochondrial mitochondrial respiration to endogenous nitric oxide them? Trends Cell Biol. 18, 165–173 (2008). disease: is there a common mechanism? Lancet 360, at physiological oxygen concentration. Biochem. J. 142. Madan, E. et al. Regulation of glucose metabolism by 1323–1325 (2002). 405, 223–231 (2007). p53: emerging new roles for the tumor suppressor. 116. Parr, R. L. et al. The pseudo-mitochondrial genome 130. Koga, Y. et al. l‑arginine improves the symptoms Oncotarget 2, 948–957 (2011). influences mistakes in heteroplasmy interpretation. of strokelike episodes in MELAS. Neurology 64, 143. van Nederveen, F. H. et al. An immunohistochemical BMC Genomics 7, 185 (2006). 710–712 (2005). procedure to detect patients with paraganglioma and 117. Maki, J. et al. Mitochondrial genome deletion aids in 131. Horvath, R. et al. Molecular basis of infantile phaeochromocytoma with germline SDHB, SDHC, or the identification of false- and true-negative prostate reversible cytochrome c oxidase deficiency myopathy. SDHD gene mutations: a retrospective and prospective needle core biopsy specimens. Am. J. Clin. Pathol. Brain 132, 3165–3174 (2009). analysis. Lancet Oncol. 10, 764–771 (2009). 129, 57–66 (2008). An unexpected connection is presented in this 144. Tomlinson, I. P. et al. Germline mutations in FH 118. Parr, R. L. et al. Somatic mitochondrial DNA mutations paper between an mtDNA mutation and a predispose to dominantly inherited uterine fibroids, in prostate cancer and normal appearing adjacent mitochondrial disorder with an unusual course. skin leiomyomata and papillary renal cell cancer. glands in comparison to age-matched prostate 132. Uusimaa, J. et al. Reversible infantile respiratory chain Nature Genet. 30, 406–410 (2002). samples without malignant histology. J. Mol. Diagn. 8, deficiency is a unique, genetically heterogenous 145. Selak, M. A. et al. Succinate links TCA cycle 312–319 (2006). mitochondrial disease. J. Med. Genet. 48, 660–668 dysfunction to oncogenesis by inhibiting HIF‑α prolyl 119. DiMauro, S. & Andreu, A. L. Mutations in mtDNA: (2011). hydroxylase. Cancer Cell 7, 77–85 (2005). are we scraping the bottom of the barrel? Brain 133. Umeda, N. et al. Mitochondria-specific RNA- 146. Lemasters, J. J. & Holmuhamedov, E. Pathol. 10, 431–441 (2000). modifying enzymes responsible for the biosynthesis Voltage-dependent anion channel (VDAC) as 120. Giordano, C. et al. Oestrogens ameliorate of the wobble base in mitochondrial tRNAs. mitochondrial governator — thinking outside the box. mitochondrial dysfunction in Leber’s hereditary Implications for the molecular pathogenesis of Biochim. Biophys. Acta 1762, 181–190 (2006). optic neuropathy. Brain 134, 220–234 (2011). human mitochondrial diseases. J. Biol. Chem. 280, 147. Majewski, N., Nogueira, V., Robey, R. B. & Hay, N. 121. Kaufmann, P. et al. Natural history of MELAS 1613–1624 (2005). Akt inhibits apoptosis downstream of BID cleavage associated with mitochondrial DNA m.3243A>G 134. Yan, Q. et al. Human TRMU encoding the via a glucose-dependent mechanism involving genotype. Neurology 77, 1965–1971 (2011). mitochondrial 5‑methylaminomethyl-2‑thiouridylate- mitochondrial hexokinases. Mol. Cell. Biol. 24, 122. Tay, S. H. et al. Aortic rupture in mitochondrial methyltransferase is a putative nuclear modifier 730–740 (2004). encephalopathy, lactic acidosis, and stroke-like gene for the phenotypic expression of the 148. Jain, M. et al. Metabolite profiling identifies a key role episodes. Arch. Neurol. 63, 281–283 (2006). deafness-associated 12S rRNA mutations. for glycine in rapid cancer cell proliferation. Science 123. Chong, P. S., Vucic, S., Hedley-Whyte, E. T., Biochem. Biophys. Res. Commun. 342, 1130–1136 336, 1040–1044 (2012). Dreyer, M. & Cros, D. Multiple symmetric (2006). 149. DiMauro, S., Hirano, M. & Schon, E. A. Approaches lipomatosis (Madelung’s disease) caused by the 135. King, M. P. & Attardi, G. Human cells lacking mtDNA: to the treatment of mitochondrial diseases. Muscle MERRF (A8344G) mutation: a report of two cases repopulation with exogenous mitochondria by Nerve 34, 265–283 (2006). and review of the literature. J. Clin. Neuromuscul. complementation. Science 246, 500–503 (1989). Dis. 5, 1–7 (2003). This was the first description of the use of cybrid Acknowledgements 124. Suzuki, T., Nagao, A. & Suzuki, T. Human technology in mammalian cells. The authors were supported by grants from the US National mitochondrial diseases caused by lack of taurine 136. King, M. P. & Attardi, G. Isolation of human cell lines Institutes of Health (HD32062), the US Department of modification in mitochondrial tRNAs. Wiley lacking mitochondrial DNA. Methods Enzymol. 264, Defense (W911NF-12‑1‑0159), the Muscular Dystrophy Interdiscip. Rev. RNA 2, 376–386 (2011). 304–313 (1996). Association, the Ellison Medical Foundation, the Alzheimer 125. Hasegawa, H., Matsuoka, T., Goto, Y. & Nonaka, I. 137. Engel, W. K. & Cunningham, G. G. Rapid examination Drug Discovery Foundation and the Marriott Mitochondrial Cytochrome c oxidase activity is deficient in blood of muscle tissue. An improved trichrome method Disorder Clinical Research Fund. vessels of patients with myoclonus epilepsy with for fresh-frozen biopsy sections. Neurology 13, ragged-red fibers. Acta Neuropathol. 85, 280–284 919–923 (1963). Competing interests statement (1993). 138. Bonilla, E. et al. New morphological approaches to The authors declare competing financial interests: see Web 126. Naini, A. et al. Hypocitrullinemia in patients the study of mitochondrial encephalomyopathies. version for details. with MELAS: an insight into the “MELAS Brain Pathol. 2, 113–119 (1992). paradox”. J. Neurol. Sci. 229–230, 187–193 In this paper, a comprehensive survey is presented (2005). of morphological approaches used to diagnose and FURTHER INFORMATION 127. Shiva, S., Brookes, P. S., Patel, R. P., Anderson, P. G. & study mitochondrial diseases. Eric Schon’s homepage 1: http://web.neuro.columbia.edu/ Darley-Usmar, V. M. Nitric oxide partitioning into 139. Quinzii, C. M. et al. Reactive oxygen species, members/profiles.php?id=207 mitochondrial membranes and the control of oxidative stress, and cell death correlate with Eric Schon’s homepage 2: http://asp.cumc.columbia.edu/ facdb/profile_list.asp?DepAffil=Genetics&uni=eas3 respiration at cytochrome c oxidase. Proc. Natl Acad. level of CoQ10 deficiency. FASEB J. 24, 3733–3743 Sci. USA 98, 7212–7217 (2001). (2010). Salvatore DiMauro’s homepage: http://web.neuro.columbia. 128. Torres, J., Darley-Usmar, V. & Wilson, M. T. 140. Loveland, B., Wang, C. R., Yonekawa, H., Hermel, E. & edu/members/profiles.php?id=24 Inhibition of cytochrome c oxidase in turnover Lindahl, K. F. Maternally transmitted Michio Hirano’s homepage: http://web.neuro.columbia.edu/ by nitric oxide: mechanism and implications for histocompatibility antigen of mice: a hydrophobic members/profiles.php?id=42 control of respiration. Biochem. J. 312, 169–173 peptide of a mitochondrially encoded protein. Cell 60, ALL LINKS ARE ACTIVE IN THE ONLINE PDF (1995). 971–980 (1990).

890 | DECEMBER 2012 | VOLUME 13 www.nature.com/reviews/genetics

Mitochondrial diseases

Anthony H V Schapira

Mitochondria have a crucial role in cellular bioenergetics and apoptosis, and thus are important to support cell Lancet 2012; 379: 1825–34 function and in determination of cell death pathways. Inherited mitochondrial diseases can be caused by mutations Published Online of mitochondrial DNA or of nuclear genes that encode mitochondrial proteins. Although many mitochondrial April 5, 2012 disorders are multisystemic, some are tissue specifi c—eg, optic neuropathy, sensorineural deafness, and type 2 DOI:10.1016/S0140- 6736(11)61305-6 diabetes mellitus. In the past few years, several disorders have been associated with mutations of nuclear genes Department of Clinical responsible for mitochondrial DNA maintenance and function, and the potential contribution of mitochondrial Neurosciences, Institute of abnormalities to progressive neurodegenerative diseases such as Parkinson’s disease and Alzheimer’s disease has Neurology, University College been recognised. The process of mitochondrial fi ssion-fusion has become a focus of attention in human disease. London, London, UK Importantly, the mitochondrion is now a target for therapeutic interventions that encompass small molecules, (Prof A H V Schapira MD) transcriptional regulation, and genetic manipulation, off ering opportunities to treat a diverse range of diseases. Correspondence to: Prof Anthony H V Schapira, Department of Clinical Introduction complexes, causing secondary respiratory chain defects. Neurosciences, Institute of Advances in genetics and cell biology have provided Mutations in several nuclear genes encoding other Neurology, London NW3 2PF, UK valuable insights into the function of mitochondria and mitochondrial proteins have been described. These [email protected] into the contribution of defects of mitochondrial mutations aff ect many mitochondrial functions and can metabolism to human disease. Almost 200 diff erent have secondary eff ects on oxidative phosphorylation and mutations of mitochondrial DNA (mtDNA) have been other processes. Some of these mutations are consistently reported in human beings. This Seminar provides an associated with specifi c phenotypes—eg, parkin and update on the pathogenesis of diseases (particularly PINK1 with Parkinson’s disease, MFN2 with Charcot- neurodegenerative disorders) associated with mitochon- Marie-Tooth disease type 2A, and frataxin with drial dysfunction, and reviews the emerging area of Friedreich’s ataxia (table 4). Thus mitochondrial diseases mitochondrial pharmacology. The appendix summarises can be associated with several primary genetic causes See Online for appendix the basic biology of mitochondria and disease.1–3 Other aff ecting either genome and conceptually, need not be important areas of interest to mitochondrial biology and restricted to defects of the respiratory chain. pathology that cannot be covered in detail here include Mitochondrial dysfunction has been identifi ed in neoplasia and anticancer therapies. The relation between several other disorders—eg, Alzheimer’s disease, Hunt- neurodegeneration and cancer has been highlighted4 and ington’s disease, and amyotrophic lateral sclerosis— the potential for somatic mutations of mtDNA to aff ect where either no causative mutation has been noted or the both the cell biology of neoplasia and the sensitivity or mitochondrial eff ects are secondary to biochemical resistance of cells to chemotherapy has been noted. abnormalities induced by the identifi ed mutation (eg, huntingtin in Huntington’s disease). Whether such Defi nition mitochondrial abnormalities contribute to the patho- Abnormalities of mitochondrial function that contribute genesis of these diseases remains to be defi ned. or lead to human disease can derive from several sources. Mutations of mtDNA are a primary cause and can be Mitochondrial quality control due to inherited sequence changes in the mtDNA Mitochondria can divide (fi ssion) or fuse, and these genome (eg, deletions, rearrangements, point mutations processes are important to mitochondrial transport. [table 1]), secondary to nuclear gene mutations causing, Fission-fusion is regulated by several signalling proteins, for example, mtDNA multiple deletions or depletion such as mitofusins 1 and 2, which mediate fusion of (table 2), or somatic—eg, as result of free-radical- mitochondrial outer membranes, and optic atrophy mediated damage or faulty repair. Since the genome encodes 13 proteins of the respiratory chain, the resulting mutations of mtDNA usually, but not always, induce Search strategy and selection criteria defects of respiratory chain function. I searched PubMed and Medline with the search terms Primary respiratory chain diseases can be thought of “mitochondrial DNA”, “polymerase gamma”, “mitochondria”, as the result of mutations of mtDNA or nuclear genes “Parkinson’s disease”, “mitochondrial biogenesis” encoding respiratory chain subunits (table 3). Mutations “neurodegeneration”, “diabetes”, “Alzheimer’s disease”, and of nuclear genes encoding respiratory chain subunits “Huntington’s disease” for articles published between tend to present early in infancy or childhood (although January, 2005, and July, 2011. Papers were also identifi ed adult onset cases are described) and are usually fatal. from the references lists of relevant articles and through Nuclear gene mutations can aff ect not only mtDNA searches of my fi les. Only papers published in English or with structure (deletions) and content (depletion), but abstracts in English were selected. also assembly and maintenance of respiratory chain www.thelancet.com Vol 379 May 12, 2012 1825 Seminar

Common genotype Chronic progressive external ophthalmoplegia Single or multiple deletions Kearns-Sayre syndrome Single deletions Pearson marrow-pancreas syndrome Single deletions Mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes tRNA mutation (eg, 3243A→G) Myoclonic epilepsy with ragged red ﬁ bres tRNA mutation (eg, 8344A→G) Leber’s hereditary optic neuropathy Complex I gene mutations (eg, 11778G→A, 14484 T→C, 3460 G→A) Neurogenic ataxia with retinitis pigmentosa Complex V mutations (eg, 8993 T→G/C) Myopathy Deletions (eg, 14709 T→C, cytochrome b) Cardiomyopathy tRNA mutations (eg, 3243 A→G, 4269 A→G) Diabetes or deafness, or both tRNA mutations (eg, 3243 A→G, 12258 C→A, 7445 A→G)

tRNA=transfer ribonucleic acid.

Table 1: Common mitochondrial DNA mutation diseases, by phenotype

(fi gure).5 Some evidence suggests that inhibition of mtDNA Phenotype mitochondrial fi ssion by knockdown of dynamin-1-like Polymerase gamma Multiple deletions, depletion CPEO (autosomal dominant or protein 1 or fi ssion 1 homologue can lead to an increase in autosomal recessive) the proportion of mutant mtDNA in cells carrying the Adenine nucleotide transporter 1 Multiple deletions CPEO mtDNA mutation A3243G, which is associated with Twinkle Multiple deletions CPEO mitochondrial encephalomyopathy, lactic acidosis, and Deoxyguanosine kinase Depletion Infantile hepatocerebral failure stroke-like episodes (MELAS).7 Knockout of mitofusin 2 Thymidine kinase 2 Depletion Infantile myopathy in mice results in a substantial reduction in mtDNA Thymidine phosphorylase Multiple deletions, depletion Mitochondrial neurogastrointestinal content, which is followed by an increase in mtDNA encephalomyopathy mutation content and morphological abnormalities in Ribonucleotide reductase Multiple deletions, depletion Kearns-Sayre syndrome, CPEO, encephalopathy, and tubulopathy skeletal muscle. These fi ndings further emphasise the Succinate coenzyme A ligase Depletion Leigh’s syndrome, deafness, and importance of fi ssion-fusion to mtDNA mutation load, methylmalonic aciduria the potential expression of disease, and the opportunity to MPV17 encoding inner Depletion Infantile hepatocerebral failure manipulate this process in favour of wildtype mtDNA. membrane protein Parkin and PTEN-induced putative kinase 1 (PINK1) CPEO=chronic progressive external ophthalmoplegia. proteins have an important role in the mitophagy pathway.8 Parkin is a ubiquitin protein ligase and translocates Table 2: Non-oxidative phosphorylation nuclear gene defects aff ecting mtDNA structure or function, from the cytosol to the mitochondrion in response to a fall by protein in mitochondrial membrane potential.9 This translocation might be preceded by phosphoryl ation of parkin by protein 1, a dynamin-like GTPase involved in fusion of PINK1.10 Parkin is also involved in the ubiquitination of the inner membranes. Dynamin-1-like protein 1 and mitofusins 1 and 2.11 Mutations of the parkin, PINK1, and fi ssion 1 homologue regulate mitochondrial fi ssion.5 HTRA2 genes lead to Parkinson’s disease,12 and evidence An important function of the fi ssion-fusion process is is accumulating that defects of the mitophagy pathway to maintain the eff ectiveness, or quality, of cell mito- contribute to the pathogenesis of this disease.13 chondria.6 Defective mitochondrial function as a con- That mitochondrial function declines with age has sequence of mtDNA or nuclear mutations, or as a result been known for some time, with an accumulation of of certain external toxins, can reduce effi ciency of ATP mtDNA deletions (usually multiple), deteriorating res- synthesis and increase free-radical production. These piratory chain function, and evidence of increased factors will reduce membrane potential and the threshold damage mediated by free radicals.14–16 An increase in for apoptotic cell death. Thus, repair or removal of rates of mtDNA mutation or a reduction in cell defective mitochondria helps to maintain cell integrity antioxidant concentrations accelerates senescence,17 and function. Part of the signalling system for mito- whereas upregulation of antioxidant enzymes can chondrial quality control involves the activation of the reverse this acceleration.18 Evidence suggests that AMP-activated protein kinase, which in turn reduces mitochondrial quality control declines with age,19 which function of the mammalian target of rapamycin complex 1. in turn will result in further free-radical-mediated This complex is an important activator of mitochondrial damage from accumulating defective mitochondria. metabolism and biogenesis, which might turn the balance Protein disposal activity by the ubiquitin proteasomal in favour of mitochondrial fi ssion and destruction via and autophagy systems declines,20 which promotes autophagy (mitophagy) rather than fusion and biogenesis protein accumula tion and aggregation. Thus the normal

