Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

Research Article

Targeting MYCN in Neuroblastoma by BET Bromodomain Inhibition

Alexandre Puissant1,3, Stacey M. Frumm1,3, Gabriela Alexe1,3,5,6, Christopher F. Bassil1,3, Jun Qi2, Yvan H. Chanthery8, Erin A. Nekritz8, Rhamy Zeid2, William Clay Gustafson8, Patricia Greninger7, Matthew J. Garnett10, Ultan McDermott10, Cyril H. Benes7, Andrew L. Kung1,3, William A. Weiss8,9, James E. Bradner2,4, and Kimberly Stegmaier1,3,6

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 1 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

A bstract Bromodomain inhibition comprises a promising therapeutic strategy in cancer, particularly for hematologic malignancies. To date, however, genomic biomarkers to direct clinical translation have been lacking. We conducted a cell-based screen of genetically defined cancer cell lines using a prototypical inhibitor of BET bromodomains. Integration of genetic features with chemosensitivity data revealed a robust correlation between MYCN amplification and sensitivity to bromodomain inhibition. We characterized the mechanistic and translational significance of this finding in neuroblastoma, a childhood cancer with frequent amplification of MYCN. Genome-wide expression analysis showed downregulation of the MYCN transcriptional program accompanied by suppression of MYCN transcription. Functionally, bromodomain-mediated inhibition of MYCN impaired growth and induced apoptosis in neuroblastoma. BRD4 knockdown phenocopied these effects, establishing BET bromodomains as transcriptional regulators of MYCN. BET inhibition conferred a significant survival advantage in 3 in vivo neuroblastoma models, providing a compelling rationale for developing BET bro- modomain inhibitors in patients with neuroblastoma.

SIGNIFICANCE: Biomarkers of response to small-molecule inhibitors of BET bromodomains, a new com- pound class with promising anticancer activity, have been lacking. Here, we reveal MYCN amplification as a strong genetic predictor of sensitivity to BET bromodomain inhibitors, show a mechanistic rationale for this finding, and provide a translational framework for clinical trial development of BET bromodomain inhibitors for pediatric patients with MYCN-amplified neuroblastoma.Cancer Discov; 3(3); 1–16. ©2012 AACR.

See related commentary by Schnepp and Maris, p. 255.

INTRODUCTION Modulation of the epigenetic regulators known as “read- ers” has recently emerged as a therapeutic strategy in cancer The interplay between master regulatory transcription treatment. These epigenetic “readers” are structurally diverse factors and specific chromatin-associated coactivators is an proteins, which recognize and bind to covalent modifica- emerging hallmark of cancer. Cancer genomic discovery efforts tions of chromatin (2). One important modification associ- continue to reveal mutations in epigenetic modifiers, and labo- ated with open chromatin and transcriptional activation is ratory efforts to validate functional dependencies are ongo- the side-chain acetylation of lysine residues on histone tails ing (1). Moreover, notable examples of successful commercial (3). The dominant mode of recognition of acetylated lysine development of drugs targeting epigenetic modifiers have residues is by bromodomains present in 47 human proteins come to the fore, including the development of inhibitors of (4–6). We and others have described the therapeutic potential enzymatic “writers,” such as DNA methyltransferases for mye- of targeting one bromodomain-containing family impor- lodysplastic syndrome, and inhibitors of enzymatic “erasers,” tant in regulating transcription, epigenetic memory, and such as histone deacetylases for cutaneous T-cell lymphoma. cell growth: the bromodomain and extraterminal domain (BET) family is composed of BRD2, BRD3, BRD4, and BRDT. Numerous hematologic malignancies and the highly malig- Authors’ Affiliations: Departments of 1Pediatric Oncology and 2Medical nant solid tumor NUT midline carcinoma are responsive to Oncology, Dana-Farber Cancer Institute; 3Boston Children’s Hospital; BET inhibition in vitro and in mouse models (7–12). 4Department of Medicine, Harvard Medical School; 5Bioinformatics Graduate Although disease-specific indications for drugs modifying Program, Boston University, Boston; 6The Broad Institute of Harvard Univer- sity and Massachusetts Institute of Technology, Cambridge; 7Massachusetts epigenetic regulators have been uncovered, precise genomic General Hospital Cancer Center, Harvard Medical School, Charlestown, Mas- biomarkers predictive of treatment response remain elusive. sachusetts; 8Department of Pediatrics, Helen Diller Family Comprehensive To date, the best validated genetic predictor of response to Cancer Center; 9Departments of Neurology and Neurosurgery, Brain Tumor BET inhibitors is in a rare genetically defined subset of poorly Research Center, University of California, San Francisco, San Francisco, differentiated squamous cell carcinomas (NUT midline car- California; and 10Cancer Genome Project, Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Cambridge, United Kingdom cinoma), in which the presence of recurrent t(15;19) chro- Note: Supplementary data for this article are available at Cancer Discovery mosomal translocation results in the expression of the twin Online (http://cancerdiscovery.aacrjournals.org/). N-terminal bromodomains of BRD4 as an in-frame fusion A. Puissant and S.M. Frumm contributed equally to this work. with the NUT protein (13). High-throughput pharmacoge- Corresponding Authors: Kimberly Stegmaier and James E. Bradner, Dana- nomic profiling offers the opportunity to reveal new insights Farber Cancer Institute, Boston, MA 02215. Phone: 617-632-4438; Fax: into selective responses to drugs in defined cancer genotypes. 617-632-4850; E-mail: [email protected]; and James Initial efforts to connect drug response with genotype in the E. Bradner, [email protected] NCI60 cell line panel have since been expanded to screening doi: 10.1158/2159-8290.CD-12-0418 campaigns in large panels of genetically characterized cancer ©2012 American Association for Cancer Research. cell lines (14–17). These efforts have revealed both expected

March 2013 CANCER DISCOVERY | OF2

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 2 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

RESEARCH ARTICLE Puissant et al.

and unexpected connections. For example, the anticipated to JQ1 and a panel of structurally distinct BET bromodo- response to anaplastic lymphoma receptor kinase (ALK) main inhibitors, each of which conferred a dose-responsive, inhibitors in tumors with aberrant ALK activation, such as inhibitory effect on cell viability as well as growth over time lymphoma, non–small cell lung cancer, and neuroblastoma, (Fig. 1D–F and Supplementary Table S2). The only exception was shown in a screen of more than 600 tumor cell lines (15). in this cell line panel was NGP, which was comparatively More recently, the unexpected connections between response insensitive to all of the BET bromodomain inhibitors tested. to PARP inhibitors and expression of the EWS/FLI fusion Importantly, cell growth was not affected in any cell lines protein in Ewing sarcoma was elucidated in a screen of 130 by the (−)-JQ1 enantiomer, which lacks activity against BET drugs in more than 600 cancer cell lines (16). In an independ- bromodomains in biochemical and biologic assays, further ent study of 24 anticancer drugs in 479 human cancer cell supporting an on-target mechanism of action. Similarly, we lines, new connections were also observed between small- retested one of the least sensitive cell lines from the primary molecule sensitivities and cell lineage, gene expression, and screen, the MYCN–wild-type neuroblastoma cell line SK-N- genotype (17). AS and a second MYCN–wild-type cell line SH-SY5Y not in We conducted a high-throughput pharmacogenomic the primary screen. As predicted, SK-N-AS was insensitive screen to identify biomarkers of response to BET bromodo- to the effects of JQ1, and SH-SY5Y was less sensitive than

main inhibitors. The prototype ligand JQ1, a novel thieno- the MYCN-amplified cell lines based on Emax (Supplementary triazolo-1,4-diazepine, which displaces BET bromodomains Fig. S2A and S2B and Supplementary Table S2). from chromatin by competitively binding to the acetyl lysine recognition pocket, has been validated in numerous mod- JQ1 Induces Cell-Cycle Arrest and Apoptosis els, nominating it as an excellent chemical probe for high- To further characterize the phenotypic consequences of throughput screening (7–10). In this study, we therefore JQ1 treatment on responsive MYCN-amplified neuroblas- queried a large compendium of genetically characterized toma cells, we determined its effects on cell-cycle arrest

tumor cell lines to identify predictors of sensitivity to JQ1. We and apoptosis. JQ1 treatment induced a G0–G1 arrest and a identified MYCN amplification as a top predictive marker of decrease in S-phase at 24 hours by flow-cytometric evaluation response to JQ1 treatment and characterized the mechanistic of propidium iodide (PI) staining (Fig. 2A and Supplemen- and translational significance of this finding in neuroblas- tary Fig. S3). A progressive increase in cell death was noted,

toma, the most common extracranial solid tumor diagnosed based on the increase in the sub-G1 fraction, with marked in children, and a cancer notable for frequent MYCN amplifi- induction of apoptosis confirmed by annexin V staining at cation in patients with high-risk disease. 72 hours (Fig. 2B). In contrast, the effect of JQ1 on cell cycle and apoptosis in MYCN–wild-type neuroblastoma was less RESULTS pronounced (Supplementary Fig. S4A and S4B). High-Throughput Pharmacogenomic Profiling Bromodomain Inhibition Downregulates MYCN and Reveals MYCN Amplification as a Predictor c-MYC Transcriptional Programs in Neuroblastoma of Response to Bromodomain Inhibitors Prior research from our laboratory has shown a selective We first conducted an unbiased screen of a collection of effect of BET bromodomain inhibition on the expression and 673 genetically characterized tumor-derived cell lines (16) to function of c-MYC in hematologic malignancies (8–10). We understand response and resistance to BET bromodomain thus hypothesized that the selective sensitivity of neuroblas- inhibition, as a way to discover new opportunities for thera- toma lines to BET inhibition may relate to impaired function peutic development. Cell lines with response to JQ1 yielding of the MYCN and c-MYC transcriptional activators. We pro-