1826 www.thelancet.com Vol 379 May 12, 2012 Seminar

process of mitochondrial senescence promotes the same Gene Common phenotype pathogenetic pathways that are thought to bring about cell dysfunction in several neurodegenerative diseases. Nuclear gene defects aff ecting individual oxidative phosphorylation proteins, by protein complex Complex I NDUFS 1–4, 6–8, V1, V2, Leigh’s syndrome mtDNA mutations and disease AI, A2, AII, FI, F2 Complex II Leigh’s syndrome, tumours The prevalence of mtDNA mutations is diffi cult to SDHA–SDHD establish with accuracy, especially because of the high Complex III BCS1L Myopathy, encephalopathy, liver disease asymptomatic carrier rate. However, studies have shown Complex IV SURF1, SCO1, SCO2, Leigh’s syndrome, encephalopathy, COX10, COX15, COX6B1, liver failure 21,22 a prevalence for specifi c mutations of 0·14–0·20%. FASTKD2, ETHE1 mtDNA mutations are associated with a very wide range Complex V ATPAF2, ATP5E Encephalopathy of clinical expression (table 1). Manifestations of mtDNA Combined oxidative phosphorylation defects, by protein mutations vary from oligosymptomatic states (eg, isolated Mitochondrial ribosomal protein S16 MRPS16 Agenesis of the corpus callosum, sensorineural deafness or type 2 diabetes) to complex dysmorphism, and fatal neonatal multisystem syndromes that might involve neurological, lactic acidosis endocrine, cardiological, dermatological, and gastro- Mitochondrial elongation factor G1 GFM Leigh’s syndrome enterological features. Many of these disorders have been Mitochondrial elongation factor Tu TUFM Leigh’s syndrome reviewed extensively, in combination with the ideas of Mitochondrial translation elongation TSFM Encephalomyopathy, hypertrophic heteroplasmy, clonal expansion, mutation thresholds, factor Ts cardiomyopathy and genetic bottleneck.1,2 Most mtDNA mutations Table 3: Nuclear gene mutations causing oxidative phosphorylation defects function recessively, in that 60–90% mutation load is needed before a biochemical defect is noted. DNA sequence variations (nuclear or mitochondrial) can aff ect Function Disease 23,24 the expression of specifi c mtDNA mutations. Mitofusin 2 Dynamin-related protein Charcot-Marie-Tooth disease type 2 mtDNA rearrangements in the form of deletions and Coenzyme Q10 Q10 function Ataxia, Leigh’s syndrome; a quantitative reduction of mtDNA concentrations biosynthesis protein hepatorenal failure 25 (depletion) are important causes of disease. Single ABC7 Iron exporter X-linked ataxia/sideroblastic anaemia deletion populations are usually inherited from the Frataxin Iron storage protein Friedreich’s ataxia germline, whereas multiple deletions and depletion are Paraplegin Metalloprotease Hereditary spastic paraplegia often the result of primary mutations in nuclear genes Optic atrophy protein 1 Dynamin-related protein Autosomal dominant optic atrophy that are involved in mtDNA function. Mutations of the DJ1 Oxidant-sensing protein Parkinsonism mitochondrial DNA polymerase gamma (POLG) gene PTEN-induced kinase 1 Respiratory chain function, mtDNA Parkinsonism cause multiple deletions or depletion of mtDNA alone or maintenance, mitophagy in combination.26 Patients might present in infancy with Parkin Mitophagy Juvenile parkinsonism myopathy or hepatocerebral disease, in adulthood with Table 4: Non-oxidative phosphorylation nuclear-encoded mitochondrial proteins and disease, by protein ophthalmoplegia and myopathy, or with a more complex phenotype that could include myopathic features, encephalopathy, polyneuropathy, reduced fertility, and A mutation in the mitochondrial-associated apoptosis parkinsonism. Thus the genotype of mtDNA depletion is initiating factor has been associated in infancy with associated with a wide range of clinical manifestations X-linked mitochondrial encephalomyopathy that is and has many diff erent genetic causes (table 2).27 partially responsive to ribofl avin.32 The relation between Several models of mitochondrial disease help to explain mtDNA mutations and their eff ect on cell survival and some of the mechanisms involved in pathogenesis— response to apoptotic signals or endoplasmic-reticulum- eg, yeast, transmitochondrial cybrids, and mouse models, induced stress is likely to be complex. which include those that incorporate mutations of nuclear genes that produce mtDNA deletions or depletion. Mouse Respiratory chain defects models of POLG mutations have expressed features of The fi ve protein complexes of the oxidative phos- accelerated senescence (progeria) and parkinsonism.17,28 phorylation system can be rendered defective by any of Disruption of mitochondrial transcription factor A in the mtDNA mutations outlined in this Seminar, or by mice also leads to loss of dopaminergic neurons and mutations of nuclear genes encoding oxidative phos- some elements of a parkinsonian phenotype.29 phorylation proteins. Selective dysfunction of a complex mtDNA mutations impair respiratory chain function can occur, but combinations of defects are more common and oxidative phosphorylation if present in suffi cient (table 3). Pure complex I defects are seen as a result of proportions, and so reduce cellular energy supply. mutations of mtDNA complex I genes, such as in Leber’s Additionally, there could be an associated increase in hereditary optic neuropathy, or of nuclear complex I free-radical production and potentially in excitotoxic- genes, which often cause Leigh’s syndrome. Complex II mediated damage.30 Mitochondria have an important role defects are rare and caused by mutations in the nuclear in mediation of cell signals for the initiation of apoptosis.31 genome. These defects can be associated with Leigh’s www.thelancet.com Vol 379 May 12, 2012 1827 Seminar

Fusion thymidine phosphorylase), or more defi nitively with bone marrow transplantation.39 MFN1, MFN2 Alternative strategies such as resistance exercise training programmes have improved oxidative phos- OPA1 phorylation but no change was noted in the mutant to wildtype ratio of deleted mtDNA.40 The changes in FIS1, DRP1 Fission oxidative phosphorylation can be aff ected partly by an Healthy Defective increase in activation of muscle satellite cells. Endurance mitochondria mitochondria training has improved oxidative phosphorylation capacity and exercise tolerance in patients with Reduced membrane myopathy,41 but was accompanied by an increase in potential mutant mtDNA load in one study.42 A range of techniques PINK1, parkin to manipulate mutant mtDNA and its products are in early development.43 Mitophagy Genetic counselling for mtDNA diseases is a challenge Figure: A simplifi ed representation of the mitochondrial fi ssion-fusion cycle because of the diffi culty with prediction of clinical Mitofusins 1 and 2 (MFN1 and MFN2) and optic atrophy protein 1 (OPA1) expression in off spring.1 Importantly, appropriate coun- mediate mitochondrial fusion. Defects in mitochondrial function can promote selling for mtDNA defects relies on an accurate fi ssion mediated through fi ssion 1 homologue (FIS1) and dynamin-1-like protein 1 (DRP1). Repaired daughter mitochondria re-enter the mitochondrial molecular genetic diagnosis. Primary mtDNA point pool by fusion, and remaining defective mitochondria with reduced mutations such as those that cause MELAS and myo- mitochondrial membrane potential are targeted by PTEN-induced putative clonic epilepsy with ragged red fi bres are inherited kinase 1 (PINK1) and parkin to mediate destruction by autophagy (mitophagy). through the female line alone and can usually be detected in the blood. Aff ected men do not transmit the disease. syndrome, carotid body paragangliomas, and phaeo- Single mtDNA deletions usually arise in the maternal chromocytomas. Complex III defects are rare either alone germline, are rarely present in the blood, and although or in combination, but mutations of the mtDNA gene off spring might be aff ected, subsequent transmission is encoding cytochrome b or the nuclear BCS1L gene uncommon. Multiple mtDNA deletions are usually account for most described to date. Patients might secondary to a nuclear gene defect and, together with present with myopathy alone or complex multisystem other mitochondrial diseases due to nuclear gene muta- disorders. Complex IV (cytochrome oxidase) defects are tions, are subject to mendelian inheritance. Diag nosis common and can be caused by mutations of the COX by abnormal muscle morphology or defective respiratory mtDNA genes, nuclear genes of cytochrome oxidase chain enzyme function is not suffi cient to provide the subunits, or cytochrome oxidase assembly and main- basis for accurate counselling as both can be caused by tenance proteins. Clinical presentation can vary from mutations of either genome. pure myopathy to Leigh’s syndrome. Mutations of A novel strategy to prevent transmission that combines complex V (ATPase) genes in either mitochondrial or both counselling and treatment is mitochondrial gene nuclear genomes have been described, with clinical replacement that involves the exchange of maternal eff ects of varying severity. mtDNA with that of a healthy donor.44,45 This technique requires in-vitro fertilisation with the parent ovum and Management of diseases with mtDNA mutations sperm, removal of the pronucleus from the resulting Guidelines for the diagnosis of mtDNA diseases have zygote, and fusion into an enucleated donor oocyte been published.33 Early attempts to treat primary (cytoplast). The reconstituted zygote can then be mitochondrial disorders used supplements, vitamins, implanted into the mother’s uterus for development. substrates, or electron carriers—eg, coenzyme Q10.34,35 Inevitably, this process requires the molecular diagnosis However, many of these treatments were of little value to have been made in the host woman (and excluded in and no randomised studies with a suffi ciently large the donor), and is an important potential therapy for number of patients to provide a defi nitive result were female mutation carriers. done. Coenzyme Q is of clear benefi t to patients with primary coenzyme Q10 defi ciency, and creatine is useful Mitochondrial dysfunction and in the treatment of creatine defi ciency.36 Benefi t of Parkinson’s disease L-arginine in MELAS on the basis of its vasodilatory Mitochondrial dysfunction in Parkinson’s disease was action has been reported anecdotally,37 but further assess- fi rst identifi ed in 1989, and accumulating evidence ment is needed. Mitochondrial neurogastrointestinal suggests a primary role in pathogenesis.46–48 An early encephalomyopathy is due to a defect of thymidine consideration was whether mtDNA mutations might phosphorylase and might be the result of mutations in account for a proportion of Parkinson’s disease cases. nuclear or mitochondrial genomes.38 The disorder can be However, no large-scale mtDNA rearrangements were treated temporarily with platelet infusions (that contain recorded in brains of patients with Parkinson’s disease,49

1828 www.thelancet.com Vol 379 May 12, 2012 Seminar

although more detailed analysis with laser capture of with Parkinson’s disease. Point mutations or dopaminergic neurons from parkinsonian brains showed multiplications of the α-synuclein gene cause familial a greater proportion of deleted mtDNA than for age- Parkinson’s disease. α-synuclein is predominantly matched controls.50 An analysis reported no bias towards cytosolic but a fraction has been identifi ed in mito- either maternal inheritance or the mtDNA haplotype chondria,68 and has been noted to interact directly with 10398G in Parkinson’s disease.51 mitochondrial membranes, including at the neuronal However, mendelian genetics seem to have a substan- synapse,69 and to inhibit complex I in a dose-dependent tial role in linkage of mitochondrial dysfunction to manner that shows regional expression of the protein.70,71 Parkinson’s disease.52 Three of the gene products causing In addition to genetic causes, several environmental autosomal recessive familial Parkinson’s disease have a factors have been associated with both mitochondrial mitochondrial location. PINK1 protein has been localised dysfunction and Parkinson’s disease or parkinsonism, to mitochondria in several tissues.53 Its function is not including a range of mitochondrial complex I inhibitors completely understood, but the protein is important in that are toxic to dopaminergic neurons.72–74 mitochondrial free-radical metabolism, calcium homoeostasis, and mtDNA maintenance.54–56 Fibroblasts from Mitochondrial dysfunction and patients with Parkinson’s disease with PINK1 mutations Alzheimer’s disease and PINK1 gene knockout models show defective Apart from age, important risk factors for Alzheimer’s oxidative phosphorylation, increased free radical damage, disease include apolipoprotein ε4 status and mutations and reduced mitochondrial numbers.57–59 of amyloid precursor protein or presenilin. Investigators Parkin mutations predominantly cause parkinsonism in of several studies have reported abnormalities of mito- patients younger than 30 years. Mitochondrial dysfunction chondrial structure or function, or mtDNA defects in the and increased oxidative stress have been described in brain or other tissues and cells of patients with parkin-defi cient Drosophila, mouse models, and periph- Alzheimer’s disease, but the presence and relevance of eral tissues in patients with parkin-mutation-positive these fi ndings have remained controversial, and the data Parkinson’s disease.60–62 Parkin is a ubiquitin E3 ligase and derived have not always been reproducible. regulates expression of peroxisome-proliferator-activated However, new fi ndings have brought a diff erent receptor γ coactivator 1α (PGC1α) through interaction with perspective to mitochondrial involvement in Alzheimer’s parkin interacting substrate protein, which represses disease pathogenesis. Polymorphism of the TOMM40 expression of PGC1α and nuclear respiratory factor 1.63 gene (2 kilobases away from the APOE 4 gene on Importantly, the mutations of parkin or PINK1 that cause chromosome 19) seems to be an important risk factor for Parkinson’s disease seem to interfere with mitophagy Alzheimer’s disease and age of onset.75 TOMM40 is an effi ciency and result in accumulation of defective mito- outer mitochondrial membrane protein that forms part chondria.11 This process can be reversed by upregulation of of a pore that serves as the import site for cytoplasmic parkin or PINK1 proteins and the removal of defective proteins to enter the mitochondrion. Amyloid precursor mitochondria. The demonstration of abnormal expression protein accumulates in this pore.76 Presenilins 1 and 2, of autophagy proteins in the brain of patients with and γ-secretase are associated with the mitochondria- Parkinson’s disease has further drawn attention to the associated membrane,77 a connection site between the importance of degradation pathways to the pathogenesis endoplasmic reticulum and the mitochondrion that is of the disease.64 These fi ndings off er intriguing oppor- dependent on mitofusin 2 function.78 The mitochondria- tunities for the development of future therapies for associated membrane plays an important part in lipid disorders of impaired mitochondrial function. That up- metabolism, including the synthesis of phosphatidyl- regulation of the translation inhibitor 4E-BP counteracts ethanolamine, which is transported into mitochondria the eff ects of PINK1 or parkin mutants in Drosophila should and has a modulatory role in tau phosphorylation. be noted. 65 Rapamycin, a drug that activates 4E-BP and Mitochondria-associated membranes also contain acyl- autophagy, is also protective in these mutants.65 CoA cholesterol acyltransferase—an important enzyme Mutations of DJ1 are a rare cause of familial Parkinson’s in cholesterol metabolism that is needed for the formation disease. DJ1-knockout mice had downregulated mito- of amyloid β,79 which in turn can localise to mitochondria.80 chondrial uncoupling proteins 4 and 5, impaired Impaired mitochondria-associated membrane function calcium-induced uncoupling, and increased oxidant could also aff ect intracellular calcium homoeostasis and damage.66 DJ1 is thought to have a protective role in be relevant to calcium dysregulation by the endoplasmic reduction of protein misfolding and aggregation that reticulum and abnormal neuronal calcium handling might be a result of oxidative stress and can reduce detected in Alzheimer’s disease models and patients.81,82 α-synuclein aggregation.67 The mitochondria-associated membrane is rich in Genetic causes of Parkinson’s disease, other than those inositol-1,4,5-trisphosphate receptors that bring about encoding mitochondrial proteins, can also aff ect mito- calcium traffi cking.83 Both presenilins 1 and 2 bind to chondrial function. α-synuclein is a major component of these receptors, which substantially increases intracellular Lewy bodies and neurites present in the brains of patients calcium and amyloid β production.83 www.thelancet.com Vol 379 May 12, 2012 1829 Seminar