IC50 ≤1 μmol/L and the maximum effect corresponding to the filed 2 of the highly sensitive neuroblastoma cell lines, BE(2)- minimum measured viability Emax ≥70% were designated as sen- C and Kelly, treated with 1 μmol/L JQ1 for 24 hours using sitive and all others were designated as resistant in a stringent genome-wide transcriptional profiling coupled with gene set classification schema. Cell lines arising from the pediatric solid enrichment analysis (GSEA; ref. 18). The top 50 differentially tumor of neural crest origin, neuroblastoma, were identified as upregulated and downregulated genes are depicted in the among the most JQ1 sensitive and MYCN amplification as the heatmap in Fig. 3A, and the full list is reported in Supple- most predictive marker of sensitivity; 4 cell lines of 99 sensitive mentary Table S3. Consistent with the established biologic cell lines are MYCN amplified and 0 cell lines of 237 resistant role of BET coactivators in chromatin-dependent transcrip- cell lines are MYCN amplified. The two-tailed Fisher exact test tional activation, there was a preponderance of downregu- returns a P value of 0.007 (Fig. 1A and B and Supplementary lated genes in comparison with upregulated genes. Acute JQ1 Table S1). We next determined expression level of MYCN in the treatment prompted a dynamic change in transcription, with neuroblastoma cell lines from the primary screen (Supplemen- 122 genes significantly upregulated and 193 genes signifi- tary Fig. S1A) and evaluated the correlation of MYCN protein cantly downregulated on the basis of permutation P < 0.05 levels with JQ1 response. MYCN protein level is also substan- and false discovery rate (FDR) < 0.05 for signal-to-noise in tially correlated with response to JQ1 treatment (Fig. 1C). the comparison of all vehicle-treated versus all JQ1-treated We retested one of the most highly sensitive MYCN-amplified samples. To assess the effects of JQ1 more specifically on tran- cell lines from the screen, BE(2)-C, and multiple additional scriptional programs regulated by either MYCN or c-MYC, we MYCN-amplified neuroblastoma cell lines confirmed to have interrogated the data with published, validated gene signa- elevated levels of MYCN protein (Supplementary Fig. S1B). tures for statistically significant enrichment by GSEA. GSEA Nearly all of the MYCN-amplified cell lines tested responded seeks to estimate the significance of overrepresentation of

OF3 | CANCER DISCOVERY March 2013 www.aacrjournals.org

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 3 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

BET Bromodomain Inhibitors Target MYCN in Neuroblastoma RESEARCH ARTICLE

A B P = 0.003 P = 0.007 1.0 1.5 6

0.8 4 1.0 2

0.6 Max

µ mol/L)] ( Max

E 50

E 0 0.5 0.4

ln [IC ln –2

0.2 0.0 –4 MYCN: WT Amplified MYCN: WT Amplified 0 D –4 –3–2 –1 0 1 2 3 4 5 N N ln [IC (µmol/L)] N N 50 S N S N C N O N O O O 0.6

Cl (+)-JQ1 Cl (–)-JQ1 0.4 N Max

E N N O O N N 0.2 r = –0.6 O N NH N O 0 O 0 1 2 3 4 N H MYCN/actin expression Cl I-BET I-BET151

E BE(2)-C Kelly F BE(2)-C Kelly 140 140 14 9 µmol/L JQ1 120 120 12 8 0 7 100 100 10 1.25 6 5 80 80 8 5 60 60 6 4 JQ1R 3 40 JQ1S 40 4 2 20 I-BET 20 2 I-BET151 1 0 0 0 0 –10 –8 –6 –4 –10 –8 –6 –4 0 2 3 5 0 2 3 5 LAN-1 NGP LAN-1 NGP 140 140 9 10 9 120 120 8 7 8 100 100 7 Normalized intensity 6 6 80 80 5 5 60 60 4 4 40 40 Luminescence relative to day 0 3 3 2 2 20 20 1 1 0 0 0 0 –10 –8 –6 –4 –10 –8 –6 –4 0 2 3 5 0 2 3 5 Log [Compound(mol/L)] Day

Figure 1. MYCN-amplified neuroblastoma is sensitive to the effects of BET bromodomain inhibition. A, antiproliferative activity of JQ1 was profiled in more than 650 cancer cell lines, revealing a broad range of sensitivity and resistance. Red dots are neuroblastoma cell lines with MYCN amplification based on SNP 6.0 arrays and/or high levels of protein expression. Black dots indicate neuroblastoma cell lines wild-type (WT) for MYCN and poor

MYCN expression. Drug response is presented as ln(IC50), plotted against the maximum effect corresponding to the minimum measured viability (Emax). B, distribution of Emax and ln(IC50) for MYCN–wild type versus MYCN-amplified cancer cell lines based on SNP 6.0 copy number analysis. P value was calculated using nonparametric Mann–Whitney test. Red squares indicate MYCN-amplified neuroblastoma cell lines. C, Spearman correlation between minimum measured viability (Emax), and the expression level of MYCN was normalized by actin level (ratio of MYCN/actin). D, structures of BET bromodo- main inhibitors. (+)-JQ1, I-BET, and I-BET151 are all active and structurally distinct, BET bromodomain inhibitors. JQ1R is the inactive (−)-JQ1 enantiomer. E, Dose response of neuroblastoma cell line viability with BET bromodomain inhibitor treatment was measured by a luminescent ATP detection assay. Data represent mean ± SEM of 4 biologic replicates. F, 4 MYCN-amplified neuroblastoma cell lines were used to determine the effects of JQ1 on growth. Values over time are shown relative to the day 0 values, with error bars representing the mean ± SD of 8 replicates per condition.

March 2013 CANCER DISCOVERY | OF4

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 4 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

RESEARCH ARTICLE Puissant et al.

A BE(2)-C Kelly B 100% 100% Vehicle JQ1 G –G 0 1 2% 7% 2% 22% 80% 80% S G –M 60% 60% 2 BE(2)-C

Sub-G1 40% 40% 80% 10% 28% 47% 20% 20% 1% 7% 2% 6% 0% 0% 0 24 h 48 h 72 h 0 24 h 48 h 72 h Kelly

LAN-1 NGP 100% 100% 77% 11% 24% 68% 104 1% 4% 8% 55% 80% 80% 103 Cells in phase of cycle 60% 60% 102 LAN-1

40% 40% 101 88% 7% 8% 29%

20% 20% PI 101 102 103 104

0% 0% AV 0 24 h 48 h 72 h 0 24 h 48 h 72 h

Figure 2. JQ1 treatment induces a G0–G1 arrest and apoptosis in neuroblastoma cell lines. Indicated neuroblastoma cell lines were treated with 1 μmol/L JQ1 for (A) 24, 48, and 72 hours before cell-cycle analysis or (B) 72 hours before measuring apoptosis by annexin V staining detected by flow cytometry.

an independently defined set of genes (e.g., c-MYC or MYCN immunoblot (Fig. 3F and G). In contrast, MYCN expression pathways) in the highly correlated or anticorrelated genes in was not downregulated in the cell line most insensitive to JQ1, the gene expression dataset. The majority of the MYCN- and NGP. Finally, c-MYC expression level was reduced in response c-MYC–related gene sets were statistically enriched among to JQ1 treatment across all the MYCN-amplified or nonampli- genes downregulated by BET bromodomain inhibition in fied neuroblastoma cell lines (Supplementary Fig. S5). Taken neuroblastoma (Fig. 3B and C). Because the MYCN signature together, these data provide strong evidence that the MYCN in the Molecular Signature Database (MSigDB) was derived program is downregulated in neuroblastoma cell lines by JQ1 in small cell lung cancer cells (19), we sought to develop a treatment, and as observed for MYC in several hematologic dis- custom MYCN-upregulated signature in neuroblastoma cells, ease models, BET bromodomain inhibition targets the expres- using a publicly available dataset of primary neuroblastoma sion of MYCN itself. tumors characterized for MYCN amplification status (20). This MYCN signature was also highly downregulated by JQ1 Genome-Wide Transcriptional Effects of BET treatment of neuroblastoma cell lines based on GSEA (Fig. 3D Bromodomain Inhibition in Cancer Cells and Supplementary Table S4). An open-ended enrichment Although the transcriptional programs altered by BET bro- analysis was next conducted, as a measure of specificity, on modomain inhibition in individual diseases have been estab- the entire set of transcription factor target gene signatures lished, an integrated analysis has not yet been conducted. available from MSigDB (21). In almost all cases, gene sets To establish neuroblastoma-specific and canonical BET defined by adjacency to MYC-binding motifs (both MYCN bromodomain-dependent transcriptional pathways, we ana- and c-MYC) were highly enriched in genes whose expression lyzed 3 datasets profiling the transcriptional changes asso- is suppressed by JQ1 in neuroblastoma (Fig. 3E). ciated with JQ1 treatment in cancer cell lines [multiple Recently, we reported the unexpected downregulation of MYC myeloma (8), acute myelogenous leukemia (AML; ref. 9), and expression in multiple myeloma and acute leukemia models by neuroblastoma] to determine whether a robust, cell con- BET bromodomain inhibitors (8–10). Localization of BRD4 to text–independent JQ1 signature exists. First, we generated strong enhancer elements proximal to MYC prompted the con- signatures of genes whose expression is regulated (up and sideration that expression of amplified MYCN may, indeed, be down) by JQ1 treatment in neuroblastoma and used these as dependent on BET bromodomains. We therefore evaluated the a gene set to query both the multiple myeloma and the AML effects of JQ1 treatment on MYCN expression. Although not transcriptional profiling datasets. Significant enrichment of in the top 100 differentially expressed genes, MYCN expression these neuroblastoma JQ1 signatures was noted in the hemat- was significantly downregulated in the genome-wide expres- opoietic malignancies with an FDR < 0.25 (Supplementary sion profiling of both neuroblastoma cell lines for 3 of 4 Fig. S6A). PrimeView representative probes, with an average reduction of Next, we developed hematopoietic malignancy signatures 50% (Supplementary Table S5). These results were confirmed for both upregulated and downregulated genes with JQ1 in the 3 neuroblastoma cell lines responsive to JQ1 [BE(2)-C, treatment, using the multiple myeloma and the AML data- Kelly, and LAN-1] by reverse transcriptase PCR (RT-PCR) and sets. We applied these signatures as gene sets to query our

OF5 | CANCER DISCOVERY March 2013 www.aacrjournals.org

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 5 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

BET Bromodomain Inhibitors Target MYCN in Neuroblastoma RESEARCH ARTICLE

A Vehicle JQ1 B KIM_MYCN_AMPLIFICATION_TARGETS_UP V$NMYC_01 0.2

0.0 0.0 Kelly Kelly Kelly BE(2)-C BE(2)-C BE(2)-C Kelly Kelly Kelly BE(2)-C BE(2)-C BE(2)-C –0.1 GTF3C6 HDAC9 –0.2 –0.2 UTRN TBL1XR1 –0.3 ZMYND8 FDR = 0.186 FDR = 0.203 DLAT Enrichment score –0.4

Enrichment score –0.4 FAM101A BATF3 C14orf1 RAB7L1 LTV1 C18orf55 LOC100130776 SCHUHMACHER_MYC_TARGETS_UP V$MYCMAX_01 TH 0.0 0.0 HOXC8 SULF2 –0.1 –0.2 PA2G4 –0.2 RNF157 ASB13 –0.4 –0.3 RAC3 HEATR2 –0.4 SLC5A6 –0.6 FDR = 0.084 –0.5 FDR = 0.027

RGS19 Enrichment score ITPRIPL2 Enrichment score SORBS3 PON2 TBL2 SLC18A1 C5orf43 OAF ADORA2B C Gene set Size NES FDR q-val MAPK3 TOMM40L DANG MYC TARGETS UP 124 –1.780 0.125 AEBP1 LRP8 SCHUHMACHER MYC TARGETS UP 67 –1.767 0.084 CC2D2A REACTOME DNA REPLICATION PRE INITIATION 70 –1.764 0.082 MTHFD1L REACTOME SYNTHESIS OF DNA 83 –1.722 0.080 JAM2 REACTOME METABOLISM OF NUCLEOTIDES 70 –1.689 0.085 TFAP2B PLIN3 BILD MYC ONCOGENIC SIGNATURE 183 –1.676 0.086 ANK3 STANELLE E2F1 TARGETS 18 –1.667 0.091 ARHGAP23 MENSSEN MYC TARGETS 16 –1.616 0.105 UBL4A REACTOME CELL-CYCLE CHECKPOINTS 104 –1.615 0.104 AS3MT DANG REGULATED BY MYC UP 64 –1.611 0.103 RAB33A MRPL15 KIM MYC AMPLIFICATION TARGETS UP 152 –1.593 0.111 MRPL11 MORI EMU MYC LYMPHOMA BY ONSET TIME UP 92 –1.586 0.116 CHRM1 BENPORATH PROLIFERATION 140 –1.584 0.115 NOP16 BENPORATH ES 1 365 –1.574 0.112 C1orf31 FERNANDEZ BOUND BY MYC 176 –1.438 0.208 PIM1 PJA2 YU MYC TARGETS UP 37 –1.420 0.218 HIST1H2BC BENPORATH MYC TARGETS WITH EBOX 221 –1.397 0.239 HEXIM1 KIM MYCN AMPLIFICATION TARGETS UP 72 –1.389 0.250 SERTAD1 BBS4 MYH9 V$MYCMAX 01 187 –1.829 0.027 C5orf55 V$NMYC 01 199 –1.586 0.203 D2HGDH V$PPARG 01 31 –1.552 0.179 KCTD21 V$MYCMAX 02 200 –1.529 0.196 ARL3 V$E2F 03 169 –1.489 0.199 LOC729991 PPP3CB V$STAT1 03 178 –1.435 0.183 FAM164A V$MYC Q2 134 –1.341 0.239 LOC728392 DNAJC1 PCDH17 SCARNA20 D JANOUEIX-LEROSEY_MYCN_AMPLIFICATION_UP E RPL12 0.0 C19orf63 1.0 C17orf108 c2_c3 AP1G2 –0.2 MYC FILIP1L 0.8 POLG HIST1H2AE –0.4 0.6 ZNF480

DCXR FDR RALGAPA1 –0.6 FDR = 0.014 0.4 THAP8 Enrichment score HIST1H2AC 0.2 TMEM8A GCH1 PCMTD1 0.0 HIST2H2AA3 –2.0 –1.5 2.01.51.00.50.0–0.5–1.0 C1orf63 SERPINI1 NES PAG1 INPP4A F G TMEFF2 120 TUFT1 GCLC 100 OS9 HIST1H2BK 80 HIST1H2AG BE(2)-C Kelly LAN-1 NGP C19orf30 60 * SDCBP * JQ1: – + – + – + – + TAX1BP3 40 GDF11 * MYCN HIST2H2BC 20 NEU1 0 Actin Relative JQ1: – + – + – + – + Relative MYCN expression BE(2)-C Kelly LAN-1 NGP Row min Row max

Figure 3. Inhibition of MYCN- and c-MYC–dependent transcription by JQ1 treatment of neuroblastoma cells. A, heatmap of the top 50 down- and upregu- lated genes following 24 hours of 1 μmol/L JQ1 treatment of neuroblastoma cell lines based on a signal-to-noise ratio (SNR) score and P < 0.05. Data are presented as row normalized. B, GSEA showing downregulation of MYCN- and c-MYC–dependent gene sets and representative sets of genes with proximal promoter regions containing MYCN- or MYC-MAX–binding sites in the transcriptional profiles of neuroblastoma cell lines treated with JQ1. Depicted is the plot of the running sum for the MSigDB gene set within the JQ1 neuroblastoma dataset, including the maximum enrichment score and the leading edge sub- set of enriched genes. C, table of selective gene sets enriched among genes downregulated by JQ1 in neuroblastoma cell lines based on GSEA (size, number of genes in each set; NES, normalized enrichment score). D, GSEA showing downregulation of a custom MYCN gene set derived from the comparison of MYCN-amplified versus MYCN-nonamplified primary neuroblastoma tumors. E, quantitative comparison of all transcription factor target gene sets available from the MSigDB by GSEA for downregulation in JQ1-treated neuroblastoma cells. Data are presented as a scatterplot of FDR versus NES for each evalu- ated gene set. Red indicates sets for either MYCN or c-MYC and gray for other transcription factors. F, neuroblastoma cell lines were treated with 1 μmol/L JQ1 or DMSO for 8 hours. After RNA extraction, level of MYCN transcript was quantified. Expression values are shown relative to the DMSO condition for each cell line. Error bars represent mean ± SD of 4 technical replicates. *, P < 0.001 calculated using a one-way ANOVA with Bonferroni correction comparing JQ1 treatment with DMSO within a cell line. G, Western blot analyses for MYCN on whole-cell extracts from 4 neuroblastoma cell lines treated with 1 μmol/L JQ1 or DMSO for 24 hours.