Triple transgenic mice expressing amyloid and tangle biogenesis, this process might contribute to the mito- pathology similar to that noted in Alzheimer’s disease chondrial dysfunction seen in Huntington’s disease, had pronounced mitochondrial abnormalities,84 such as including impaired defence against free radicals.97 reduced oxidative phosphorylation, decreased activities of complexes I and IV, lowered mitochondrial membrane Other neurodegenerative diseases potential, and increased free-radical generation. Thus, the Mitochondrial dysfunction has been identifi ed in several potential contribution of mitochondria to Alzheimer’s other neurodegenerative diseases. Secondary abnor- disease continues to develop from a primary role in terms malities of mitochondrial morphology and function have of mtDNA mutations or polymorphisms, to a pivotal role been recorded in amyotrophic latereral sclerosis,98 in mediation of downstream biochemical events that whereas in other disorders the causative gene mutation aff ect intracellular bioenergetics and homoeostasis. involves a mitochondrial protein (table 4)—eg, Friedreich’s ataxia99 and hereditary spastic paraplegia.100 Mutations in Mitochondrial dysfunction and the MFN2 gene are a common cause of autosomal Huntington’s disease dominant Charcot-Marie-Tooth type 2 disease—an early- Huntington’s disease is caused by a triplet repeat onset axonal sensorimotor neuropathy.101 A proportion of expansion in the huntingtin gene encoding an enlarged patients have additional abnormalities, such as optic polyglutamine sequence in the mature protein. Mito- atrophy or deafness.102 Mutations of OPA1 cause autosomal chondrial defects have been described in patients with dominant optic atrophy, but the phenotype can include Huntington’s disease in vivo, in aff ected brains post peripheral neuropathy, deafness, ataxia, and ophthal- mortem, and in cell and animal models of the disease.85–88 moplegia with multiple mtDNA deletions.103 The part that The mitochondrial defects in Huntington’s disease are both mitofusin 2 and optic atrophy protein 1 play in associated with abnormalities of calcium handling, fi ssion-fusion might at least partly explain both the patho- increased susceptibility to calcium-induced opening of physiology of neuronal–axonal dysfunction and the the mitochondrial permeability pore, and reduced overlapping phenotypes of mutations aff ecting these respiration.89 Evidence shows that mutant huntingtin proteins,104 although an additional role in mtDNA protein associates with mitochondrial membranes and maintenance cannot be excluded. can impair axonal traffi cking of mitochondria and reduce synaptic ATP concentrations.90 Mutant huntingtin protein Mitochondrial dysfunction and visual failure interacts with, and increases the sensitivity of, the Mitochondrial dysfunction has been a topic of interest to inositol-1,4,5-trisphosphate receptor at the mitochondria- ophthalmological practice since the identifi cation of associated membrane and thus contributes to calcium mtDNA mutations as a cause of Leber’s hereditary optic dysregulation in Huntington’s disease.91 neuropathy.105 OPA1 mutations are a cause of optic Mutant huntingtin protein also sensitises cells to free- atrophy, and mtDNA mutations associated with enceph- radical-mediated damage, reduces ATP production and alomyopathies can be associated with ophthalmoplegia mitochondrial fusion, and induces increased fragmen- or retinal pigmentation. Attention is now focused on the tation—changes that were prevented by overexpression potential involvement of mitochondria in glaucoma. The of mitofusin 2.92 The role of mitochondrial quality control cause of glaucoma is multifactorial; age and ocular is further supported by the fi nding that the calcineurin- pressure are risk factors, although the disease can occur mediated dephosphorylation of dynamin-like protein 1 is at normal ocular pressures. Age-related mitochondrial increased in cells of patients with Huntington’s disease dysfunction and oxidative stress might contribute to risk and leads to increases in mitochondrial translocation, for the development of glaucoma.106,107 Nucci and promotion of fragmentation, and an increased cell colleagues108 reported evidence of excitotoxic-mediated susceptibility to apoptosis.93 Mutant huntingtin protein damage to the retina in glaucoma; mitochondrial has an important role in transcription regulation, and the dysfunction, specifi cally that induced, for example, by expression of a range of mitochondrial proteins is the A3243G mtDNA mutation, lowers the threshold for modifi ed in Huntington’s disease striatal neurons—such excitotoxic eff ects.30 as downregulation of cytochrome oxidase subunit 2, mitofusin 1, mitochondrial transcription factor A, and Mitochondrial dysfunction and diabetes mellitus PGC1α—correlating with disease severity and increased Diabetes mellitus is a recognised feature of many expression of dynamin-like protein 1.94 mitochondrial disorders. It can be the sole expression of The regulation of PGC1α by mutant huntingtin protein mtDNA mutations, but is also frequently recorded as is of particular interest because of the potential to part of an encephalomyopathy (eg, MELAS), and is manipulate the expression of this molecule with drugs. associated with Friedreich’s ataxia and Huntington’s Mutant huntingtin protein binds to the PGC1α promoter disease. Mitochondria play a crucial part in glucose and blocks transcription of target genes in Huntington’s signalling for insulin release and mitochondrial defects disease models and patient muscle.95,96 In view of the impair this process, as in turn does persistent hyper- important regulatory role for PGC1α in mitochondrial glycaemia, leading to mitochondrial dysfunction and

1830 www.thelancet.com Vol 379 May 12, 2012 Seminar

reduced insulin release.109 Many mechanisms are asso- another electron carrier, did not show benefi t in a ciated with the pathogenesis of type 2 diabetes, including 6 month controlled trial in Friedreich’s ataxia,125 although impaired mitochondrial capacity or function; altered other studies have shown improved cardiac function.126 insulin signalling due to cellular lipid accumulation, Modifi ed agents have been produced—eg, Mito-Q, proinfl ammatory signals, and endoplasmic reticulum which has enhanced mitochondrial penetration and stress; and reduced incretin-dependent and incretin- activity in vitro.127 independent cell insulin secretion.110 In a small study of patients with Parkinson’s disease, Abnormal mitochondrial metabolism with reduced creatine was of no benefi t,128 but it did improve motor mitochondrial mass has been detected in muscle biopsies, scores in a larger randomised futility analysis.129 Some and in vivo in patients with type 2 diabetes and people clinical benefi t has been associated with doses of 10 g of who are obese.111 Defects specifi c for patients with type 2 creatine daily in Huntington’s disease, 130 and concen- diabetes—eg, impaired response to exercise stimulus— trations of a peripheral marker of oxidative damage were have been detected.112 Reduced mitochondrial mass is also reduced.131 associated with a 20–30% global reduction in nuclear- encoded subunits of oxidative phosphorylation.113 Several Transcription regulation factors probably aff ect the contribution of mitochondrial An interesting strategy for reversing the eff ects of metabolism to type 2 diabetes, including genetic contri- mitochondrial dysfunction might be through the bution to oxidative phosphorylation enzymes114 and regulation of mitochondrial protein transcription and expression of PINK1, which is suppressed in type 2 biogenesis. PGC1α is an important regulator of mito- diabetic muscle.115 Similar mitochondrial abnormalities chondrial activity (appendix) and functions together with are noted in liver and adipose tissue. Thus, increasing sirtuin 1 to alter genetic programmes for mitochondrial evidence shows that mitochondrial dysfunction is present biogenesis. SIRT1 is one of a family of situins, known to in type 2 diabetes and could participate in a complex catalyse NAD+-dependent protein deacetylation, yielding interacting cycle to promote cell damage and insulin nicotinamide and O-acetyl-ADP-ribose; and to regulate resistance. However, some of the mitochondrial changes longevity, apoptosis, and DNA repair.132 SIRT1 interacts could be a response, rather than a cause, of the metabolic directly with and deacetylates PGC1α and increases its abnormalities.116 activity, leading to the induction of gene transcription. The decrease in mitochondrial mass and downregulation Both proteins promote adaptation to caloric restriction of oxidative phosphorylation subunits might also be by regulation of the genetic programmes for gluco- secondary to the reduced expression of PGC1α and PGC1β neogenesis and glycolysis.133 Activation of peroxisome- (appendix), which is detected both in patients with type 2 proliferator-activated receptor γ transactivates target diabetes and in insulin resistance.117 Manipulation of genes with the support of PGC1α. Drugs that activate PGC concentrations has therefore been of interest in the this receptor include rosiglitazone, pioglitazone, and potential treatment of type 2 diabetes.118 troglitazone, which are used to treat type 2 diabetes. Resveratrol is a natural polyphenolic compound found Mitochondria as a therapeutic target in the skin of grapes that substantially increases SIRT1 Substrates, carriers, and antioxidants activity.134 Resveratrol enhances PGC1α activity, increases The discovery of mitochondrial defects in several mitochondrial biogenesis, decreases insulin resistance, common neurodegenerative diseases provided the basis and renders animals resistant to diet-induced obesity.135 and suffi cient numbers of patients to begin to assess Resveratrol and bezafi brate, another agonist, have shown applicability of compounds such as coenzyme Q10 and protective properties in animal models of Parkinson’s creatine to treat disorders of mitochondrial function.119 disease,136 Huntington’s disease,137,138 Alzheimer’s disease,139 Coenzyme Q10 is an electron carrier and antioxidant. At and other diseases including a mouse model of mito- a dose of 1200 mg per day, coenzyme Q10 seemed to chondrial myopathy.140 slow progression in a pilot study in early Parkinson’s Importantly, the upregulation of mitochondrial bio- disease,120 although other studies using similar biogenesis through the PGC1α pathway potentially targets available doses have not shown benefi t.121 Further all mitochondria (wildtype and mutant) and so could studies of coenzyme Q10 in early Parkinson’s disease have applications in diseases caused by mtDNA muta- For more information about the are underway, but preliminary results suggest that tions and in other disorders associated with mitochondrial coenzyme Q10 studies see these are negative. Coenzyme Q10 seemed to slow dysfunction. http://clinicaltrials.gov/ct2/show/ CT00740714?term=q10&rank=7 progression in Huntington’s disease, but this eff ect was Confl icts of interest not signifi cant.122 In Friedreich’s ataxia, a combination I declare that I have no confl icts of interest. of coenzyme Q10 and vitamin E improved neurological References progression compared with 4 year cross-sectional 1 Schapira AHV. Mitochondrial disease. Lancet 2006; 368: 70–82. natural progression data.123 A low dose was as eff ective 2 Duchen MR, Szabadkai G. Roles of mitochondria in human disease. Essays Biochem 2010; 47: 115–37. as high-dose therapy in improving function in patients 3 McFarland R, Taylor RW, Turnbull DM. A neurological perspective with coexisting coenzyme Q defi ciency.124 Idebenone, on mitochondrial disease. Lancet Neurol 2010; 9: 829–40. www.thelancet.com Vol 379 May 12, 2012 1831 Seminar

4 Plun-Favreau H, Lewis PA, Hardy J, Martins LM, Wood NW. Cancer 29 Ekstrand MI, Terzioglu M, Galter D, et al. Progressive and neurodegeneration: between the devil and the deep blue sea. parkinsonism in mice with respiratory-chain-defi cient dopamine PLoS Genet 2010; 6: e1001257. neurons. Proc Natl Acad Sci USA 2007; 104: 1325–30. 5 de Castro I, Martins LM, Tufi R. Mitochondrial quality control and 30 DiFrancesco JC, Cooper JM, Lam A, et al. MELAS mitochondrial neurological disease: an emerging connection. Expert Rev Mol Med DNA mutation A3243G reduces glutamate transport in cybrids cell 2010; 12: e12. lines. Exp Neurol 2008; 212: 152–56. 6 Dagda RK, Chu CT. Mitochondrial quality control: insights on how 31 Wang C, Youle RJ. The role of mitochondria in apoptosis. Parkinson's disease related genes PINK1, parkin, and Omi/HtrA2 Annu Rev Genet 2009; 43: 95–118. interact to maintain mitochondrial homeostasis. 32 Ghezzi D, Sevrioukova I, Invernizzi F, et al. Severe X-linked J Bioenerg Biomembr 2009; 41: 473–79. mitochondrial encephalomyopathy associated with a mutation in 7 Malena A, Loro E, Di RM, Holt IJ, Vergani L. Inhibition of apoptosis-inducing factor. Am J Hum Genet 2010; 86: 639–49. mitochondrial fi ssion favours mutant over wild-type mitochondrial 33 Finsterer J, Harbo HF, Baets J, et al. EFNS guidelines on the DNA. Hum Mol Genet 2009; 18: 3407–16. molecular diagnosis of mitochondrial disorders. Eur J Neurol 2009; 8 Poole AC, Thomas RE, Andrews LA, McBride HM, Whitworth AJ, 16: 1255–64. Pallanck LJ. The PINK1/Parkin pathway regulates mitochondrial 34 Morgan-Hughes JA, Sweeney MG, Cooper JM, et al. Mitochondrial morphology. Proc Natl Acad Sci USA 2008; 105: 1638–43. DNA (mtDNA) diseases: correlation of genotype to phenotype. 9 Narendra D, Tanaka A, Suen DF, Youle RJ. Parkin is recruited Biochim Biophys Acta 1995; 1271: 135–40. selectively to impaired mitochondria and promotes their autophagy. 35 Chinnery P, Majamaa K, Turnbull D, Thorburn D. Treatment for J Cell Biol 2008; 183: 795–803. mitochondrial disorders. Cochrane Database Syst Rev 2006; 10 Kim Y, Park J, Kim S, et al. PINK1 controls mitochondrial 1: CD004426. localization of Parkin through direct phosphorylation. 36 Montini G, Malaventura C, Salviati L. Early coenzyme Biochem Biophys Res Commun 2008; 377: 975–80. Q10 supplementation in primary coenzyme Q10 defi ciency. 11 Gegg ME, Cooper JM, Chau KY, Rojo M, Schapira AH, N Engl J Med 2008; 358: 2849–50. Taanman JW. Mitofusin 1 and mitofusin 2 are ubiquitinated in a 37 Moutaouakil F, El Otmani H, Fadel H, Sefrioui F, Slassi I. PINK1/parkin-dependent manner upon induction of mitophagy. l-arginine effi ciency in MELAS syndrome. A case report. Hum Mol Genet 2010; 19: 4861–70. Rev Neurol (Paris) 2009; 165: 482–85 (in French). 12 Schapira AH. Etiology of Parkinson’s disease. Neurology 2006; 38 Taanman JW, Daras M, Albrecht J, et al. Characterization of a novel 66 (10 suppl 4): S10–S23. TYMP splice site mutation associated with mitochondrial 13 Gegg ME, Schapira AH. PINK1-parkin-dependent mitophagy neurogastrointestinal encephalomyopathy (MNGIE). involves ubiquitination of mitofusins 1 and 2: Implications for Neuromuscul Disord 2009; 19: 151–54. Parkinson disease pathogenesis. Autophagy 2011; 7: 243–45. 39 Halter J, Schupbach WM, Casali C, et al. Allogeneic hematopoietic 14 Larsson NG. Somatic mitochondrial DNA mutations in mammalian SCT as treatment option for patients with mitochondrial aging. Annu Rev Biochem 2010; 79: 683–706. neurogastrointestinal encephalomyopathy (MNGIE): a consensus 15 Wallace DC. Mitochondrial DNA mutations in disease and aging. conference proposal for a standardized approach. Environ Mol Mutagen 2010; 51: 440–50. Bone Marrow Transplant 2011; 46: 330–37 16 Kraytsberg Y, Kudryavtseva E, McKee AC, Geula C, Kowall NW, 40 Murphy JL, Blakely EL, Schaefer AM, et al. Resistance training in Khrapko K. Mitochondrial DNA deletions are abundant and cause patients with single, large-scale deletions of mitochondrial DNA. functional impairment in aged human substantia nigra neurons. Brain 2008; 131: 2832–40. Nat Genet 2006; 38: 518–20. 41 Jeppesen TD, Duno M, Schwartz M, et al. Short- and long-term 17 Trifunovic A, Wredenberg A, Falkenberg M, et al. Premature ageing eff ects of endurance training in patients with mitochondrial in mice expressing defective mitochondrial DNA polymerase. myopathy. Eur J Neurol 2009; 16: 1336–39. Nature 2004; 429: 417–23. 42 Taivassalo T, Shoubridge EA, Chen J, et al. Aerobic conditioning in 18 Schriner SE, Linford NJ, Martin GM, et al. Extension of murine life patients with mitochondrial myopathies: physiological, biochemical, span by overexpression of catalase targeted to mitochondria. Science and genetic eff ects. Ann Neurol 2001; 50: 133–41. 2005; 308: 1909–11. 43 Kyriakouli DS, Boesch P, Taylor RW, Lightowlers RN. Progress and 19 Luce K, Weil AC, Osiewacz HD. Mitochondrial protein quality control prospects: gene therapy for mitochondrial DNA disease. Gene Ther systems in aging and disease. Adv Exp Med Biol 2010; 694: 108–25. 2008; 15: 1017–23. 20 Bandyopadhyay U, Cuervo AM. Chaperone-mediated autophagy 44 Tachibana M, Sparman M, Sritanaudomchai H, et al. Mitochondrial in aging and neurodegeneration: lessons from alpha-synuclein. gene replacement in primate off spring and embryonic stem cells. Exp Gerontol 2007; 42: 120–28. Nature 2009; 461: 367–72. 21 Bitner-Glindzicz M, Pembrey M, Duncan A, et al. Prevalence 45 Craven L, Tuppen HA, Greggains GD, et al. Pronuclear transfer in of mitochondrial 1555A→G mutation in European children. human embryos to prevent transmission of mitochondrial DNA N Engl J Med 2009; 360: 640–42. disease. Nature 2010; 465: 82–85. 22 Vandebona H, Mitchell P, Manwaring N, et al. Prevalence of 46 Schapira AHV, Cooper JM, Dexter D, Jenner P, Clark JB, mitochondrial 1555A→G mutation in adults of European descent. Marsden CD. Mitochondrial complex I defi ciency in Parkinson's N Engl J Med 2009; 360: 642–44. disease. Lancet 1989; 333: 1269. 23 Cai W, Fu Q, Zhou X, Qu J, Tong Y, Guan MX. Mitochondrial 47 Schapira AHV, Cooper JM, Dexter D, Clark JB, Jenner P, variants may infl uence the phenotypic manifestation of Leber's Marsden CD. Mitochondrial complex I defi ciency in Parkinson’s hereditary optic neuropathy-associated ND4 G11778A mutation. disease. J Neurochem 1990; 54: 823–27. J Genet Genomics 2008; 35: 649–55. 48 Schapira AHV. Mitochondria in the aetiology and pathogenesis 24 Cock HR, Tabrizi SJ, Cooper JM, Schapira AH. The infl uence of of Parkinson's disease. Lancet Neurol 2008; 7: 97–109. nuclear background on the biochemical expression of 3460 Leber's 49 Mann VM, Cooper JM, Schapira AH. Quantitation of a hereditary optic neuropathy. Ann Neurol 1998; 44: 187–93. mitochondrial DNA deletion in Parkinson’s disease. FEBS Lett 1992; 25 Copeland WC. Inherited mitochondrial diseases of DNA 299: 218–22. replication. Annu Rev Med 2008; 59: 131–46. 50 Bender A, Krishnan KJ, Morris CM, et al. High levels of 26 Taanman JW, Rahman S, Pagnamenta AT, et al. Analysis of mutant mitochondrial DNA deletions in substantia nigra neurons in aging DNA polymerase gamma in patients with mitochondrial DNA and Parkinson disease. Nat Genet 2006; 38: 515–17. depletion. Hum Mutat 2009; 30: 248–54. 51 Simon DK, Pankratz N, Kissell DK, et al. Maternal inheritance and 27 Rahman S, Poulton J. Diagnosis of mitochondrial DNA depletion mitochondrial DNA variants in familial Parkinson's disease. syndromes. Arch Dis Child 2009; 94: 3–5. BMC Med Genet 2010; 11: 53. 28 Williams SL, Huang J, Edwards YJ, et al. The mtDNA mutation 52 Schapira AH, Agid Y, Barone P, et al. Perspectives on recent spectrum of the progeroid Polg mutator mouse includes abundant advances in the understanding and treatment of Parkinson's control region multimers. Cell Metab 2010; 12: 675–82. disease. Eur J Neurol 2009; 16: 1090–99.