March 2013 CANCER DISCOVERY | OF6

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 6 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

RESEARCH ARTICLE Puissant et al.

neuroblastoma transcriptional profiling data by GSEA. Both blotting, and expression of the neuroblastoma-specific target of these signatures were consistently enriched in the expected identified in our expression profiling analysis, PHOX2B, is also directions in neuroblastoma cell lines treated with JQ1 (Sup- downregulated (Fig. 5B and C). As expected, there is no altera- plementary Fig. S6B). Moreover, all of the JQ1 signatures tion of these targets in NGP, in which JQ1 treatment does not were enriched in the treatment of AML cells with a structur- lead to downregulation of MYCN expression. ally distinct BET bromodomain inhibitor, I-BET151 (11), consistent with an on-target effect of JQ1 (Supplementary BRD4 Suppression by Short Hairpin RNA Fig. S7). Finally, we developed a consensus signature across all Recapitulates the Effects of JQ1 Treatment 3 datasets (Fig. 4A) and determined the relevance to primary in Neuroblastoma Cell Lines human neuroblastoma. The consensus JQ1 signature was Previous studies have focused on the role of a specific BET significantly associated with MYCN-amplified neuro­blastoma family member, BRD4, which is potently inhibited by JQ1 when projected into a primary human neuroblastoma gene and implicated in several malignancies, including NUT mid- expression profiling dataset with annotation forMYCN status line carcinoma, AML, B-cell acute lymphoblastic leukemia and stage, suggesting that the signature has relevance beyond (B-ALL), and multiple myeloma (7–9). Moreover, a recent cancer cell lines grown in culture to bona fide human disease siRNA screen to identify synthetic lethal interactions with (Fig. 4B). We next determined the biologic and functional con- MYC overexpression revealed BRD4 as a candidate gene (23). nections among those genes. Notably, although many individ- Therefore, we studied selective suppression of BRD4 by short ual gene sets were significant, marked enrichment was noted hairpin RNA (shRNA) in the 3 JQ1-sensitive neuroblastoma for multiple gene sets associated with MYCN and c-MYC, E2F, cell lines. Four shRNAs directed against BRD4 were evaluated cell cycle, transcription/translation, metabolism, and DNA and shown to alter relative cell viability and growth over a damage/repair (Fig. 4C and Supplementary Table S6). In con- 6-day time course, with a dose response in all 3 lines sensitive sideration of these findings this analysis suggests that there to JQ1 (Fig. 6A and B). As seen with JQ1 treatment, there was indeed exists a consensus transcriptional signature altered by a striking induction of apoptosis (Fig. 6C) and downregula- JQ1 treatment of cancer cells, with c-MYC and MYCN gene tion of MYCN expression by RT-PCR and immunoblot with sets, and their associated biologic functions, serving as hubs. the top 3 shRNAs in the 3 JQ1-sensitive cell lines (Fig. 6D Although BET bromodomain inhibition alters a com- and E). Moreover, as expected, direct suppression of MYCN mon transcriptional program across structurally distinct by shRNA resulted in growth arrest and apoptotic cell death compounds and cancers of different lineages, we were also (Supplementary Fig. S9A–S9C). However, in the JQ1-resistant interested in the transcriptional changes unique to MYCN- neuroblastoma cell line NGP, BRD4-directed shRNAs did amplified neuroblastoma. In this case, we identified a set of not alter growth or viability, induce apoptosis, or lead to genes whose expression is uniquely altered in neuroblastoma, suppression of MYCN expression (Fig. 6A–E). According to but not in the hematopoietic cancer cell lines (Supplementary these results, BRD4 knockdown did not significantly dimin- Fig. S8). Here, evidence was found of the loss of lineage- ish growth of 2 MYCN nonamplified cell lines, SH-SY5Y and related genes with JQ1 treatment, reflected in the downregu- SK-N-AS (Supplementary Fig. S10A and S10B). lation of gene sets associated with neural crest stem cells and neurotransmitter release, as well as the downregulation of Efficacy of JQ1 Treatment in Independent Murine sets of genes with proximal promoter regions containing Models of Neuroblastoma binding sites for LHX3 (LIM homeobox 3, a gene involved Because no consensus has been reached about the most in neural development) and of ZIC3 (zinc finger protein of relevant in vivo mouse model for preclinical testing of a new the cerebellum 3; Fig. 4D and E; ref. 22). In addition, con- therapy, we conducted in vivo testing of JQ1 in 3 unique models sistent with the observed phenotypic consequences of the of MYCN-amplified neuroblastoma: a subcutaneous xenograft, compound in neuroblastoma cells, enrichment was noted an orthotopic primary human xenograft, and an experimentally for gene sets associated with apoptosis (Fig. 4F). A full list of derived mouse model of MYCN-amplified neuroblastoma (24). enriched gene sets is presented in Supplementary Table S7. First, JQ1 was evaluated in a BE(2)-C cell line xenograft model established by subcutaneous injection into nonobese diabetic A BET Bromodomain Inhibitor Displaces BRD4 (NOD)–severe combined immunodeficient (SCID) IL2R–γ nul from the MYCN Promoter Region and MYCN (NSG) mice. Tumor-bearing mice were treated with 50 mg/kg Targets Are Downregulated of JQ1 or vehicle delivered by daily intraperitoneal injection It was previously shown that BET bromodomain inhibitors (n = 10 per group) until sacrifice. JQ1 treatment significantly displace BRD4 from the c-MYC promoter region, suggesting the diminished tumor volume and prolonged overall survival in hypothesis that BET inhibitors would similarly displace BRD4 these mice compared with control-treated mice, without an from the MYCN promoter region (8). Using chromatin immu- effect on body weight (Fig. 7A and B and Supplementary noprecipitation (ChIP) PCR, we observed BRD4 localization to Fig. S11A), and no overt toxicities were observed. In contrast, the MYCN promoter as well as a putative enhancer region. JQ1 treatment of the MYCN–wild-type SH-SY5Y subcutaneous treatment resulted in displacement of the BRD4 coactivator xenograft with JQ1 did not significantly prolong survival or protein from both elements, providing a mechanistic explana- reduce tumor volume (Supplementary Fig. S11B and S11C). tion for the observed JQ1-dependent decrease in MYCN tran- In the primary human orthotopic xenograft model, a scription in sensitive neuroblastoma cells (Fig. 5A). Moreover, human MYCN-amplified primary neuroblastoma tumor with JQ1 treatment 2 well-reported targets of MYCN, MCM7 was obtained from a heavily pretreated child with relapsed and MDM2, are confirmed to be downregulated by Western metastatic and drug-resistant disease. Tumor pieces were

OF7 | CANCER DISCOVERY March 2013 www.aacrjournals.org

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 7 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

BET Bromodomain Inhibitors Target MYCN in Neuroblastoma RESEARCH ARTICLE

A Neuroblastoma Acute myeloid Multiple myeloma B Nonamplified No information leukemia Amplified Stage I or II Veh JQ1 Veh JQ1 Stage III Veh JQ1 Stage IV Stage IVS

GTF3C6 POLE2 Stage C1orf163 MYCN MTHFD1L MTHFD1L ADAT2 C12orf24 E2F8 NR2C2AP FAR2 ALKBH8 MTMR2 CLPP PPRC1 TTC27 IFRD2 FKBP4 POLE2 MRTO4 UNG PEMT MAGOHB RAB7L1 CCDC58 TYRO3 FKBP4 IFRD2 ADAT2 GPATCH4 BDH1 NOP16 TMEM126A ALG14 MTMR2 TTC27 TSGA14 C1orf163 BDH1 E2F8 SFXN4 RNASEH2B UNG SFXN4 GALC NOP16 UBXN8 GPATCH4 ALKBH8 C1orf31 MAGOHB UBXN8 TMEM126A OBFC2B MRTO4 C12orf24 GTF3C6 IRAK1 RAB7L1 PPRC1 SERPINI1 C1orf31 PNRC1 CCDC58 GALC OBFC2B TUFT1 RNASEH2B ALG14 NR2C2AP FAR2 CLPP PEMT STX7 CSRNP2 IRAK1 DAAM1 ITFG3 STX7 TYRO3 BNIP3L HEXIM1 ITFG3 AP1G2 AP1G2 C1orf63 FGD6 TSGA14 PNRC1 DAAM1 C1orf63 BNIP3L TP53INP1 TUFT1 ZSWIM6 ZSWIM6 KLHL24 PAG1 FGD6 SERPINI1 PAG1 KLHL24 CSRNP2 HEXIM1 Relative HIST2H4A TP53INP1 Row min Row max D Biologic Gene set name # Genes in # Genes in k/K P value process gene set (K) overlap (k)

C Neural development A

Apoptosis F

B E F

Veh JQ1 Veh JQ1

E

SHC1 CASP7 TFAP2B TNFRSF25 PMP22 CFLAR GAP43 NFKB1 IGFBP5 HDAC9 EDNRA PHOX2B ST7 KCNMA1 COMMD9 IL7 PHOX2B NELL1 DCX TFAP2B LITAF C5orf13 D C DDC SORL1 TH SLC18A1 CPLX1 EMILIN1 SSPN RPH3A KIAA0182 CENPA KCNMA1 KIAA0182 KCTD15 EFNA1 SERTAD4 IMPDH1 A MYC LDB2 SHC1 C5ORF13 ERF LRRTM1 FHOD1 B Metabolism RASL10B F12 ADAMTS17 SH3BP1 KCNH2 LITAF C Transcription/translation ZNF532 TLE1 SH3BP1 CTSC D Cell cycle MAPK10 GSTO1 HEBP2 AEBP1 ANP32A CD58 E DNA repair PRDM10 C14orf139 HOXD3 XBP1 IMPDH1 BRE F E2F SIX4 PDE4B UBE2M CRTC3

Figure 4. Transcriptional changes associated with BET bromodomain inhibition by JQ1. A, heatmap of the 36 down- and 17 upregulated genes after JQ1 treatment, with a consistent direction of regulation in neuroblastoma, multiple myeloma, and AML and fold-change greater than 2 and P ≤ 0.05. Data are presented as row normalized. B, heatmap of the JQ1 consensus signature developed in A, evaluated in a dataset profiling genome-wide expression of primary neuroblastoma tumors. JQ1 consensus signature genes denoted in blue are downregulated and those in red are upregulated with JQ1 treatment. Data are presented as row normalized. The neuroblastoma samples cluster into 2 groups, which are associated with the MYCN amplification status of the tumors (P < 0.002 by a two-tailed Fisher exact test) and with high stage (stage III and IV) versus low stage (all others; P < 0.002 by a two-tailed Fisher exact test). C, a relaxed consensus JQ1 downregulation signature was identified on the basis of the absolute fold change ≥ 1.5 and P value and FDR ≤ 0.05 and was inter- rogated in a functional enrichment analysis across the MSigDB. The results were visualized with the Enrichment Map software, which organizes the significant gene sets into a network called an “enrichment map.” In the enrichment map, the nodes correspond to gene sets and the edges reflect significant overlap between the nodes according to a two-tailed Fisher exact test. The hubs correspond to collections of gene sets with a unifying class label according to gene ontology (GO) biologic processes. The size of the nodes is correlated with the number of genes in the gene set. D, table describing the results of a two-tailed Fisher exact tests for the MSigDB signatures enriched with genes selectively downregulated by JQ1 in neuroblastoma cells. Heatmap of the genes uniquely regulated by JQ1 in neuroblastoma in the neural development (E) and apoptosis-related (F) gene sets. Data are presented as row normalized.

March 2013 CANCER DISCOVERY | OF8

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 8 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

RESEARCH ARTICLE Puissant et al.

A B 500 bp MYCN

50 H3K27ac 0 BE(2)-C Kelly LAN-1 NGP JQ1: – + – + – + – + 8 Control JQ1 MCM7

6 MDM2

Negative Actin

4 region Input (%) Input

2 *

** 0

C 140 Control JQ1 120

100 Figure 5. A, ChIP with a BRD4 antibody at 2 sites within the MYCN promoter region in BE(2)-C cells treated with 1 μmol/L JQ1 for 24 hours. 80 Enrichment is shown as the percentage of total input DNA. The negative con- trol region primers amplify within a gene desert region approximately 1 Mb away from MYCN. Error bars represent ± SEM of triplicate data. *, P < 0.05; 60 * * **, P < 0.01 (paired t test). B, Western blot analysis showing effects of 1 μmol/L JQ1 treatment for 24 hours on the expression of MCM7 and MDM2 in MYCN- 40 amplified neuroblastoma cells. C, neuroblastoma cell lines were treated with * 1 μmol/L JQ1 or DMSO for 24 hours. After RNA extraction, level of PHOX2B 20 transcript was quantified. Expression values are shown relative to the DMSO Relative PHOX2B expression condition for each cell line. Error bars represent mean ± SD of 4 technical 0 replicates. *, P < 0.001 calculated using a one-way ANOVA with Bonferroni cor- BE(2)-C Kelly LAN-1 NGP rection comparing JQ1 treatment with DMSO within a cell line.

implanted into the kidney capsule of nude mice, and the has been substantial for treating patients with low-risk disease, mice were treated once daily with 50 mg/kg of JQ1 intraperi- the majority of children with neuroblastoma present with high- toneally for 28 days, starting 7 days after orthotopic trans- risk disease, and many of these children will succumb to neu- plantation. As shown in Fig. 7C, JQ1 treatment significantly roblastoma despite intensive chemotherapy with autologous prolonged survival as compared with vehicle treatment. stem cell transplantation, surgery, and radiation (26). New Finally, we tested the effects of JQ1 therapy in a genetically treatment approaches are clearly needed for these patients, engineered mouse model (GEMM) of MYCN-amplified neurob- as the delivery of dose-intensified, cytotoxic chemotherapy is lastoma (TH-MYCN; ref. 24). TH-MYCN mice with palpable already maximized. The pathologic activation of MYCN plays a tumors were treated with JQ1 or vehicle, as above, once daily central role in high-risk neuroblastoma, with MYCN amplifica- for 28 days. A marked improvement in survival for JQ1-treated tion identified in 25% of primary neuro­blastoma tumors and mice was observed (Fig. 7D). Tumor biopsy specimens were nearly half of high-risk cases (26–29). Genomic studies of neu- obtained from mice receiving therapy with JQ1 or vehicle and roblastoma tumors, including massively parallel sequencing, assessed for pharmacodynamic effects. As shown in Fig. 7E, have failed to reveal other recurrent and imminently targetable JQ1 conferred an inhibitory effect on cellular proliferation molecular lesions, with the exception of mutations in ALK in evidenced by Ki67 staining, an increase in apoptosis by cleaved neuroblastomas, which often coharbor MYCN amplification caspase-3 staining, and an inhibitory effect on the expression of (20, 30–34). The central role of the MYCN oncogene in neurob- MYCN itself and its downstream target MCM7 (Fig. 7F). lastoma tumorigenesis, and its limited expression in mature, normal tissues, make it a compelling target for drug develop- ment. Although transcription factor oncoproteins have largely DISCUSSION been refractory to conventional drug discovery approaches, Neuroblastoma, a tumor arising from primitive neural crest the selective targeting of JQ1 in neuroblastoma raises the cells in the sympathetic nervous system, is the most common possibility of targeting MYCN by bromodomain inhibitors extracranial solid tumor in children (25). Although progress in this disease. Indeed, our data also support the use of other

OF9 | CANCER DISCOVERY March 2013 www.aacrjournals.org

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 9 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

BET Bromodomain Inhibitors Target MYCN in Neuroblastoma RESEARCH ARTICLE

A B BE(2)-C Kelly 10 shControl 10 shBRD4-2 8 shBRD4-3 8 shBRD4-4 BE(2)-C 120 6 shBRD4-10 6 Kelly 4 4 100 LAN-1 * NGP 2 2 80 ** ** 0 0 ** ** ** 0 2 4 6 0 2 4 6 60 ** ** LAN-1 NGP 40 10 10 ** ** ** ** ** ** 8 8 20 Relative BRD4 expression ** ** 6 6

0 Luminescence relative to day 0 shRNA: Control BRD4-2 BRD4-3 BRD4-4 BRD4-10 4 4

2 2

0 0 0 2 4 6 0 2 4 6 Days C Control BRD4-2 BRD4-3 BRD4-4 BRD4-10 6% 0% 16% 4% 17% 12% 23% 33% 12% 8%

BE(2)-C

93% 0% 70% 10% 64% 6% 34% 10% 30% 10%

2% 9% 6% 44% 4% 62% 3% 47% 3% 47%

Kelly

89% 2% 37% 10% 28% 5% 42% 6% 45% 5%

19% 12% 15% 33% 9% 53% 12% 47% 10% 46%

LAN-1

86% 2% 46% 5% 33% 6% 34% 7% 37% 7% 104 14% 10% 13% 11% 11% 7% 13% 12% 7% 13% 103

102 NGP

101 75% 1% 74% 2% 81% 1% 74% 1% 76% 4% 1 2 3 4 PI 10 10 10 10 AV

D E 120

100

80 * * * * * 60 * shControl BRD4-3 BRD4-4 BRD4-10 shControl BRD4-3 BRD4-4 BRD4-10 shControl BRD4-3 BRD4-4 BRD4-10 shControl BRD4-3 BRD4-4 BRD4-10 * * 40 BRD4 * 20 MYCN Relative MYCN expression

0 shControl shBRD4-3 shBRD4-4 shBRD4-10 shControl shBRD4-3 shBRD4-4 shBRD4-10 shControl shBRD4-3 shBRD4-4 shBRD4-10 shControl shBRD4-3 shBRD4-4 shBRD4-10 Actin

BE(2)-C Kelly LAN-1 NGP

BE(2)-C Kelly LAN-1 NGP

Figure 6. Effect of BRD4 downregulation on neuroblastoma cell lines. A–E, the 3 most JQ1-sensitive neuroblastoma cell lines were transduced with shRNAs targeting BRD4 or a control shRNA. A, RNA was extracted at day 3 post transduction and BRD4 transcript level was quantified. Shown are the expression values relative to the shRNA control–transduced cells. Error bars represent mean ± SD of 4 technical replicates. *, P < 0.05; **, P < 0.01, calculated using a one-way ANOVA, with Bonferroni correction. B, viability values over days post transduction are shown relative to the day 0 (time of seeding) values, with error bars representing the mean ± SD of 8 replicates per condition. C, apoptosis analysis was conducted on day 6 post transduc- tion. D, Western blot analyses showing BRD4 and MYCN protein levels on day 4 post transduction with 3 BRD4-directed shRNAs. E, MYCN transcript levels were quantified 4 days after transduction. The expression values are relative to cells infected with a control shRNA. Error bars represent mean ± SD of 4 technical replicates. *, P < 0.001 calculated using a one-way ANOVA, with Bonferroni correction, comparing each BRD4-directed shRNA with the control shRNA within a cell line.

March 2013 CANCER DISCOVERY | OF10

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 10 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

RESEARCH ARTICLE Puissant et al.