1832 www.thelancet.com Vol 379 May 12, 2012 Seminar

53 Valente EM, Abou-Sleiman PM, Caputo V, et al. Hereditary 76 Devi L, Prabhu BM, Galati DF, Avadhani NG, early-onset Parkinson's disease caused by mutations in PINK1. Anandatheerthavarada HK. Accumulation of amyloid precursor Science 2004; 304: 1158–60. protein in the mitochondrial import channels of human 54 Abramov AY, Gegg M, Grunewald A, Wood NW, Klein C, Alzheimer's disease brain is associated with mitochondrial Schapira AH. Bioenergetic consequences of PINK1 mutations in dysfunction. J Neurosci 2006; 26: 9057–68. Parkinson disease. PLoS One 2011; 6: e25622. 77 Area-Gomez E, de Groof AJ, Boldogh I, et al. Presenilins are 55 Gandhi S, Wood-Kaczmar A, Yao Z, et al. PINK1-associated enriched in endoplasmic reticulum membranes associated with Parkinson's disease is caused by neuronal vulnerability to mitochondria. Am J Pathol 2009; 175: 1810–16. calcium-induced cell death. Mol Cell 2009; 33: 627–38. 78 de Brito OM, Scorrano L. Mitofusin 2 tethers endoplasmic 56 Gegg ME, Cooper JM, Schapira AH, Taanman JW. Silencing reticulum to mitochondria. Nature 2008; 456: 605–10. of PINK1 expression aff ects mitochondrial DNA and oxidative 79 Puglielli L, Konopka G, Pack-Chung E, et al. Acyl-coenzyme A: phosphorylation in dopaminergic cells. PLoS One 2009; 4: e4756. cholesterol acyltransferase modulates the generation of the amyloid 57 Hoepken HH, Gispert S, Morales B, et al. Mitochondrial beta-peptide. Nat Cell Biol 2001; 3: 905–12. dysfunction, peroxidation damage and changes in glutathione 80 Manczak M, Anekonda TS, Henson E, Park BS, Quinn J, metabolism in PARK6. Neurobiol Dis 2007; 25: 401–11. Reddy PH. Mitochondria are a direct site of A beta accumulation 58 Grunewald A, Gegg ME, Taanman JW, et al. Diff erential eff ects in Alzheimer's disease neurons: implications for free radical of PINK1 nonsense and missense mutations on mitochondrial generation and oxidative damage in disease progression. function and morphology. Exp Neurol 2009; 219: 266–73. Hum Mol Genet 2006; 15: 1437–49. 59 Gispert S, Ricciardi F, Kurz A, et al. Parkinson phenotype in aged 81 Demuro A, Parker I, Stutzmann GE. Calcium signaling and amyloid PINK1-defi cient mice is accompanied by progressive mitochondrial toxicity in Alzheimer disease. J Biol Chem 2010; 285: 12463–68. dysfunction in absence of neurodegeneration. PLoS One 2009; 82 Supnet C, Bezprozvanny I. The dysregulation of intracellular 4: e5777. calcium in Alzheimer disease. Cell Calcium 2010; 47: 183–89. 60 Greene JC, Whitworth AJ, Kuo I, Andrews LA, Feany MB, 83 Cheung KH, Mei L, Mak DO, et al. Gain-of-function enhancement Pallanck LJ. Mitochondrial pathology and apoptotic muscle of IP3 receptor modal gating by familial Alzheimer’s disease-linked degeneration in Drosophila parkin mutants. Proc Natl Acad Sci USA presenilin mutants in human cells and mouse neurons. Sci Signal 2003; 100: 4078–83. 2010; 3: ra22. 61 Muftuoglu M, Elibol B, Dalmizrak O, et al. Mitochondrial complex I 84 Rhein V, Song X, Wiesner A, et al. Amyloid-beta and tau and IV activities in leukocytes from patients with parkin mutations. synergistically impair the oxidative phosphorylation system in triple Mov Disord 2004; 19: 544–48. transgenic Alzheimer’s disease mice. Proc Natl Acad Sci USA 2009; 62 Grunewald A, Voges L, Rakovic A, et al. Mutant Parkin impairs 106: 20057–62. mitochondrial function and morphology in human fi broblasts. 85 Gu M, Gash MT, Mann VM, Javoy-Agid F, Cooper JM, Schapira AH. PLoS One 2010; 5: e12962. Mitochondrial defect in Huntington’s disease caudate nucleus. 63 Shin JH, Ko HS, Kang H, et al. PARIS (ZNF746) repression of Ann Neurol 1996; 39: 385–89. PGC-1alpha contributes to neurodegeneration in Parkinson's 86 Tabrizi SJ, Cleeter MW, Xuereb J, Taanman JW, Cooper JM, disease. Cell 2011; 144: 689–702. Schapira AH. Biochemical abnormalities and excitotoxicity in 64 Alvarez-Erviti L, Rodriguez-Oroz MC, Cooper JM, et al. Huntington’s disease brain. Ann Neurol 1999; 45: 25–32. Chaperone-mediated autophagy markers in Parkinson disease 87 Browne SE, Bowling AC, MacGarvey U, et al. Oxidative damage brains. Arch Neurol 2010; 67: 1464–72. and metabolic dysfunction in Huntington’s disease: selective 65 Tain LS, Mortiboys H, Tao RN, Ziviani E, Bandmann O, vulnerability of the basal ganglia. Ann Neurol 1997; 41: 646–53. Whitworth AJ. Rapamycin activation of 4E-BP prevents parkinsonian 88 Lodi R, Schapira AH, Manners D, et al. Abnormal in vivo skeletal dopaminergic neuron loss. Nat Neurosci 2009; 12: 1129–35. muscle energy metabolism in Huntington’s disease and 66 Guzman JN, Sanchez-Padilla J, Wokosin D, et al. Oxidant stress dentatorubropallidoluysian atrophy. Ann Neurol 2000; 48: 72–76. evoked by pacemaking in dopaminergic neurons is attenuated by 89 Lim D, Fedrizzi L, Tartari M, et al. Calcium homeostasis and DJ-1. Nature 2010; 468: 696–700. mitochondrial dysfunction in striatal neurons of Huntington 67 Batelli S, Albani D, Rametta R, et al. DJ-1 modulates disease. J Biol Chem 2008; 283: 5780–89. alpha-synuclein aggregation state in a cellular model of oxidative 90 Orr AL, Li S, Wang CE, et al. N-terminal mutant huntingtin stress: relevance for Parkinson’s disease and involvement of HSP70. associates with mitochondria and impairs mitochondrial traffi cking. PLoS One 2008; 3: e1884. J Neurosci 2008; 28: 2783–92. 68 Li WW, Yang R, Guo JC, et al. Localization of alpha-synuclein to 91 Kaltenbach LS, Romero E, Becklin RR, et al. Huntingtin interacting mitochondria within midbrain of mice. Neuroreport 2007; 18: 1543–46. proteins are genetic modifi ers of neurodegeneration. PLoS Genet 69 Nakamura K, Nemani VM, Wallender EK, Kaehlcke K, Ott M, 2007; 3: e82. Edwards RH. Optical reporters for the conformation of 92 Wang H, Lim PJ, Karbowski M, Monteiro MJ. Eff ects of alpha-synuclein reveal a specifi c interaction with mitochondria. overexpression of huntingtin proteins on mitochondrial integrity. J Neurosci 2008; 28: 12305–17. Hum Mol Genet 2009; 18: 737–52. 70 Liu G, Zhang C, Yin J, et al. alpha-Synuclein is diff erentially 93 Costa V, Giacomello M, Hudec R, et al. Mitochondrial fi ssion and expressed in mitochondria from diff erent rat brain regions and cristae disruption increase the response of cell models of dose-dependently down-regulates complex I activity. Neurosci Lett Huntington’s disease to apoptotic stimuli. EMBO Mol Med 2010; 2009; 454: 187–92. 2: 490–503. 71 Devi L, Raghavendran V, Prabhu BM, Avadhani NG, 94 Kim J, Moody JP, Edgerly CK, et al. Mitochondrial loss, dysfunction Anandatheerthavarada HK. Mitochondrial import and and altered dynamics in Huntington’s disease. Hum Mol Genet accumulation of alpha-synuclein impair complex I in human 2010; 19: 3919–35. dopaminergic neuronal cultures and Parkinson disease brain. 95 Cui L, Jeong H, Borovecki F, Parkhurst CN, Tanese N, Krainc D. J Biol Chem 2008; 283: 9089–100. Transcriptional repression of PGC-1alpha by mutant huntingtin 72 Warner TT, Schapira AH. Genetic and environmental factors leads to mitochondrial dysfunction and neurodegeneration. Cell in the cause of Parkinson's disease. Ann Neurol 2003; 2006; 127: 59–69. 53 (suppl 3): S16–S23. 96 Chaturvedi RK, Adhihetty P, Shukla S, et al. Impaired PGC-1alpha 73 Schapira AH. Complex I: inhibitors, inhibition and function in muscle in Huntington’s disease. Hum Mol Genet 2009; neurodegeneration. Exp Neurol 2010; 224: 331–35. 18: 3048–65. 74 Hollerhage M, Matusch A, Champy P, et al. Natural lipophilic 97 St-Pierre J, Drori S, Uldry M, et al. Suppression of reactive oxygen inhibitors of mitochondrial complex I are candidate toxins for sporadic species and neurodegeneration by the PGC-1 transcriptional neurodegenerative tau pathologies. Exp Neurol 2009; 220: 133–42. coactivators. Cell 2006; 127: 397–408. 75 Roses AD, Lutz MW, Amrine-Madsen H, et al. A TOMM40 98 Martin LJ. Mitochondrial pathobiology in Parkinson’s disease variable-length polymorphism predicts the age of late-onset and amyotrophic lateral sclerosis. J Alzheimers Dis 2010; Alzheimer's disease. Pharmacogenomics J 2010; 10: 375–84. 20 (suppl 2): S335–S356.