A B Subcutaneous cell line xenograft 5,000 100 Control JQ1 ) 3 4,000 80 P = 0.01 3,000 * 60

2,000 40 P = 0.006 Survival (%) 1,000 20 Tumor volume (mm

0 0 Control JQ1 0 5 10 15 20 25 Days

C Primary human orthotopic xenograft D GEMM 100 Control 100 Control JQ1 JQ1 80 80

60 60

40 40

Survival (%) P = 0.004 P = 0.004 Survival (%) 20 20

0 0 0 25 50 75 100 125 0 20 40 60 Days Days

E Vehicle JQ1 F

Ki67 Control JQ1 (Red) MYCN

20 M 20 M MCM7

GAPDH Cleaved caspase-3 (green)

20 M 20 M

Figure 7. Testing of JQ1 in multiple in vivo models of MYCN-amplified neuroblastoma. A, mice were injected with BE(2)-C cells subcutaneously and treated with JQ1 or vehicle once tumors reached 100 mm3. After 15 days, tumor volume was measured. Error bars indicate mean ± SD of 5 mice. *, P = 0.01, calculated using nonparametric Mann–Whitney test. B, effects of JQ1 treatment on survival in the BE(2)-C xenograft model. Day 0 indicates the first day of treatment, and mice were treated until time of sacrifice. C, a human MYCN-amplified primary neuroblastoma tumor was implanted into kidney capsule of nude mice, and mice were treated once daily with JQ1 for 28 days, starting 7 days after orthotopic transplantation. D, TH-MYCN mice with palpable tumors were treated with JQ1 or vehicle once daily for 28 days. Statistical significance A–C( ) was determined by log-rank (Mantel–Cox) test for the survival curves, as shown. Day 0 indicates the day of treatment initiation. E, staining for Ki-67 (red), cleaved caspase-3 (green), and 4′,6-diamidino- 2-phenylindole (DAPI; blue) in GEMM tumors treated with either vehicle or JQ1, as indicated. F, Western blot analysis indicating the expression of MYCN and MCM7 in GEMM tumors treated with either vehicle or JQ1, as indicated.

BET bromodomain inhibitors, expanding the possibilities for large-scale screening of highly annotated collections of cancer future clinical testing. cell lines to uncover a strong genetic predictor of response to Even though numerous examples now exist of genotypic BET bromodomain inhibitors. Many of the cancer cell lines predictors of chemical phenotypes, particularly for kinase in our high-throughput screening study, particularly among inhibitors (35–37), we are still lacking genetic/genomic pre- the solid tumors, were insensitive to JQ1, suggesting that dictors of response to most drugs in current clinical use and JQ1 is not a general cytotoxic agent. Although nearly all of in early clinical testing. In this study, we reveal the power of the prior literature supports the use of BET bromodomain

OF11 | CANCER DISCOVERY March 2013 www.aacrjournals.org

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 11 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

BET Bromodomain Inhibitors Target MYCN in Neuroblastoma RESEARCH ARTICLE

inhibitors in hematologic malignancies, our work shows a with bromodomain inhibitors tested. Moreover, the recent strong indication for the use of BET bromodomain inhibitors report that ALK(F1174L)/MYCN tumors exhibit increased in a genetically defined solid tumor,MYCN- amplified neurob- MYCN dosage due to ALK(F1174L)-induced activation of the lastoma. Similar to the observation that MYC is transcrip- phosphoinositide 3-kinase (PI3K)/AKT/mTOR and mitogen- tionally regulated by bromodomain inhibitors, we showed activated protein kinase (MAPK) pathways suggests the pos- that MYCN expression is repressed both by JQ1 treatment sibility of combining ALK inhibitors with BET bromodomain and by shRNA directed against BRD4. Importantly, in the inhibitors in neuroblastoma (44). one MYCN-amplified cell line (NGP) with no response to JQ1 In summary, we have leveraged high-throughput, cell-based or other structurally distinct BET bromodomain inhibitors, screening of genetically characterized cancer cell lines to iden- no downregulation of MYCN expression at either a transcrip- tify MYCN amplification as a strong predictor of sensitivity to tional or a protein level occurred with either JQ1 treatment BET bromodomain inhibition. We have confirmed this finding or BRD4-directed shRNA. Although the precise mechanism in MYCN-amplified neuroblastoma and executed on the pre- for failure to suppress MYCN expression in NGP by BET clinical validation of this hypothesis. With a ­survival advantage bromodomain inhibition is still under investigation, these observed in 3 independent in vivo models of ­neuroblastoma data support the assessment of MYCN downregulation as a treated with JQ1, including a highly chemotherapy-resistant putative approach to response stratification in clinical trials genetically engineered MYCN mouse model, the clinical devel- investigating this compound class. Furthermore, whereas in opment of bromodomain inhibitors for testing in children with primary human neuroblastoma tumors, MYCN amplifica- relapsed or refractory neuroblastoma is already under way. tion is strongly correlated with the JQ1 expression signature derived from cell lines, some primary human tumors cluster with the JQ1 signature but lack MYCN amplification, sug- METHODS gesting that additional predictors of response to JQ1 remain Genomic Characterization of Cancer Cell Lines to be discovered. A total of 84 of the most frequently mutated, amplified, deleted, In addition to identifying a consensus JQ1 gene expression or rearranged cancer genes were examined in the cell line collection. signature shared by JQ1-responsive cell lines, we also identi- Sixty-five genes were sequenced to base-pair resolution across all fied a gene signature uniquely regulated in neuroblastoma, coding exons for each gene by capillary sequencing. The presence including genes associated with neural cellular identity. For of 7 of the most commonly rearranged cancer genes (e.g., BCR–ABL example, one of the genes whose expression is uniquely mod- and EWS–FLI1) was determined across the drug screen cell line panel ulated by BET bromodomain inhibition in neuroblastoma is by the design of breakpoint-specific sequence primers that enabled PHOX2B, a gene encoding a transcription factor involved in detection of the rearrangement following capillary sequencing. In the differentiation of neural crest cells. PHOX2B is mutated addition, analysis of microsatellite instability (MSI) was conducted according to the guidelines set down by the International Workshop in neuroblastoma, particularly in association with familial on Microsatellite Instability and RER Phenotypes in Cancer Detec- neuroblastoma and with congenital central hypoventilation tion and Familial Predisposition (45). Samples were screened using syndrome and Hirschsprung disease (38–40). Similarly, tyro- the markers BAT25, BAT26, D5S346, D2S123, and D17S250 and sine hydroxylase expression is uniquely modulated by BET were characterized as MSI if 2 or more markers showed instability. bromodomain inhibition with JQ1 in neuroblastoma, a likely Total integral copy number values across the footprints of the cancer explanation for the downregulation of MYCN expression genes were determined from Affymetrix SNP6.0 microarray data, in our GEMM model of neuroblastoma in which MYCN is using the PICNIC algorithm to predict copy number segments in driven from a tyrosine hydroxylase promoter. The even more each of the cell lines (46). For a gene to be classified as amplified, the dramatic effects of JQ1 on the downstream target of MYCN, entire coding sequence must be contained in one contiguous seg- MCM7, could be explained by the contribution of a direct ment defined by PICNIC and have a total copy number of 8 or more. Deletions must occur within a single contiguous segment with copy inhibitory effect of JQ1 on the interaction of BRD4 and number 0. A complete description of the characterization of the can- MYCN at MYCN promoter sites. cer cell line collection used in this study is available from the Cancer Although it will be important in future studies to extend Genome Project webpages (47). testing of BET bromodomain inhibition to other diseases with MYCN amplification, such as medulloblastoma (41), the Cell Line Screening open-source nature of publicly available screening data infi- Cell lines in an exponential phase of growth were seeded at optimal nitely expands the use of any individual laboratory’s screening density previously determined to provide maximum signal in control efforts by enabling remining of the data. For example, if we (untreated) wells, while maintaining growth through the experimen- relax the criteria for identifying candidate biomarkers of sen- tal exposure. Cells were seeded on day 1, with drug delivered the sitivity versus resistance to JQ1 to significant P( ≤ 0.05) values following day. Nine concentrations of (+)-JQ1 were applied to cells for a two-tailed Fisher exact test at the 25th percentile (sensi- at a stepwise 2-fold dilution series. After 72 hours of drug exposure, cells were fixed and stained with Syto60 (Invitrogen) for fluorescence tivity) or the 75th percentile (resistance) of the ln(IC50) distri- bution, NOTCH1 activation is also correlated with response measurement, as described previously (48). Replicate experiments were variably carried out for quality assessment during the screening to JQ1, nominating diseases with aberrant NOTCH1 activa- phase. Stringent quality control criteria were applied, and estimates tion, such as T-cell acute lymphoblastic leukemia (T-ALL; of IC50 were derived from the 9 dose–response curves, as described ref. 42) and chronic lymphocytic leukemia (CLL; ref. 43), for previously (16). Drug response is presented as the ln(IC50) plotted future study (Supplementary Table S8). Similarly, expression against the Emax (the maximum effect corresponding to the mini- of GNAS, MDM2, and NF2 should be explored as predic- mum measured viability). Enrichment for a given organ of origin tors of resistance and the combination of MDM2 inhibitors (673 cell lines) or genotype (473 cell lines with genotype information)

March 2013 CANCER DISCOVERY | OF12

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 12 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

RESEARCH ARTICLE Puissant et al.

in the sensitive cell lines was tested using a two-tailed Fisher exact test– using the ΔΔCT method, and plotted as percentage of transcript com- based approach. Cell lines with response to JQ1 yielding IC50 ≤ 1 μmol/L pared with the negative control condition. and Emax ≥ 70% were designated as sensitive, and all others were desig- nated as resistant in the most stringent classification schema. With less shRNA Studies stringent criteria, cell lines were assigned to the sensitive or resistant Virus was created by transfecting 293T cells with packaging plas- group thresholds corresponding to the 25th to 75th percentile of the mid (pCMV-d8.9), envelope plasmid (VSV-G), and a pLK0.1 hairpin distribution of ln(IC50) values. A two-tailed Fisher exact test was used plasmid (see Supplementary Table S9 for hairpin target sequences), to determine the statistical enrichment of a given genotype (or organ) using FuGENE 6 per the manufacturer’s instructions (Promega). in the sensitive or resistant group at each threshold. In this analysis, It was filtered with a 0.4 μmol/L filter before use. Neuroblastoma mutation is defined as the presence of a specific gene fusion, a sequence cell lines were transduced in 10-cm plates with 2 mL virus and 8 μg/ change, or a copy number change across 84 cancer genes. mL Polybrene (Sigma-Aldrich) for 2 hours at 37°C, and then 8 mL medium was added to each plate. On day 2 post transduction, 2 μg/ Cell Culture mL [BE(2)-C] or 1 μg/mL (all other cell lines) puromycin (Sigma- Neuroblastoma cell lines were maintained in Dulbecco modified Aldrich) was added to select for infected cells, and 4 days post trans- Eagle medium (Cellgro) supplemented with 10% FBS (Sigma-Aldrich) duction, experiments to evaluate cell growth, apoptosis, and protein and 1% penicillin–streptomycin with glutamine (Cellgro). BE(2)-C and transcript levels were begun. and SH-SY5Y were obtained from the American Type Culture Collec- tion, and Kelly, LAN-1, SK-N-AS, and NGP were kindly provided by Genome-Wide Expression Analysis Dr. Rani George (Dana-Farber Cancer Institute). The identity of all BE(2)-C and Kelly cells were treated in triplicate with 1 μmol/L JQ1 lines was verified by small tandem repeat profiling conducted by the or dimethyl sulfoxide (DMSO) for 24 hours. RNA was extracted, and Shannon McCormack Advanced Molecular Diagnostics Laboratory a decrease in MYCN transcript was confirmed by real-time RT-PCR, at the Dana-Farber Cancer Institute. as described earlier. The samples were profiled using the Affymetrix PrimeView Human Gene Expression Array (Affymetrix) at Beth Israel Compounds, Cellular Viability, and Growth Deaconess Medical Center (Boston, MA). The computational analysis JQ1R, JQ1S, I-BET, and I-BET151 were synthesized by Dr. Jun Qi pipeline was conducted on the GenomeSpace bioinformatics plat- (Dana-Farber Cancer Institute). For the testing of multiple BET bro- form (50). modomain inhibitors in 4 neuroblastoma cell lines, cells were seeded onto 384-well tissue culture–treated plates at a density of 2,000 cells Data Processing The CEL data files were subjected to quality per well in a volume of 50 μL/well. Addition of inhibitor was con- control and passed tests based on distance between arrays, array ducted with a JANUS Workstation (PerkinElmer) using a 384-well intensity distribution, and variance mean dependence, which are pinhead tool that is calibrated to deliver 100 nL drug per well. After implemented in the ArrayQuality R package (Bioconductor). The raw 72 hours of incubation with inhibitor, cells were analyzed for cell expression data were processed and log2 transformed by applying viability using the ATPlite (PerkinElmer) Luminescence Assay Kit per the RMA algorithm in the Affymetrix package (Bioconductor). All the manufacturer’s instructions, using ATP content as a surrogate for probe sets with an average log2 expression less than 4 were consid- viable cell number. Luminescence was read on an EnVision 2104 Mul- ered underexpressed and were designated as “filtered.” Of the 49,293 tilabel Plate Reader (PerkinElmer). Nonlinear dose–response curves probe sets on the Affymetrix PrimeView Human Gene Expression were fitted to the data using Graphpad Prism software. To assess Array, 45,925 probe sets remained after filtering. The data from the growth, neuroblastoma cell lines were incubated with JQ1 in 384-well 45,925 probe sets were further collapsed to 19,108 nonredundant plates. ATP content was measured on days 0, 2, 3, and 5, using Cell- genes with distinct Human Genome Organisation (HUGO) sym- Titer Glo (Promega) according to the manufacturer’s instructions. bols, by assigning to each gene the probe set with the maximum average expression intensity. Gene expression data are available from Flow Cytometry Gene Expression Omnibus (GEO; accession no. GSE43392). Cell cycle was determined by measuring DNA content using PI staining. Apoptosis was measured using the annexin V: fluorescein Comparative Marker Analysis The 12 samples available in the isothiocyanate (FITC) Apoptosis Detection Kit per the manufac- data were separated into 2 groups: 1 μmol/L JQ1-treated samples ver- turer’s protocol (BD Pharmingen). sus DMSO-treated samples. The Comparative Marker Selection mod- ule from GenePattern 3.5.0 (50) was used to identify individual genes Protein Extraction and Immunoblotting differentially expressed between the JQ1- and the DMSO-treated groups (51). A 2-sided signal-to-noise ratio (SNR) test followed by Protein was extracted from cells by lysis with Cell Signaling Lysis 1,000 permutations of phenotype labels was conducted for this Buffer (Cell Signaling Technology) containing Complete EDTA-Free analysis. The settings for the SNR parameters were log-transformed Protease Inhibitor Cocktail (Roche Diagnostics) and PhosSTOP Phos- data, yes; complete, no; balanced, no; and smooth P values, yes. A phatase Inhibitor (Roche Diagnostics). Immunoblots were run as permutation P ≤ 0.05, a Benjamini–Hochberg FDR ≤ 0.05, account- previously described (49). Primary antibodies included anti-MYCN ing for multiple hypothesis testing, and an absolute fold change ≥ 2 (Abcam 16898), anti-BRD4 (Abcam 75898), anti-Vinculin (Abcam served as a cutoff for significant genes. Heatmaps were created with 18058), anti-MCM7 (Cell Signaling Technology 4018S), anti-MDM2 GENE-E software (50). (Santa Cruz Biotechnology sc-813), and anti-Actin (Neomarkers MS1295P). GSEA The GSEA software (50) was used to identify pathways, or groups of functionally related genes, deregulated by the JQ1 treat- RNA Extraction and Real-Time RT-PCR ment (18). The goal of GSEA is to identify groups of genes sharing RNA was extracted from cells with the RNeasy Kit and on-column DNA common biologic function (gene sets), which are distributed at the digestion (Qiagen). Primers and probes for MYCN (Hs00232074_ top or at the bottom of the ranked list of differentially expressed m1), BRD4 (Hs04188087_m1), PHOX2B (Hs00243679_m1), and the genes. GSEA assigns to each gene set an enrichment score calculated control gene RPL13A (Hs01926559_g1) were obtained from Applied as a running sum statistic by walking down the ranked list of dif- Biosystems. Data were collected in technical quadruplicate, analyzed ferentially expressed genes, increasing the sum when encountering

OF13 | CANCER DISCOVERY March 2013 www.aacrjournals.org

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 13 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