www.thelancet.com Vol 379 May 12, 2012 1833 Seminar

99 Santos R, Lefevre S, Sliwa D, Seguin A, Camadro JM, Lesuisse E. 120 Shults CW, Oakes D, Kieburtz K, et al. Eff ects of coenzyme Q10 in Friedreich ataxia: molecular mechanisms, redox considerations, early Parkinson disease: evidence of slowing of the functional and therapeutic opportunities. Antioxid Redox Signal 2010; decline. Arch Neurol 2002; 59: 1541–50. 13: 651–90. 121 Storch A, Jost WH, Vieregge P, et al. Randomized, double-blind, 100 Ferreirinha F, Quattrini A, Pirozzi M, et al. Axonal degeneration placebo-controlled trial on symptomatic eff ects of coenzyme Q(10) in paraplegin-defi cient mice is associated with abnormal in Parkinson disease. Arch Neurol 2007; 64: 938–44. mitochondria and impairment of axonal transport. J Clin Invest 122 The Huntington Study Group. A randomized, placebo-controlled 2004; 113: 231–42. trial of coenzyme Q10 and remacemide in Huntington's disease. 101 Calvo J, Funalot B, Ouvrier RA, et al. Genotype-phenotype Neurology 2001; 57: 397–404. correlations in Charcot-Marie-Tooth disease type 2 caused by 123 Hart PE, Lodi R, Rajagopalan B, et al. Antioxidant treatment of mitofusin 2 mutations. Arch Neurol 2009; 66: 1511–16. patients with Friedreich ataxia: four-year follow-up. Arch Neurol 102 Del BR, Moggio M, Rango M, et al. Mutated mitofusin 2 presents 2005; 62: 621–26. with intrafamilial variability and brain mitochondrial dysfunction. 124 Cooper JM, Korlipara LV, Hart PE, Bradley JL, Schapira AH. Neurology 2008; 71: 1959–66. Coenzyme Q10 and vitamin E defi ciency in Friedreich’s ataxia: 103 Hudson G, Amati-Bonneau P, Blakely EL, et al. Mutation of OPA1 predictor of effi cacy of vitamin E and coenzyme Q10 therapy. causes dominant optic atrophy with external ophthalmoplegia, Eur J Neurol 2008; 15: 1371–19. ataxia, deafness and multiple mitochondrial DNA deletions: a novel 125 Lynch DR, Perlman SL, Meier T. A phase 3, double-blind, disorder of mtDNA maintenance. Brain 2008; 131: 329–37. placebo-controlled trial of idebenone in Friedreich ataxia. 104 Cho DH, Nakamura T, Lipton SA. Mitochondrial dynamics in cell Arch Neurol 2010; 67: 941–47. death and neurodegeneration. Cell Mol Life Sci 2010; 67: 3435–47. 126 Di Prospero NA, Baker A, Jeff ries N, Fischbeck KH. Neurological 105 Carelli V, La MC, Valentino ML, Barboni P, Ross-Cisneros FN, eff ects of high-dose idebenone in patients with Friedreich’s ataxia: Sadun AA. Retinal ganglion cell neurodegeneration in a randomised, placebo-controlled trial. Lancet Neurol 2007; mitochondrial inherited disorders. Biochim Biophys Acta 2009; 6: 878–86. 1787: 518–28. 127 Murphy MP, Smith RA. Targeting antioxidants to mitochondria by 106 Kong GY, Van Bergen NJ, Trounce IA, Crowston JG. Mitochondrial conjugation to lipophilic cations. Annu Rev Pharmacol Toxicol 2007; dysfunction and glaucoma. J Glaucoma 2009; 18: 93–100. 47: 629–56. 107 Lascaratos G, Garway-Heath DF, Willoughby CE, Chau KY, 128 Bender A, Koch W, Elstner M, et al. Creatine supplementation in Schapira AH. Mitochondrial dysfunction in glaucoma: Parkinson disease: a placebo-controlled randomized pilot trial. understanding genetic infl uences. Mitochondrion 2012; 12: 202–12. Neurology 2006; 67: 1262–64. 108 Nucci C, Tartaglione R, Rombola L, Morrone LA, Fazzi E, Bagetta G. 129 NINDS NET-PD Investigators. A randomized, double-blind, futility Neurochemical evidence to implicate elevated glutamate in the clinical trial of creatine and minocycline in early Parkinson disease. mechanisms of high intraocular pressure (IOP)-induced retinal Neurology 2006; 66: 664–71. ganglion cell death in rat. Neurotoxicology 2005; 26: 935–41. 130 Tabrizi SJ, Blamire AM, Manners DN, et al. High-dose creatine 109 Jitrapakdee S, Wutthisathapornchai A, Wallace JC, MacDonald MJ. therapy for Huntington disease: a 2-year clinical and MRS study. Regulation of insulin secretion: role of mitochondrial signalling. Neurology 2005; 64: 1655–56. Diabetologia 2010; 53: 1019–32. 131 Hersch SM, Gevorkian S, Marder K, et al. Creatine in Huntington 110 Patti ME, Corvera S. The role of mitochondria in the pathogenesis disease is safe, tolerable, bioavailable in brain and reduces serum of type 2 diabetes. Endocr Rev 2010; 31: 364–95. 8OH2'dG. Neurology 2006; 66: 250–52. 111 Ritov VB, Menshikova EV, Azuma K, et al. Defi ciency of electron 132 Blander G, Guarente L. The Sir2 family of protein deacetylases. transport chain in human skeletal muscle mitochondria in type 2 Annu Rev Biochem 2004; 73: 417–35. diabetes mellitus and obesity. Am J Physiol Endocrinol Metab 2010; 133 Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM, 298: E49–E58. Puigserver P. Nutrient control of glucose homeostasis through a 112 Kacerovsky-Bielesz G, Chmelik M, Ling C, et al. Short-term complex of PGC-1alpha and SIRT1. Nature 2005; 434: 113–18. exercise training does not stimulate skeletal muscle ATP synthesis 134 Howitz KT, Bitterman KJ, Cohen HY, et al. Small molecule in relatives of humans with type 2 diabetes. Diabetes 2009; activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 58: 1333–41. 2003; 425: 191–96. 113 Patti ME, Butte AJ, Crunkhorn S, et al. Coordinated reduction of 135 Lagouge M, Argmann C, Gerhart-Hines Z, et al. Resveratrol genes of oxidative metabolism in humans with insulin resistance improves mitochondrial function and protects against metabolic and diabetes: Potential role of PGC1 and NRF1. disease by activating SIRT1 and PGC-1alpha. Cell 2006; Proc Natl Acad Sci USA 2003; 100: 8466–71. 127: 1109–22. 114 Ronn T, Poulsen P, Tuomi T, et al. Genetic variation in ATP5O is 136 Khan MM, Ahmad A, Ishrat T, et al. Resveratrol attenuates associated with skeletal muscle ATP50 mRNA expression and 6-hydroxydopamine-induced oxidative damage and dopamine glucose uptake in young twins. PLoS One 2009; 4: e4793. depletion in rat model of Parkinson’s disease. Brain Res 2010; 115 Scheele C, Nielsen AR, Walden TB, et al. Altered regulation 1328: 139–51. of the PINK1 locus: a link between type 2 diabetes and 137 Maher P, Dargusch R, Bodai L, Gerard PE, Purcell JM, Marsh JL. neurodegeneration? FASEB J 2007; 21: 3653–65. ERK activation by the polyphenols fi setin and resveratrol provides 116 Schiff M, Loublier S, Coulibaly A, Benit P, de Baulny HO, Rustin P. neuroprotection in multiple models of Huntington’s disease. Mitochondria and diabetes mellitus: untangling a confl ictive Hum Mol Genet 2011; 20: 261–70. relationship? J Inherit Metab Dis 2009; 32: 684–98. 138 Ho DJ, Calingasan NY, Wille E, Dumont M, Beal MF. Resveratrol 117 Mootha VK, Lindgren CM, Eriksson KF, et al. PGC-1alpha- protects against peripheral defi cits in a mouse model of responsive genes involved in oxidative phosphorylation are Huntington’s disease. Exp Neurol 2010; 225: 74–84. coordinately downregulated in human diabetes. Nat Genet 2003; 139 Anekonda TS, Reddy PH. Neuronal protection by sirtuins 34: 267–73. in Alzheimer’s disease. J Neurochem 2006; 96: 305–13. 118 Lira VA, Benton CR, Yan Z, Bonen A. PGC-1alpha regulation by 140 Wenz T, Diaz F, Spiegelman BM, Moraes CT. Activation of the exercise training and its infl uences on muscle function and insulin PPAR/PGC-1alpha pathway prevents a bioenergetic defi cit and sensitivity. Am J Physiol Endocrinol Metab 2010; 299: E145–E161. eff ectively improves a mitochondrial myopathy phenotype. 119 Kerr DS. Treatment of mitochondrial electron transport chain Cell Metab 2008; 8: 249–56. disorders: a review of clinical trials over the past decade. Mol Genet Metab 2010; 99: 246–55.

1834 www.thelancet.com Vol 379 May 12, 2012 DEVELOPMENTAL DISABILITIES RESEARCH REVIEWS 16: 154 – 162 (2010)

MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS

Lee-Jun C. Wong* Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas

Mitochondrial respiratory chain (RC) disorders (RCDs) are a group Hoefs et al., 2008; Pagliarini et al., 2008; Willems et al., of genetically and clinically heterogeneous diseases because of the fact 2008; Saada et al., 2009]. that protein components of the RC are encoded by both mitochondrial and nuclear genomes and are essential in all cells. In addition, the bio- The human mitochondrial genome is a circular, double- genesis, structure, and function of mitochondria, including DNA replica- stranded, 16.6-kb DNA encoding 13 protein subunits of tion, transcription, and translation, all require nuclear-encoded genes. In OXPHOS complexes and 2 ribosomal RNAs (rRNAs) and this review, primary molecular defects in the mitochondrial genome and 22 transfer RNAs (tRNAs) essential for mitochondrial protein major classes of nuclear genes causing mitochondrial RCDs, including synthesis. Mitochondrial DNA (mtDNA) is susceptible to oxi- genes underlying mitochondrial DNA (mtDNA) depletion syndrome, as well as genes encoding RC subunits, complex assembly genes, and trans- dative DNA damage because of its close vicinity to where the lation factors, are described. Diagnostic methodologies used to detect reactive oxygen species (ROS) are produced, the lack of pro- common point mutations, large deletions, and unknown point mutations tective histone proteins, and the limited DNA proof-reading in the mtDNA and to quantify mutation heteroplasmy are also discussed. and repair systems in mitochondria. The biogenesis of Finally, the selection of nuclear genes for gold standard sequence analy- mtDNA requires nuclear-encoded genes such as DNA poly- sis, application of novel technologies including oligonucleotide array com- POLG TWINKLE parative genomic hybridization, and massive parallel sequencing of target merase gamma ( ) and DNA helicase ( ) for genes are reviewed. ' 2010 Wiley-Liss, Inc. mtDNA replication and purine/pyrimidine nucleoside kinases, Dev Disabil Res Rev 2010;16:154–162. DGUOK and TK2, for the salvage synthesis and maintenance of deoxynucleoside triphosphate (dNTP) pools in the mito- Key Words: mitochondrial disorder; mtDNA mutation; mtDNA depletion; chondria. Defects in any of these genes will cause mtDNA mtDNA deletion depletion [Spinazzola and Zeviani, 2009; Spinazzola et al., 2009] or mtDNA multiple deletions [Milone et al., 2008]. Mitochondrial biogenesis, complex assembly, mtDNA replication, transcription, and mitochondrial protein biosynthesis, all require nuclear DNA-encoded factors [Spinazzola and Zeviani, 2005; Pagliarini et al., 2008; Koene and Smei- INTRODUCTION tink, 2009]. Furthermore, the roles of mitochondria in he major function of mitochondria is to use molecular autophagy, apoptosis, and ROS production have recently pro- oxygen to convert the chemical energy of food into ven to be indispensable in the pathogenic mechanisms of neu- ATP, the cellular energy currency. To carry out this T rodegenerative diseases (Parkinson, Alzheimer, Huntington, oxidative phosphorylation (OXPHOS) reaction, the mito- etc.) and cancer [Corral-Debrinski et al., 1992; Soong et al., chondria must maintain intact structure and function, which 1992; Bianchi et al., 1995; Horton et al., 1996; Jessie et al., requires the participation of 1,500 genes encoded by both 2001; Tan et al., 2002; Geisler et al., 2010]. It is thus conceiv- the mitochondrial and nuclear genomes [Calvo et al., 2006]. able that defects in any of the 1,500 genes targeted to mito- By Krebs cycle and beta-oxidation, carbohydrates and fatty chondria are potentially detrimental to mitochondrial structure acids are oxidized to form NADH and FADH , respectively. 2 and function [Wallace, 1999; Smeitink et al., 2001; DiMauro, Electrons from these reducing agents are passed through the 2004; Geisler et al., 2010]. Since mitochondria are the essen- electron transport chain complexes, creating a proton-gradient, tial energy-producing organelles in animal cells, virtually all which is the driving force for ATP synthesis (Fig. 1). Most organ systems may be affected if there is a mitochondrial patients with mitochondrial disorders have molecular defects defect. However, the tissues with high-energy demand, such affecting the mitochondrial OXPHOS system, which is made up of 87 protein subunits forming five multiprotein complexes (Complexes I–V) embedded in the inner mitochondrial membrane. Among these 87 proteins, 13 are encoded by the *Correspondence to: Lee-Jun C. Wong, PhD, Department of Molecular and Human mitochondrial genome and the remainder are encoded by the Genetics, Baylor College of Medicine, One Baylor Plaza, NAB 2015, Houston, TX nuclear genome. To form the OXPHOS complexes, a number 77030. E-mail: [email protected] of nuclear-encoded assembly factors are required [Tiranti Received 13 June 2010; Accepted 29 June 2010 View this article online at wileyonlinelibrary.com. et al., 1998; Valnot et al., 2000; de Lonlay et al., 2001; Anto- DOI: 10.1002/ddrr.104 nicka et al., 2003; Tay et al., 2004; Dieteren et al., 2008; ' 2010 Wiley -Liss, Inc. as muscle and nerve, are most suscepti- fatal, a definitive molecular diagnosis lated to play a role in disease expression of ble. In general, neuromuscular symp- and confirmed parental carrier status matrilineal relatives who are homoplasmic toms are the major clinical features of may assist in future prenatal and/or pre- for the mutations and have variable phe- mitochondrial diseases, including seiz- implantation genetic diagnosis. notypic expression [Wallace et al., 1995, ures, skeletal muscle weakness, exercise In this article, the molecular genet- 2001; Gropman et al., 2004]. intolerance, cardiomyopathy, sensori- ics of mitochondrial disorders, current The most well-known point muta- neural hearing loss, optic atrophy, reti- molecular diagnostic approaches, meth- tions in mitochondrial rRNA genes are nitis pigmentosa, ophthalmoplegia, dia- odologies used, and advances toward a the m.1555A>G and the m.1494T>C betes mellitus, hypothyroidism, gastroin- single-step comprehensive molecular mutations in the 12S rRNA gene, which testinal reflux, renal dysfunction, and diagnostic approach are described. cause hearing loss upon exposure to oto- immunodeficiency. However, diagnosis toxic aminoglycosides. In addition to of mitochondrial respiratory chain (RC) PRIMARY DEFECTS IN THE common mtDNA point mutations, large disorders cannot be solely based on MITOCHONDRIAL GENOME mtDNA deletions are a frequent cause of clinical features because of their diverse Each animal cell contains hundreds pathology accounting for Pearson syn- and often nonspecific nature [Haas to thousands of mtDNA molecules. The drome (PS), Kearns–Sayre syndrome et al., 2007, 2008]. mutation rate of mtDNA is 10–20 times (KSS), progressive external ophthalmo- Accordingly, mitochondrial disor- higher than that of nuclear DNA. Dele- plegia (PEO), or myopathy [Wong, ders are a complex dual genome disease terious mutations of mtDNA usually 2001]. PS is characterized by infantile that can be caused by molecular defects coexist with wild-type mtDNA mole- marrow and pancreas abnormalities with in both nuclear and mitochondrial cules in a heteroplasmic state. mtDNA sideroblastic anemia. KSS is characterized genomes. The disease is genetically het- mutations are maternally inherited by onset at the second decade of life with erogeneous. Depending upon the pri- [Smeitink et al., 2001; Wallace et al., PEO, pigmentary retinopathy, and at mary defect, mitochondrial disorders 2001; DiMauro, 2004]. There are recur- least one of the following: cerebellar may be autosomal recessive, autosomal rent mtDNA mutations, including the ataxia, cardiac conduction defect, or ele- dominant, X-linked, or maternally most common m.3243A>G mutation in vated CSF protein. inherited. Mitochondrial disorders are tRNAleu(uur) for MELAS syndrome and In addition to the qualitative also clinically heterogeneous because of the m.8344A>G mutation the tRNAlys changes in mtDNA, which include point variation in tissue distribution of the gene for MERRF (Myoclonic Epilepsy, mutations and large deletions, quantita- mutation, the degree of heteroplasmy in Ragged Red Fibers) syndrome. The tive alterations in mtDNA content have affected tissues, and variable thresholds m.3243A>G mutation has much more also been reported in patients with mito- and penetrance effects for different severe clinical course than the chondrial disorders and severely reduced mutations [Wallace et al., 1995, 2001]. m.8344A>G mutation. Clinical symp- content of mtDNA molecules. This phe- Although there are some recognizable toms may be observed at m.3243A>G nomenon is called mtDNA depletion, syndromes, in most cases, diagnosis is mutation heteroplasmy <20% in blood, where mtDNA molecules do not contain challenging because the same mutations while the threshold for m.8344A>Gis detectable mutations, but there is a or different mutations in the same genes much higher, typically >80%. The reduction in the copy number of may cause different clinical phenotype, m.3243A>G mutation is predominantly mtDNA molecules. Such quantitative and different mutations or different detected in pediatric patients. The changes in mtDNA content are caused genes may cause the same clinical symp- tRNAleu(uur) and tRNAlys genes are by primary mutations in nuclear- toms. For example, the most common mutation hot spots where other recur- encoded genes responsible for mtDNA mtDNA mutation, m.3243A>G, may rent mutations such as m.3271T>C biosynthesis [Spinazzola and Zeviani, cause MELAS (Mitochondrial Ence- (MELAS), m.8356T>C (MERRF), and 2009; Spinazzola et al., 2009]. phalopathy, Lactic Acidosis and Stroke- m.8363G>A (peripheral neuropathy and like episodes) or diabetes, hearing loss, cardiomyopathy) are located. NUCLEAR GENE DEFECTS and retinopathy. Similarly, hearing loss Mutations in protein-coding THAT CAUSE and progressive external ophthalmople- regions include m.8993T>G (p.L156R, MITOCHONDRIAL DISORDERS gia may be caused by mtDNA deletion ATP6) and m.8993T>C (p.L156P, ATP6) An estimated 1,500 nuclear- or mtDNA multiple deletions secondary for NARP (Neuropathy, Ataxia, Retinitis encoded proteins are targeted to mito- to defects in nuclear genes such as Pigmentosa) syndrome and m.11778G>A chondria [Calvo et al., 2006] (Table 1). POLG, OPA1, and TWINKLE [Milone (p.R340H, ND4), m.3460G>A (p.A52T, Defects in any of these genes can poten- et al., 2008, 2009; Van Hove et al., ND1), and m.14484T>C(p.M64V, tially cause mitochondrial disorders. 2009]. ND6) for LHON (Leber Hereditary However, mutations have been identified A definitive molecular diagnosis Optic Neuropathy). Depending on the in only about 150 nuclear genes (Table of a primary mitochondrial RC disor- degree of mutation heteroplasmy, the 2). Except for the analysis of whole mi- der (RCD) is important to administer m.8993T>G (p.L156R, ATP6) mutation tochondrial genome, which is now rou- prompt treatment and appropriate can cause a continuous spectrum of syn- tinely being sequenced for diagnostic patient care. In addition, identification dromes from asymptomatic (<60%) to purposes, the limited nuclear subset of of the disease-causing genes, specific retinopathy (60–75%), NARP (75–90%), genes that are available for clinical mutations, and the mode of inheritance and Leigh syndrome (>90%) [Enns et al., sequence analysis is listed in Table 2. will facilitate accurate genetic counsel- 2006]. Mutations causing LHON are usu- ling. Furthermore, upon identification ally homoplasmic, and there is a difference mtDNA Depletion: Nuclear Gene of mutations, genetic testing of at-risk in penetrance between male and female Defects family members will become available. carriers. Mutations causing LHON pri- The identification of mtDNA As most of the autosomal recessive mi- marily affect the eyes. Nuclear modifier depletion or multiple deletions may tochondrial disorders are severe and genes and tissue-specific factors are specu- suggest a Mendelian disorder because

Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG 155 Table 1. Categories of Nuclear Genes Targeted to Mitochondria

Category Number Category Number Category Number Category Number

Apoptosis 50 Metabolisma 350a Proteases 25 tRNA synthase 22 Chaperone 20 Mito dynamics 10 Nucleases 5 Transportersd 75 Cytochromes 15 Replication 10 RNA mod 5 Protein folding and modification 12 Cytoskeletal 10 Transcription 30 Translationb 15 Protein import: TIMMs and TOMMs 30 DNA repair 12 Regulation 5 MRPLsc 55 RC complex and assembly 150 Fe-S cluster 3 Porins 4 MRPSsc 36 RNA modification and processing 10 Immune 2 ROS 15 Others 175 Unknown 150

aMetabolic pathways include amino acids, carbohydrates, creatine, iron, ketones, Kreb cycle, lipids, nucleotide, phospholipid, porphyrin, steroid, tetrahydrofolate, tRNA, CoQs, pyruvate, etc. bTranslation: initiation, elongation, termination proteins and factors. cMRP: mitochondrial ribosomal proteins large and small subunits. dTransporters: ATP-binding cassette, iron, nucleotides, solutes, and uncouplers.

Table 2. Nuclear Genes Causing Mitochondrial Disorders That Are Currently Analyzed by Clinical Diagnostic Laboratories

1. OXPHOS Subunit Genes NDUFA1, NDUFA2, NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS5, NDUFS6, NDUFS7, NDUFS8, NDUFV1, NDUFV2, NDUFA11, COX6B1, SDHA, SDHB, SDHC, SDHD 2. OXPHOS Complex Assembly Genes NDUFAF1, NDUFAF2, SDH5, BCS1L, SCO1, SCO2, SURF1, LRPPRC, COX15, COX10, ATPAF1, COX6B2, TMEM70 3. Enzymes ABCB7, APTX, ASS1, BCKDHA, BCKDHB, CABC1, COQ2, COQ9, CYCS, DLD, ETHE1, ETFA, ETFB, ETFDH, FH, HADHA, HADHB, HMGCL, MCCC2, MCCC1, PC, PCK2, PDHA1, PDHB, PDHX, PDSS1, PDSS2, PPM1B, TAZ, C12orf65, C14orf156, C18orf22, CPT1A, CPT1B, CPT2, FASTKD2, HLCS, PDK1, MMAA, MMAB, MMACHC, MMADHC, MRP63, MUT, OGDH, OTC, CPS1, NAGS, OXA1L 4. Mitochondrial Transcription Factors, tRNA Post-Transcription Modification Enzymes, Amino Acyl tRNA Synthetases, Translation Factors, and Mitochondrial Ribosomal Proteins TFAM, NRF1, PGC1, GABPA, GABPB1, PUS1, DARS2, RARS2, GFM1, TSFM, TUFM, MRPS16, MRPL33 5. Mitochondrial Membrane Proteins, Carriers, and Transporters DNC, ANT1, TIMM8A, PHC, VDAC1, CACT 6. Mitochondrial DNA Synthesis and Mitochondrial Dynamics DGUOK, MPV17, POLG, POLG2, c10orf2, RRM2B, SUCLA2, SUCLG2, SUCLG1, TK2, TYMP, DNA2, MFN2, OPA1, OPA3, PINK1, SPG7

the maintenance of mtDNA integrity is the clinical manifestations of patients often have neonatal onset of severe liver highly dependent on a number of nu- with POLG mutations can be extremely disease with neurological features clear-encoded proteins. The mtDNA heterogeneous [DiMauro, 2004; Wong including hypotonia, developmental depletion syndromes (MDDSs) are et al., 2008b]. It includes the most delay, nystagmus, neuropathy, encephal- autosomal recessive disorders caused by severe form of childhood myocerebro- opathy, and early death [Mandel et al., molecular defects in nuclear genes that hepatopathy spectrum disorders, spino- 2001; Dimmock et al., 2008]. In con- are involved in mtDNA biogenesis and cerebellar ataxia with epilepsy, sensory trast, patients with POLG deficiency maintenance of dNTP pools, and when ataxic neuropathy with dysarthria and have a predominantly encephalopathic mutated result in a reduction in cellular ophthalmoparesis (SANDO), and auto- presentation and hepatic failure usually mtDNA content. At present, mutations somal dominant and recessive forms of occurs long after the initial encephalop- in at least nine genes (TYMP, POLG, PEO [Van Goethem et al., 2001, 2003; athy [Horvath et al., 2006; Wong et al., DGUOK, TK2, SUCLA2, MPV17, Lamantea et al., 2002]. 2008b]. Hepatic failure may be induced SUCLG1, RRM2B, and C10orf2)have In addition to Alpers syndrome, by infection or the antiepileptic drug, been found to result in mtDNA deple- the hepatocerebral form of MDDS is a valproic acid [Lutz et al., 2009; Saneto tion with somewhat tissue-specific common cause of severe infantile mito- et al., 2010]. The TWINKLE gene involvement [Hakonen et al., 2007; chondrial disease with liver failure and encodes a DNA helicase [Spelbrink Sarzi et al., 2007; Spinazzola and encephalopathy, which includes molec- et al., 2001]. Heterozygous TWINKLE Zeviani, 2007; Wong et al., 2007, 2008; ular defects in MPV17, DGUOK, and mutations result in mtDNA multiple Dimmock et al., 2008; Spinazzola et al., TWINKLE genes. MPV17 is a mito- deletions and cause the autosomal dom- 2009]. chondrial inner membrane protein inant form of PEO, while autosomal re- Mutations in the POLG gene are whose function is not clear [Spinazzola cessive TWINKLE mutations cause a the most common nuclear gene defects et al., 2006]. Deficiency of MPV17 is hepatocerebral form of MDDS causing mitochondrial disorders. Alpers characterized by infantile hepatic failure. [Hakonen et al., 2007]. syndrome is the most common autoso- Patients die before neurological deficits Mutations in TK2 and SUCLA2 mal recessive form of POLG deficiency, started [Wong et al., 2007; El-Hattab are responsible for the severe myopathic which is characterized by refractory et al., 2010]. Deoxyguanosine kinase form of MDDS [Elpeleg et al., 2005; seizures, psychomotor regression, and (DGUOK) is responsible for the salvage Galbiati et al., 2006; Carrozzo et al., liver failure [Naviaux and Nguyen, of purine nucleosides in the mitochon- 2007; Ostergaard et al., 2007a,b]. The 2004; Nguyen et al., 2005]. However, dria. Patients with DGUOK deficiency mitochondrial thymidine kinase (TK2)

156 Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG is an enzyme responsible for the salvage IV (cytochrome c oxidase) assembly fac- Patton et al., 2005; Fernandez-Vizarra of pyrimidine nucleosides. Patients with tors, including SURF1 (Leigh), SCO1 et al. 2007]. Mutations have also been TK2 deficiency present with congenital (encephalohepatopathy), SCO2 (cardio- identified in mitochondrial arginyl- and muscular dystrophy, elevated CK, myopathy), COX10 (encephalonephrop- aspartyl-tRNA synthetase genes (RARS2 ragged red fibers, and COX-deficient athy), and COX15 (myopathy) [Tiranti and DARS2) [Edvardson et al., 2007; fibers. Deficiency of SUCLG1 (Succinyl et al., 1998; Valnot et al., 2000; Antonicka Scheper et al., 2007]. Furthermore, mito- CoA Ligase GDP-binding protein sub- et al., 2003; Tay et al., 2004]. Mutations chondrial translation elongation factors unit alpha) also causes myopathy in in a Complex III assembly gene, BCS1L, are also targets in which mutations cause addition to severe lactic acidosis and have also been reported [de Lonlay et al., mitochondrial disease [Smeitink et al., encephalopathy [Ostergaard et al., 2001]. Recently, molecular defects in 2006; Valente et al., 2009]. Evidently, all 2007a,b]. MDDS due to defects in TMEM70, an assembly factor for Com- mitochondrial tRNA synthetases, tRNA SUCLA or SUCLG genes can be dis- plex V, ATP synthetase, have been nucleotide modification enzymes, and tinguished from others by a mild eleva- reported in patients with elevated translation factors are potential causes of tion of methylmalonic acid [Elpeleg 3-methyl glutaconic acid and cardiomy- mitochondrial disorders. Thus, all these et al., 2005; Carrozzo et al., 2007; opathy [Willems et al., 2008; Houstek genes need to be considered in the molec- Ostergaard et al., 2007a,b]. et al., 2009]. Molecular defects in ular diagnosis of mitochondrial disease. The GI form of MDDS, MNGIE OXPHOS subunit genes or genes essen- (mitochondrial neurogastrointestinal tial for complex assembly may cause an MOLECULAR encephalomyopathy), is causes by thy- isolated complex deficiency depending on METHODOLOGIES USED FOR midine phosphorylase (TP) deficiency, the defective gene [Dieteren et al., 2008; DIAGNOSIS OF which affects primarily the smooth Hoefs et al., 2008; Willems et al., 2008; MITOCHONDRIAL DISORDERS muscle and the brain [Nishino et al., Saada et al., 2009]. Thus, assay of RC The recurrent common mtDNA 1999]. Mutations in p-53-inducible complex activities may prioritize genes for point mutations can be easily screened ribonucleotide reductase, RRM2B, sequence analysis. by using various mutation detection cause mtDNA depletion in multiple methods, including PCR/restriction organs and a wide clinical spectrum Other Nuclear Genes Involved in fragment length polymorphism (RFLP), including myopathy, Leigh-like, and Mitochondrial Structure and PCR/allele-specific oligonucleotide MNGIE-like syndromes [Bourdon Function (ASO) dot blot analysis, TaqMan allele et al., 2007; Shaibani et al., 2009]. Mitochondrial encephalomyopa- discrimination assay, allele refractory Because of the diverse, yet overlap- thies caused by Coenzyme Q10 (CoQ10) mutation system (ARMS), or direct ping, clinical features of MDDSs and their deficiency are now well recognized sequencing. The multiplex PCR/ASO multiple gene etiology, a quick way to because of the discovery of mutations in dot blot method appeared to be the screen for and establish mtDNA depletion genes involved in the CoQ10 biosynthetic most cost effective because it allowed si- before sequence analysis of candidate nu- pathway, including PDSS1, PDSS2, multaneous analysis of all common clear genes would be ideal. This can be COQ2, CABC1,andCOQ9 [Quinzii point mutations with a sensitivity of achieved by quantitative PCR (qPCR) et al., 2005; Mollet et al., 2007, 2008; detecting heteroplasmy as low as 0.5% analysis to determine mtDNA copy num- Lagier-Tourenne et al., 2008]. Secondary [Wong and Senadheera, 1997]. The ber in affected tissues [Dimmock et al., CoQ10 deficiency was also found to be ARMS qPCR analysis, however, allows 2010; Wong et al., 2010]. associated with ETFDH and APTX muta- real-time one-step detection and quan- mtDNA multiple deletions in tions[Quinziietal.,2006;Gempeletal., tification of the mutation heteroplasmy muscle have been found in SANDO 2007]. Several groups of genes play crucial as low as 0.1% [Bai and Wong, 2004]. patients with autosomal recessive muta- roles in the mitochondrial protein transla- For the detection of mtDNA large tions in POLG and in patients with tion machinery. These include mitochon- deletions, Southern blot analysis is usu- autosomal dominant mutations in genes drial ribosomal proteins (MRPs), tRNA ally used [Shanske and Wong, 2004]. responsible for the maintenance of posttranscriptional modification enzymes, Since most pathogenic mtDNA mtDNA integrity, including TWIN- amino acyl-tRNA synthetases, and mito- mutations are heteroplasmic, quantifica- KLE, ANT1, POLG2, and OPA1 chondrial protein translation factors. Pro- tion of mutation heteroplasmy is impor- [Naimi et al., 2006; Milone et al., tein subunits of mitochondrial large and tant to permit correlation with disease 2009]. Mutations in this group of genes small ribosomes (named MRPL’s and expression. Most of the mutation detec- may cause an autosomal dominant form MRPS’s, respectively) play important roles tion methods mentioned earlier do not of PEO characterized by muscle weak- in maintaining the ribosomal structure allow quantification of mutant hetero- ness, ptosis, and ophthalmoplegia. necessary for mitochondrial protein syn- plasmy load. Traditionally, the last cycle thesis [Kenmochi et al., 2000]. It is very hot PCR linked to RFLP analysis fol- OXPHOS Complex Subunits and likely that defects in any of the MRPs will lowed by phosphoimaging detection has Complex Assembly Genes cause mitochondrial disorders, but because been used for the quantification of het- Molecular defects in nuclear genes of the lack of an efficient molecular testing eroplasmy levels [Shanske and Wong, likely account for the majority of the method, currently only two such cases 2004]. However, this method requires severe mitochondrial disorders that are have been reported [Miller et al., 2004]. radioactive material and quantification is present in infants and children. In addition All 22 mitochondrial tRNAs are not always reliable. A more sophisti- to genes responsible for MDDSs, nuclear- subject to posttranscriptional modifica- cated method, ARMS qPCR, has been encoded complex subunits (75 of them) tion. Molecular defects in PUS1 (pseu- developed for this purpose [Bai and and complex assembly factors are another douridine synthase 1) have been reported Wong, 2004] (see below). group of genes that cause autosomal reces- in several patients with MLASA (myopa- Previous studies demonstrated that sive mitochondrial RCDs. The most thy, lactic acidosis, and sideroblastic ane- analysis of a panel of the 12 most com- common of these are defects in Complex mia) [Bykhovskaya et al., 2004, 2007; mon point mutations for MELAS,

Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG 157 ple, the 18S rRNA gene), followed by densitometric analysis of the autoradio- gram or phosphoimage [Shanske and Wong, 2004], has been used to determine mtDNA content. However, this method is tedious and requires a large amount of DNA. Recently, real-time qPCR (RT qPCR) analysis has been developed for this purpose [Dimmock et al., 2010]. Using the qPCR method, mtDNA content in affected tissues, such as muscle or liver, can be rapidly determined. If there is an indication of mtDNA depletion, the relevant nuclear genes can then be selected based on clinical presentation for sequence analysis. Increased mtDNA content could suggest a compensatory amplification of mtDNA because of mitochondrial dysfunction. Increased mtDNA content has been observed in patients with point Fig. 1. Major function of mitochondria: producing energy. [Color figure can be viewed in the mutations in mitochondrial tRNA online issue, which is available at wileyonlinelibrary.com.] genes or with mtDNA deletions. Enzymatic assays of RC complex activities can be used to determine the defective complex and whether the deficiency is in an isolated complex or affects multiple complexes. For example, if the molecular defects reside in a complex subunit or assembly gene, isolated deficiency of the specific complex will be observed [Zhu et al., 1998]. In contrast, mtDNA depletion will cause a reduction in activities of all complexes containing mtDNA-encoded protein subunits [Wong et al., 2007; Dimmock et al., 2008]. Combined deficiencies of Complexes I þ III and II þ III are suggestive of defects in the biosynthetic pathways of CoQ10 [Quinzii et al., 2005; Mollet et al., 2007, 2008; Lagier-Tourenne et al., 2008]. Fig. 2. Recognizable mitochondrial syndromes and causative genes. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.] CURRENT DIAGNOSTIC APPROACHES Current practice in the molecular MERRF, NARP, Leigh disease, LHON, 2008; El-Hattab et al., 2010]. The diagnosis of mitochondrial disorders and large deletions detected mutations in selection of candidate genes for begins with a thorough clinical evalua- only about 6% of the patients suspected sequencing analysis is based on individ- tion followed by metabolic screening of having mitochondrial disorders [Liang ual clinical presentation and biochemical and imaging studies [Haas et al., 2007, and Wong, 1998]. Search for unknown evaluation. For recognizable syndromes, 2008; Wong et al., 2010]. Based on the mutations in the entire mitochondrial a group of candidate genes may be results of clinical, biochemical, and genome by sequencing analysis slightly sequenced. However, because of genetic imaging evaluations, if a mitochondrial improved the mutation detection rate and clinical heterogeneity underlying disorder is indicated, screening for the [Smeitink et al., 2001; Spinazzola and mitochondrial disorders, it is often diffi- most common mtDNA mutations, Zeviani, 2005; Brautbar et al., 2008; cult to determine the exact ‘‘syndrome’’ including m.3243A>G, m.8344A>T, Elliott et al., 2008]. This suggests that or genes to be sequenced. Thus, molec- m.8993T>G, and m.8993T>C point the vast majority of the molecular defects ular or biochemical screening methods mutations, as well as single mtDNA causing mitochondrial RC deficiency re- that can quickly determine mtDNA deletions (for multisystem disorders side in nuclear genes. copy number or RC enzyme complex with variable clinical presentation) is Identification of molecular defects activities may be helpful in the rational usually the first step to promptly con- in nuclear genes is usually performed by selection of genes to be sequenced firm the diagnosis. Since, to date, direct Sanger sequencing analysis of the [Dimmock et al., 2010; Wong et al., POLG1 is the most frequently mutated candidate genes following PCR amplifi- 2010]. For example, Southern blot anal- nuclear gene that causes highly variable cation of the coding exons [Wong ysis with radioactive probes for both clinical phenotypes, DNA sequence et al., 2007, 2008; Dimmock et al., mtDNA and nuclear DNA (for exam- analysis of POLG1 gene is usually rec-

158 Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG ommended following negative common Table 3. mtDNA Depletion in Blood, Muscle, and Liver mtDNA mutation screening [Wong Specimens et al., 2008b, 2010]. If only a blood sample is available, screening analysis for Blood Specimens Muscle Specimens Liver Specimens mtDNA deletions and point mutations Mutation Number of Number of Number of is negative, and the patient presents with of Genes Patients % Mean 6 SD Patients % Mean 6 SD Patients % Mean 6 SD a recognizable clinical syndrome (Fig. 2); specific nuclear gene(s) or genes can be POLG 83 78 6 33 8 35 6 20 2 14 6 17 selected for DNA sequence analysis. If DGUOK 12 52 6 21 2 35 6 20 4 5 6 1.5 MPV17 8506 15 4 28 6 27 8 10 6 9 there is clear indication of maternal in- TK2 5796 13 3 25 6 2 1 N.A. heritance, sequence analysis of the entire TP 5706 20 mitochondrial genome is warranted, SUCLG1 3726 23 1 N.A. which is preferably performed on DNA RRM2B 6 6 43913 2 13 8 extracted from affected tissues such as SUCLA2 2866 34 1 N.A. muscle or liver. As mentioned earlier, if Blood specimens: total number of patients 5 122, average % mean 6 SD 5 72 6 31; muscle specimens: total number of patients 5 muscle or liver tissue is available for test- 21, average % mean 6 SD 5 33 6 21; liver specimens: total number of patients 5 15, average % mean 6 SD 5 8 6 7.The average percentage of mtDNA content in patients with a molecularly proven mtDNA depletion syndrome compared to mtDNA content in ing, results from qPCR analysis of age- and tissue-matched pooled controls is given. The mtDNA copy number of each affected patient was measured by real-time qPCR and compared to the mtDNA copy number of age- and tissue-matched mean to obtain the percentage. mtDNA contents (in reference mtDNA content and electron transport to matched control mean) of patients with molecular defects in the same gene were then averaged and tabulated. chain activities in these tissues may help with the diagnosis and the selection of genes for sequence analysis. Currently, the gold standard of confirming a suspected diagnosis of mitochondrial disease is to perform sequence analysis of the candidate gene(s) to identify the disease-causing pathogenic mutation(s). Large deletions that cannot be detected by sequencing may be detected by traditional Southern blot analysis or targeted oligonucleotide array comparative genomic hybridization (aCGH) [Lacbawan et al., 2000; Wong et al., 2008a, 2010; Chinault et al., 2009; Lee et al., 2009; Mardis, 2009; Shchelochkov et al., 2009]. To correlate pathogenic mtDNA mutations with clinical phenotype, it is important to determine the degree of mutation heteroplasmy in various tissues by last cycle hot PCR/RFLP or ARMS qPCR [Bai and Wong, 2004; Shanske and Wong, 2004; Enns et al., 2006]. The degree of heteroplasmy for mtDNA deletion and content of mtDNA molecules may be determined by qPCR or targeted aCGH [Chinault et al., 2009; Dimmock et al., 2010].

QUANTITATIVE SCREENING FOR MDDS MDDS is by far the most severe and common mitochondrial disorder caused by mutations in a group of nuclear genes responsible for the biogenesis of mtDNA and the maintenance of mtDNA integrity. RT qPCR analysis has shown that the mtDNA content increases with age in muscle tis- Fig. 3. Targeted oligonucleotide aCGH: simultaneous detection of nuclear gene copy number sue, but decreases with age in blood change and mtDNA depletion. A: Detection of a 1.8-kb heterozygous deletion encompassing Exon samples [Dimmock et al., 2010]. Table 4ofDGUOK gene in the affected son. Mother carried the deletion. Father carried a point mutation 3 shows that in 158 samples (122 that was detected by sequence analysis. B: The black dots illustrate the approximate position of the blood, 21 muscle, and 15 liver) from oligonucleotide probes that are lost. The coordinates indicated the deletion breakpoints subsequently determined by PCR/sequencing. C: The mtDNA profile in the MitoMet array. The mtDNA patients with a molecularly proven content in the affected liver specimen is severely depleted to about 6% of tissue-matched control. MDDS, severe mtDNA depletion was The mtDNA content in blood is also reduced (50% of age- and tissue- matched control). The detected in liver and muscle tissues mtDNA content in the blood specimen of the carrier mother and father is within the normal range. [Dimmock et al., 2010]. The mtDNA [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.] content in blood samples of patients

Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG 159 points and the percentage of mtDNA deletion heteroplasmy. The same custom- designed oligonucleotide MitoMet aCGH, described earlier, that contained not only dense coverage of mitochondrial targeted nuclear genes but also tiled coverage of the entire 16.6-kb mitochondrial genome was used to quickly evaluate for mtDNA deletions and depletion. As shown in Figure 4, the deletion breakpoints and the percent mtDNA deletion heteroplasmy can be easily deduced from the oligonucleotide aCGH [Chinault et al., 2009]. These studies strongly suggest that the targeted oligonucleotide custom array is capable of reliably detecting mtDNA deletions while simultaneously elucidating of the deletion breakpoints and percentage of heteroplasmy. In addition, simultaneous detection of copy Fig. 4. mtDNA deletion and depletion illustrated by MitoMet aCGH. Lanes A–C show the approximate deletion breakpoint and deletion heteroplasmy load. A: Pearson syndrome patient, number changes in both nuclear and mi- 5-kb deletion, 85% heteroplasmy; B: hearing loss/diabetes, 7.5-kb deletion, 20% hetero- tochondrial genomes makes this dual ge- plasmy; C: KSS, 4.1-kb deletion, 75% heteroplasmy; and D: mtDNA depletion, to about 50% nome array of tremendous value in the of control mtDNA copy number levels. [Color figure can be viewed in the online issue, which diagnoses of MDDSs [Chinault et al., is available at wileyonlinelibrary.com.] 2009].

PITFALLS OF CURRENT MOLECULAR DIAGNOSTIC with MDDS is reduced but not as 2010]. The oligonucleotide aCGH has APPROACH FOR significantly as in muscle or liver excellent utility for the detection of MITOCHONDRIAL DISORDERS specimens [Dimmock et al., 2010]. intragenic large deletions, particularly in The current diagnosis of mitochon- Thus, qPCR can be used to quickly autosomal recessive mtDNA depletion drial disorders involves multiple steps and screen for mtDNA depletion in mus- disorders when only one mutant allele multiple techniques that include screening cle or liver specimens. Following this is detected by sequencing despite clear of common mtDNA point mutations and screening method, mutations in the demonstration of mtDNA depletion by large deletions, sequencing of the whole POLG, RRM2B, and MPV17 genes copy number analysis [Lee et al., 2009; mitochondrial genome, sequential can be identified prospectively [Dim- Zhang et al., 2010]. Figure 3 provides sequencing of a group of candidate nu- mock et al., 2010]. an example of a hepatocerebral form of clear genes, specific methods to quantify MDDS of an infant referred for tyrosi- mtDNA mutation heteroplasmy, mtDNA THE UTILITY OF nemia detected on newborn screening copy number, and large mtDNA dele- OLIGONUCLEOTIDE aCGH who subsequently developed liver fail- tions. Sequencing candidate genes one by Direct sequencing of relevant ure. DNA sequence analysis revealed a one is tedious. Further, it is impossible to genes is currently the primary clinical heterozygous missense mutation analyze all 1,500 nuclear genes, which technique available to identify mutations (c.679G>A, p.E227K) in the deoxygua- produce proteins that function within mi- in human diseases. However, this nosine kinase (DGUOK) gene, while tochondria. Rather, sequence analysis is approach will not detect large intragenic qPCR analysis of liver DNA showed a clinically available on only a small fraction or whole gene deletions. Large dele- severe reduction in mtDNA content. (about 100–150) of these genes. Even after tions are conventionally detected by Using oligonucleotide aCGH, an intra- exhaustive sequence analysis, majority of Southern blot [Shanske and Wong, genic heterozygous 1.8-kb deletion patients suspected of having mitochon- 2004] or multiplex ligation-dependent encompassing Exon 4 of the DGUOK drial disorders remain without a definitive probe amplification analysis. These pro- gene (Figs. 3A and 3B) was detected. diagnosis. cedures are tedious and do not estimate The mtDNA profile on the same array the deletion breakpoints. Recently, a showed mtDNA depletion in liver (6%) FUTURE APPROACHES targeted custom oligonucleotide-based and in blood (50%; Fig. 3C) [Lee et al., TOWARD ONE-STEP, 1 microarray (MitoMet ) has been 2009]. Similarly, a heterozygous intra- COMPREHENSIVE, DUAL designed to provide high-density cover- genic deletion of 5.8 kb was detected GENOME ANALYSIS age of a set of 192 nuclear genes in two deceased siblings with a congen- To overcome the obstacles inherent involved in the pathogenesis of meta- ital myopathic form of MDDS but who in the current diagnosis of mitochondrial bolic and mitochondrial disorders harbored only one sequence detectable disorders, a comprehensive method is [Wong et al., 2008a; Chinault et al., heterozygous point mutation, p.I254N, needed that would allow simultaneous 2009]. Using the MitoMet array, intra- in the TK2 gene [Zhang et al., 2010]. qualitative and quantitative analysis of all genic deletions in nuclear genes The current procedures for the di- genes (both nuclear- and mitochondrial- (including DGUOK, TK2, MPV17, agnosis of mtDNA deletion syndromes encoded) targeted to mitochondria in a and POLG1) have been detected and based on Southern analysis are particularly time and cost-effective fashion. This can reported [Lee et al., 2009; Zhang et al., inefficient in determining deletion break- be achieved by the application of novel,

160 Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG high-throughput sequencing technologies ease genes through integrative genomics. tron-transferring-flavoprotein dehydrogenase to bi-genomic analysis [Vasta et al., 2009]. Nat Genet 38:576–582. (ETFDH) gene. Brain 130:2037–2044. Carrozzo R, Dionisi-Vici C, Steuerwald U, et al. Gropman A, Chen TJ, Perng CL, et al. 2004. A large number of target genes may be 2007. SUCLA2 mutations are associated Variable clinical manifestation of homoplas- captured by custom-designed oligonu- with mild methylmalonic aciduria, Leigh- mic G14459A mitochondrial DNA muta- cleotide probes on microarrays or selected like encephalomyopathy, dystonia and deaf- tion. Am J Med Genet A 124A:377–382. by hybridization to RNA baits in solu- ness. Brain 130:862–874. HaasRH,ParikhS,FalkMJ,etal.2007.Mitochon- tion. Captured target DNA template is Chinault AC, Shaw CA, Brundage EK, et al. drial disease: a practical approach for primary 2009. Application of dual-genome oligonu- care physicians. Pediatrics 120:1326–1333. then massively parallel-sequenced with cleotide array-based comparative genomic Haas RH, Parikh S, Falk MJ, et al. 2008. The in- deep coverage using one of the next gen- hybridization to the molecular diagnosis of depth evaluation of suspected mitochondrial eration sequencing instruments [Vasta mitochondrial DNA deletion and depletion disease. Mol Genet Metab 94:16–37. et al., 2009]. The characteristics of the syndromes. Genet Med 11:518–526. Hakonen AH, Isohanni P, Paetau A, et al. 2007. capture design must include the mito- Corral-Debrinski M, Horton T, Lott MT, et al. Recessive Twinkle mutations in early onset 1992. Mitochondrial DNA deletions in encephalopathy with mtDNA depletion. chondrial genome and take into consider- human brain: regional variability and increase Brain 130:3032–3040. ation that the mitochondrial genome is with advanced age. Nat Genet 2:324–329. Hoefs SJ, Dieteren CE, Distelmaier F, et al. 2008. present in 300-fold higher copy number de Lonlay P, Valnot I, Barrientos A, et al. 2001. NDUFA2 complex I mutation leads to Leigh than average nuclear genes. To detect large A mutant mitochondrial respiratory chain disease. Am J Hum Genet 82:1306–1315. deletions and estimate mtDNA mutation assembly protein causes complex III defi- Horton TM, Petros JA, Heddi A, et al. 1996. ciency in patients with tubulopathy, ence- Novel mitochondrial DNA deletion found heteroplasmy, the target sequences must phalopathy and liver failure. Nat Genet in a renal cell carcinoma. Genes Chromo- be completely captured and sequenced at 29:57–60. somes Cancer 15:95–101. a reasonable depth of about 100-fold (for Dieteren CE, Willems PH, Vogel RO, et al. 2008. Horvath R, Hudson G, Ferrari G, et al. 2006. nuclear genes) to 1,000-fold (for mito- Subunits of mitochondrial complex I exist as Phenotypic spectrum associated with muta- chondrial genes). Such an approach will part of matrix- and membrane-associated tions of the mitochondrial polymerase subcomplexes in living cells. J Biol Chem gamma gene. Brain 129:1674–1684. allow quick and comprehensive analyses 283:34753–34761. Houstek J, Kmoch S, Zeman J. 2009. TMEM70 simultaneously in both nuclear and mito- DiMauro S. 2004. The many faces of mitochon- protein—a novel ancillary factor of mamma- chondrial genomes for point mutations, drial diseases. Mitochondrion 4:799–807. lian ATP synthase. Biochim Biophys Acta large deletions, copy number changes, and Dimmock D, Tang LY, Schmitt ES, et al. 2010. 1787:529–532. for mtDNA, mutation heteroplasmy load. Quantitative evaluation of the mitochondrial Jessie BC, Sun CQ, Irons HR, et al. 2001. Accu- DNA depletion syndrome. Clin Chem 56: mulation of mitochondrial DNA deletions New disease genes are expected to be dis- 1119–1127. in the malignant prostate of patients of dif- covered using this approach of compre- Dimmock DP, Zhang Q, Dionisi-Vici C, et al. ferent ages. Exp Gerontol 37:169–174. hensive target gene capture followed by 2008. Clinical and molecular features of mi- Kenmochi N, Yoshihama M, Higa S, et al. 2000. deep genome sequencing. n tochondrial DNA depletion due to muta- The human ribosomal protein L6 gene in a tions in deoxyguanosine kinase. Hum Mutat critical region for Noonan syndrome. J 29:330–331. Hum Genet 45:290–293. REFERENCES Edvardson S, Shaag A, Kolesnikova O, et al. 2007. Koene S, Smeitink J. 2009. Mitochondrial medi- Antonicka H, Mattman A, Carlson CG, et al. Deleterious mutation in the mitochondrial cine: entering the era of treatment. J Intern 2003. Mutations in COX15 produce a arginyl-transfer RNA synthetase gene is Med 265:193–209. defect in the mitochondrial heme biosyn- associated with pontocerebellar hypoplasia. Lacbawan F, Tifft CJ, Luban NL, et al. 2000. thetic pathway, causing early-onset fatal hy- Am J Hum Genet 81:857–862. Clinical heterogeneity in mitochondrial pertrophic cardiomyopathy. Am J Hum El-Hattab AW, Li FY, Schmitt E, et al. 2010. DNA deletion disorders: a diagnostic chal- Genet 72:101–114. MPV17-associated hepatocerebral mitochon- lenge of Pearson syndrome. Am J Med Bai RK, Wong LJ. 2004. Detection and quantifi- drial DNA depletion syndrome: new Genet 95:266–268. cation of heteroplasmic mutant mitochon- patients and novel mutations. Mol Genet Lagier-Tourenne C, Tazir M, Lopez LC, et al. drial DNA by real-time amplification refrac- Metab 99:300–308. 2008. ADCK3, an ancestral kinase, is tory mutation system quantitative PCR anal- Elliott HR, Samuels DC, Eden JA, et al. 2008. mutated in a form of recessive ataxia associ- ysis: a single-step approach. Clin Chem Pathogenic mitochondrial DNA mutations ated with coenzyme Q10 deficiency. Am J 50:996–1001. are common in the general population. Am Hum Genet 82:661–672. Bianchi MS, Bianchi NO, Bailliet G. 1995. Mito- J Hum Genet 83:254–260. Lamantea E, Tiranti V, Bordoni A, et al. 2002. chondrial DNA mutations in normal and tu- Elpeleg O, Miller C, Hershkovitz E, et al. 2005. Mutations of mitochondrial DNA polymerase mor tissues from breast cancer patients. Deficiency of the ADP-forming succinyl- gammaA are a frequent cause of autosomal Cytogenet Cell Genet 71:99–103. CoA synthase activity is associated with ence- dominant or recessive progressive external Bourdon A, Minai L, Serre V, et al. 2007. Muta- phalomyopathy and mitochondrial DNA ophthalmoplegia. Ann Neurol 52:211–219. tion of RRM2B, encoding p53-controlled depletion. Am J Hum Genet 76:1081–1086. Lee NC, Dimmock D, Hwu WL, et al. 2009. Si- ribonucleotide reductase (p53R2), causes Enns GM, Bai RK, Beck AE, et al. 2006. Molec- multaneous detection of mitochondrial severe mitochondrial DNA depletion. Nat ular–clinical correlations in a family with DNA depletion and single-exon deletion in Genet 39:776–780. variable tissue mitochondrial DNA T8993G the deoxyguanosine gene using array-based Brautbar A, Wang J, Abdenur JE, et al. 2008. The mutant load. Mol Genet Metab 88:364–371. comparative genomic hybridisation. Arch mitochondrial 13513G>A mutation is asso- Fernandez-Vizarra E, Berardinelli A, Valente L, et al. Dis Child 94:55–58. ciated with Leigh disease phenotypes inde- 2007. Nonsense mutation in pseudouridylate Liang MH, Wong LJ. 1998. Yield of mtDNA pendent of complex I deficiency in muscle. synthase 1 (PUS1) in two brothers affected by mutation analysis in 2,000 patients. Am J Mol Genet Metab 94:485–490. myopathy, lactic acidosis and sideroblastic anae- Med Genet 77:395–400. Bykhovskaya Y, Casas K, Mengesha E, et al. 2004. mia (MLASA). J Med Genet 44:173–180. Lutz RE, Dimmock D, Schmitt ES, et al. 2009. Missense mutation in pseudouridine synthase Galbiati S, Bordoni A, Papadimitriou D, et al. De novo mutations in POLG presenting 1 (PUS1) causes mitochondrial myopathy 2006. New mutations in TK2 gene associ- with acute liver failure or encephalopathy. J and sideroblastic anemia (MLASA). Am J ated with mitochondrial DNA depletion. Pediatr Gastroenterol Nutr 49:126–129. Hum Genet 74:1303–1308. Pediatr Neurol 34:177–185. Mandel H, Szargel R, Labay V, et al. 2001. The Bykhovskaya Y, Mengesha E, Fischel-Ghodsian N. Geisler S, Holmstrom KM, Skujat D, et al. 2010. deoxyguanosine kinase gene is mutated in 2007. Pleiotropic effects and compensation PINK1/Parkin-mediated mitophagy is de- individuals with depleted hepatocerebral mi- mechanisms determine tissue specificity in mi- pendent on VDAC1 and p62/SQSTM1. tochondrial DNA. Nat Genet 29:337–341. tochondrial myopathy and sideroblastic anemia Nat Cell Biol 12:119–131. Mardis ER. 2009. New strategies and emerging (MLASA). Mol Genet Metab 91:148–156. Gempel K, Topaloglu H, Talim B, et al. 2007. technologies for massively parallel sequenc- Calvo S, Jain M, Xie X, et al. 2006. Systematic The myopathic form of coenzyme Q10 defi- ing: applications in medical research. Ge- identification of human mitochondrial dis- ciency is caused by mutations in the elec- nome Med 1:40.

Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG 161 Miller C, Saada A, Shaul N, et al. 2004. Defective apy for pediatric seizure disorders. Seizure Valnot I, Osmond S, Gigarel N, et al. 2000. mitochondrial translation caused by a ribo- 19:140–146. Mutations of the SCO1 gene in mitoc- somal protein (MRPS16) mutation. Ann Sarzi E, Goffart S, Serre V, et al. 2007. Twinkle hondrial cytochrome c oxidase deficiency Neurol 56:734–738. helicase (PEO1) gene mutation causes mito- with neonatal-onset hepatic failure and Milone M, Brunetti-Pierri N, Tang LY, et al. chondrial DNA depletion. Ann Neurol encephalopathy. Am J Hum Genet 67: 2008. Sensory ataxic neuropathy with oph- 62:579–587. 1104–1109. thalmoparesis caused by POLG mutations. Scheper GC, van der Klok T, van Andel RJ, et al. Van Goethem G, Dermaut B, Lofgren A, et al. Neuromuscul Disord 18:626–632. 2007. Mitochondrial aspartyl-tRNA synthe- 2001. Mutation of POLG is associated with Milone M, Younge BR, Wang J, et al. 2009. Mito- tase deficiency causes leukoencephalopathy progressive external ophthalmoplegia charac- chondrial disorder with OPA1 mutation lacking with brain stem and spinal cord involvement terized by mtDNA deletions. Nat Genet optic atrophy. Mitochondrion 9:279–281. and lactate elevation. Nat Genet 39:534–539. 28:211–212. Mollet J, Delahodde A, Serre V, et al. 2008. Shaibani A, Shchelochkov OA, Zhang S, et al. Van Goethem G, Martin JJ, Dermaut B, et al. CABC1 gene mutations cause ubiquinone 2009. Mitochondrial neurogastrointestinal 2003. Recessive POLG mutations presenting deficiency with cerebellar ataxia and seizures. encephalopathy due to mutations in with sensory and ataxic neuropathy in com- Am J Hum Genet 82:623–630. RRM2B. Arch Neurol 66:1028–1032. pound heterozygote patients with progressive Mollet J, Giurgea I, Schlemmer D, et al. 2007. Shanske S, Wong LJ. 2004. Molecular analysis for external ophthalmoplegia. Neuromuscul Prenyldiphosphate synthase, subunit 1 mitochondrial DNA disorders. Mitochond- Disord 13:133–142. (PDSS1) and OH-benzoate polyprenyltrans- rion 4:403–415. Van Hove JL, Cunningham V, Rice C, et al. ferase (COQ2) mutations in ubiquinone Shchelochkov OA, Li FY, Geraghty MT, et al. 2009. 2009. Finding twinkle in the eyes of a 71- deficiency and oxidative phosphorylation High-frequency detection of deletions and year-old lady: a case report and review of disorders. J Clin Invest 117:765–772. variable rearrangements at the ornithine trans- the genotypic and phenotypic spectrum of Naimi M, Bannwarth S, Procaccio V, et al. 2006. Mo- carbamylase (OTC) locus by oligonucleotide TWINKLE-related dominant disease. Am J lecular analysis of ANT1, TWINKLE and array CGH. Mol Genet Metab 96:97–105. Med Genet A 149A:861–867. POLG in patients with multiple deletions or Smeitink J, van den Heuvel L, DiMauro S. 2001. Vasta V, Ng SB, Turner EH, et al. 2009. Next depletion of mitochondrial DNA by a dHPLC- The genetics and pathology of oxidative generation sequence analysis for mitochon- based assay. Eur J Hum Genet 14:917–922. phosphorylation. Nat Rev Genet 2:342–352. drial disorders. Genome Med 1:100. Naviaux RK, Nguyen KV. 2004. POLG muta- Smeitink JA, Elpeleg O, Antonicka H, et al. 2006. Wallace DC. 1999. Mitochondrial diseases in man tions associated with Alpers’ syndrome and Distinct clinical phenotypes associated with a and mouse. Science 283:1482–1488. mitochondrial DNA depletion. Ann Neurol mutation in the mitochondrial translation Wallace DC, Lott MT, Brown MD, et al. 2001. 55:706–712. elongation factor EFTs. Am J Hum Genet Mitochondria and neuro-ophthalmologic Nguyen KV, Ostergaard E, Ravn SH, et al. 2005. 79:869–877. diseases. In:Scriver CR, Beaudet AL, Sly POLG mutations in Alpers syndrome. Neu- Soong NW, Hinton DR, Cortopassi G, et al. WS, et al., editors.The metabolic and rology 65:1493–1495. 1992. Mosaicism for a specific somatic mito- molecular bases of inherited disease, Vol Nishino I, Spinazzola A, Hirano M. 1999. Thy- chondrial DNA mutation in adult human II. New York: McGraw-Hill. p2425– midine phosphorylase gene mutations in brain. Nat Genet 2:318–323. 2509. MNGIE, a human mitochondrial disorder. Spelbrink JN, Li FY, Tiranti V, et al. 2001. Wallace DC, Shoffner JM, Trounce I, et al. 1995. Science 283:689–692. Human mitochondrial DNA deletions asso- Mitochondrial DNA mutations in human Ostergaard E, Christensen E, Kristensen E, et al. ciated with mutations in the gene encoding degenerative diseases and aging. Biochim 2007a. Deficiency of the alpha subunit of Twinkle, a phage T7 gene 4-like protein Biophys Acta 1271:141–151. succinate-coenzyme A ligase causes fatal in- localized in mitochondria. Nat Genet Willems PH, Valsecchi F, Distelmaier F, et al. fantile lactic acidosis with mitochondrial 28:223–231. 2008. Mitochondrial Ca2þ homeostasis in DNA depletion. Am J Hum Genet 81: Spinazzola A, Invernizzi F, Carrara F, et al. 2009. human NADH:ubiquinone oxidoreductase 383–387. Clinical and molecular features of mitochon- deficiency. Cell Calcium 44:123–133. Ostergaard E, Hansen FJ, Sorensen N, et al. drial DNA depletion syndromes. J Inherit Wong LJ. 2001. Recognition of mitochondrial 2007b. Mitochondrial encephalomyopathy Metab Dis 32:143–158. DNA deletion syndrome with non-neuro- with elevated methylmalonic acid is caused Spinazzola A, Viscomi C, Fernandez-Vizarra E, muscular multisystemic manifestation. Genet by SUCLA2 mutations. Brain 130:853–861. et al. 2006. MPV17 encodes an inner mito- Med 3:399–404. Pagliarini DJ, Calvo SE, Chang B, et al. 2008. A chondrial membrane protein and is mutated Wong LJ, Brunetti-Pierri N, Zhang Q, et al. mitochondrial protein compendium eluci- in infantile hepatic mitochondrial DNA 2007. Mutations in the MPV17 gene are re- dates complex I disease biology. Cell depletion. Nat Genet 38:570–575. sponsible for rapidly progressive liver failure 134:112–123. Spinazzola A, Zeviani M. 2005. Disorders of in infancy. Hepatology 46:1218–1227. Patton JR, Bykhovskaya Y, Mengesha E, et al. nuclear–mitochondrial intergenomic signal- Wong LJ, Dimmock D, Geraghty MT, et al. 2005. Mitochondrial myopathy and sidero- ing. Gene 354:162–168. 2008a. Utility of oligonucleotide array-based blastic anemia (MLASA): missense mutation Spinazzola A, Zeviani M. 2007. Disorders of comparative genomic hybridization for in the pseudouridine synthase 1 (PUS1) nuclear–mitochondrial intergenomic com- detection of target gene deletions. Clin gene is associated with the loss of tRNA munication. Biosci Rep 27:39–51. Chem 54:1141–1148. pseudouridylation. J Biol Chem 280:19823– Spinazzola A, Zeviani M. 2009. Disorders from per- Wong LJ, Naviaux RK, Brunetti-Pierri N, et al. 19828. turbations of nuclear–mitochondrial intergeno- 2008b. Molecular and clinical genetics of Quinzii C, Naini A, Salviati L, et al. 2006. A mic cross-talk. J Intern Med 265:174–192. mitochondrial diseases due to POLG muta- mutation in para-hydroxybenzoate-poly- Tan DJ, Bai RK, Wong LJ. 2002. Comprehensive tions. Hum Mutat 29:E150–E172. prenyl transferase (COQ2) causes primary scanning of somatic mitochondrial DNA Wong LJ, Scaglia F, Graham BH, et al. 2010. Cur- coenzyme Q10 deficiency. Am J Hum mutations in breast cancer. Cancer Res rent molecular diagnostic algorithm for mi- Genet 78:345–349. 62:972–976. tochondrial disorders. Mol Genet Metab Quinzii CM, Kattah AG, Naini A, et al. 2005. Tay SK, Shanske S, Kaplan P, et al. 2004. Associa- 100:111–117. Coenzyme Q deficiency and cerebellar tion of mutations in SCO2, a cytochrome c Wong LJ, Senadheera D. 1997. Direct detection of ataxia associated with an aprataxin mutation. oxidase assembly gene, with early fetal multiple point mutations in mitochondrial Neurology 64:539–541. lethality. Arch Neurol 61:950–952. DNA. Clin Chem 43:1857–1861. Saada A, Vogel RO, Hoefs SJ, et al. 2009. Muta- Tiranti V, Hoertnagel K, Carrozzo R, et al. 1998. Zhang S, Li FY, Bass HN, et al. 2010. Application tions in NDUFAF3 (C3ORF60), encoding Mutations of SURF-1 in Leigh disease asso- of oligonucleotide aCGH to the simultane- an NDUFAF4 (C6ORF66)-interacting ciated with cytochrome c oxidase deficiency. ous detection of a deletion in the nuclear complex I assembly protein, cause fatal neo- Am J Hum Genet 63:1609–1621. TK2 gene and mtDNA depletion. Mol natal mitochondrial disease. Am J Hum Valente L, Shigi N, Suzuki T, et al. 2009. The Genet Metab 99:53–57. Genet 84:718–727. R336Q mutation in human mitochondrial Zhu Z, Yao J, Johns T, et al. 1998. SURF1, Saneto RP, Lee IC, Koenig MK, et al. 2010. EFTu prevents the formation of an active encoding a factor involved in the biogenesis POLG DNA testing as an emerging standard mt-EFTu.GTP.aa-tRNA ternary complex. of cytochrome c oxidase, is mutated in Leigh of care before instituting valproic acid ther- Biochim Biophys Acta 1792:791–795. syndrome. Nat Genet 20:337–343.

162 Dev Disabil Res Rev MOLECULAR GENETICS OF MITOCHONDRIAL DISORDERS WONG