BET Bromodomain Inhibitors Target MYCN in Neuroblastoma RESEARCH ARTICLE

genes in the gene set, and decreasing it when encountering genes not In Vivo Studies in the gene set. The significance of the enrichment score is estimated Cell line xenograft tumors were established by implanting on the basis of a permutation P value and adjusted for multiple 2 million BE(2)-C-LucNeo cells or 2 million SH-SY5Y cells in 30% hypotheses testing through FDR. The set of differentially expressed Matrigel (BD Biosciences) subcutaneously in the flanks of 6-week- genes accounting for the enrichment signal is called the leading edge. old female NSG mice (The Jackson Laboratory). Serial biolumi- GSEA was run on the collections of 3,272 curated gene sets (c2) nescence imaging was conducted after injection with 75 mg/kg of and 615 transcription factor targets (c3) from version 3.1 of the d-luciferin (Promega) using a Xenogen IVIS Spectrum instrument MSigDB (50). Gene sets with less than 15 genes or more than 500 (PerkinElmer). Eight days after tumor inoculation, mice with genes were excluded from the analysis. Gene sets with an FDR ≤ established tumors, defined as increasing bioluminescence and 0.25 and a nominal P ≤ 0.05 were considered significant. The gene- measurable tumor volume, were divided into cohorts to be treated ranking metric in the weighted enrichment score was the 2-sided with 50 mg/kg JQ1 or vehicle (10% DMSO in 5% dextrose) deliv- SNR, and the P values were calculated using 1,000 permutations of ered by daily intraperitoneal injection (n = 10 per group). Because the phenotype. of rapid tumor growth and saturation, bioluminescence imaging was abandoned as an endpoint. Tumor volume was determined MYCN Amplification Signature A gene expression upregulation using the equation volume = 0.5 × length × width2. Mice were sac- signature to distinguish primary neuroblastoma tumors with MYCN rificed when tumors reached 2 cm in the longest linear dimension. amplification from those without MYCN amplification was created Statistical significance was determined by log-rank (Mantel–Cox) from the expression profiling of primary neuroblastoma tumors test for survival curves. This study was conducted using protocols (GSE12460, available at the GEO Database; ref. 20). The signature approved by the Dana-Farber Cancer Institute Animal Care and was generated on the basis of the Comparative Marker Selection algo- Use Committee. rithm of GenePattern, with the cutoff threshold 2 for the absolute TH-MYCN mice with palpable tumors (mean age at detection fold-change ratio and the cutoff 0.05 for the P value and the FDR. was 60 ± 15 d) were treated with JQ1 via intraperitoneal injection (50 mg/kg in 1:10 solution of DMSO:10% cyclodextrin) or vehicle A Consensus JQ1 Signature A consensus JQ1 signature was cre- (1:10 solution of DMSO:10% cyclodextrin), once daily for 28 days ated by intersecting the JQ1 differential expression signature in (n = 5 per group). In the primary human orthotopic model, a human this study with those from the studies by Delmore and colleagues MYCN-amplified primary neuroblastoma tumor was obtained from (8) in multiple myeloma and Zuber and colleagues (9) in AML. a child with relapsed, drug-resistant metastatic disease (SFNB-06). This consensus JQ1 signature consisted of 36 genes significantly Tumor pieces (4 mm3) were implanted into kidney capsule of nude downregulated and 17 genes significantly upregulated on the basis mice and maintained as a continuous xenograft. Human primary of the cutoffs of an absolute fold change ≥ 2 and P value and FDR SFNB-06 mice were treated once daily for 28 days, starting 7 days ≤ 0.05. The consensus JQ1 signature was evaluated on the primary after orthotopic transplantation (dosage as above; n = 5 per group). neuro­blastoma tumor data of Janoueix-Lerosey and colleagues (20) Statistical significance was determined by log-rank (Mantel–Cox) describing stage and MYCN amplification status. The primary tumor test for survival curves. All mice were monitored until euthanasia data were projected onto the consensus JQ1 signature and clustered was required, in accordance with the University of California, San on the basis of the average linkage hierarchical method. The JQ1 Francisco, Institutional Animal Care and Use Committee (IACUC) consensus signature separated the tumors into 2 clusters. The asso- guidelines. ciation of the tumor clusters with the MYCN status and stage was computed on the basis of the two-tailed Fisher exact test. A relaxed consensus JQ1 signature for downregulated genes iden- Disclosure of Potential Conflicts of Interest tified on the basis of the absolute fold change ≥ 1.5 and a P value J. Qi is a consultant/advisory board member of Tensha Therapeu- and FDR ≤ 0.05 was used in a functional enrichment analysis of the tics. J.E. Bradner is employed as a Scientific Founder in Tensha Thera- consensus JQ1 signature by GSEA. Functional enrichment analysis peutics, is a consultant/advisory board member, and has ownership results were visualized with Enrichment Map software, and func- interest (including patents) in the same. No potential conflicts of tional clusters are listed in Supplementary Table S7. interest were disclosed by the other authors.

Neuroblastoma JQ1-Specific Signature A collection of 116 genes Authors’ Contributions significantly downregulated (absolute fold change ≥ 2 and P value Conception and design: A. Puissant, S.M. Frumm, C.F. Bassil, and FDR ≤ 0.05) in the JQ1-treated neuroblastoma cell lines versus Y.H. Chanthery, C.H. Benes, A.L. Kung, W.A. Weiss, J.E. Bradner, control and unchanged in any of the other 2 JQ1-treated studies was K. Stegmaier identified. The small size of the neuroblastoma JQ1-specific signa- Development of methodology: A. Puissant, Y.H. Chanthery, A.L. Kung, ture, even in a relaxed format, necessitated the use of a two-tailed W.A. Weiss, J.E. Bradner, K. Stegmaier Fisher exact test rather than GSEA to identify the functional related- Acquisition of data (provided animals, acquired and managed ness of these genes. patients, provided facilities, etc.): S.M. Frumm, Y.H. Chanthery, E.A. Nekritz, R. Zeid, W.C. Gustafson, M.J. Garnett, U. McDermott, ChIP Studies C.H. Benes, A.L. Kung, W.A. Weiss, K. Stegmaier ChIP studies were carried out as described previously, using spe- Analysis and interpretation of data (e.g., statistical analysis, cific primers for the MYCN locus (8). Primers were designed to biostatistics, computational analysis): A. Puissant, S.M. Frumm, amplify 2 sites within the promoter region (5′–3′) and a nega- G. Alexe, C.F. Bassil, E.A. Nekritz, R. Zeid, A.L. Kung, W.A. Weiss, tive control region outside the promoter region: MYCN promoter J.E. Bradner, K. Stegmaier site 1 (forward) TTTGCACCTTCGGACTACCC and (reverse) TTT- Writing, review, and/or revision of the manuscript: A. Puissant, GACTGCGTGTTGTGCAG; MYCN promoter site 2 (forward) Y.H. Chanthery, W.C. Gustafson, C.H. Benes, A.L. Kung, W.A. Weiss, TCCTGGGAACTGTGTTGGAG and (reverse) TCCTCGGATGGCT- J.E. Bradner, K. Stegmaier ACAGTCT; MYCN-negative region (forward) GTATCACCGTCCAT- Administrative, technical, or material support (i.e., reporting TCCCCG and (reverse) TTGGAGGCAGCTCAAAGACC. Enrichment or organizing data, constructing databases): J. Qi, P. Greninger, data were analyzed by calculating the immunoprecipitated DNA A.L. Kung percentage of input DNA for each sample (triplicate PCR reactions). Study supervision: A.L. Kung, J.E. Bradner, K. Stegmaier

March 2013 CANCER DISCOVERY | OF14

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 14 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

RESEARCH ARTICLE Puissant et al.

Acknowledgments 15. McDermott U, Iafrate AJ, Gray NS, Shioda T, Classon M, Maheswaran S, et al. Genomic alterations of anaplastic lymphoma kinase may sen- The authors thank Dr. Rani George for providing cell lines and sitize tumors to anaplastic lymphoma kinase inhibitors. Cancer Res Ronald Paranal for technical support. 2008;68:3389–95. 16. Garnett MJ, Edelman EJ, Heidorn SJ, Greenman CD, Dastur A, Lau Grant Support KW, et al. Systematic identification of genomic markers of drug sen- This study was supported by V Foundation for Cancer Research sitivity in cancer cells. Nature 2012;483:570–5. Translational Grant (to K. Stegmaier and J.E. Bradner); Friends for 17. Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA, Life Fellowship (to K. Stegmaier and A.L. Kung); Howard Hughes Kim S, et al. The Cancer Cell Line Encyclopedia enables predictive Medical Institute Physician-Scientist Early Career Award (to K. Steg- modelling of anticancer drug sensitivity. Nature 2012;483:603–7. maier); Damon Runyon Cancer Research Foundation and Smith Fam- 18. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, ily Foundation (to J.E. Bradner and J. Qi); Alex’s Lemonade Stand (to Gillette MA, et al. Gene set enrichment analysis: a knowledge-based W.C. Gustafson); NIH grants R01CA102321 (to W.A. Weiss), approach for interpreting genome-wide expression profiles. Proc Natl P01CA081403 (to W.A. Weiss), K08NS079485 (to W.C. Gustafson), Acad Sci U S A 2005;102:15545–50. and T32CA151022 (to Y.H. Chanthery); The Wellcome Trust (086357; 19. Kim YH, Girard L, Giacomini CP, Wang P, Hernandez-Boussard T, Tibshirani R, et al. Combined microarray analysis of small cell lung to U. McDermott, M.J. Garnett, P. Greninger, and C.H. Benes); The cancer reveals altered apoptotic balance and distinct expression signa- Katie Dougherty Foundation (to W.A. Weiss); The Cancer League, Inc. tures of MYC family gene amplification. Oncogene 2006;25:130–8. (to W.A. Weiss); the Samuel Waxman Cancer Research Foundation (to 20. Janoueix-Lerosey I, Lequin D, Brugieres L, Ribeiro A, de Pontual L, J.E. Bradner and W.A. Weiss); and L’Association pour la Recherche sur Combaret V, et al. Somatic and germline activating mutations of the le Cancer (to A. Puissant). K. Stegmaier is also supported by a Stand Up ALK kinase receptor in neuroblastoma. Nature 2008;455:967–70. to Cancer Innovative Research Grant, a program of the Entertainment 21. Liberzon A, Subramanian A, Pinchback R, Thorvaldsdottir H, Industry Foundation (SU2C-AACR-IRG0509). Tamayo P, Mesirov JP. Molecular signatures database (MSigDB) 3.0. Bioinformatics 2011;27:1739–40. Received September 14, 2012; revised December 4, 2012; accepted 22. Thor S, Andersson SG, Tomlinson A, Thomas JB. A LIM-homeo- December 20, 2012; published OnlineFirst February 21, 2013. domain combinatorial code for motor-neuron pathway selection. Nature 1999;397:76–80. 23. Toyoshima M, Howie HL, Imakura M, Walsh RM, Annis JE, Chang AN, et al. Functional genomics identifies therapeutic targets for References MYC-driven cancer. Proc Natl Acad Sci U S A 2012;109:9545–50. . 1 Baylin SB, Jones PA. A decade of exploring the cancer epigenome— 24. Weiss WA, Aldape K, Mohapatra G, Feuerstein BG, Bishop JM. Tar- biological and translational implications. Nat Rev Cancer 2011;11: geted expression of MYCN causes neuroblastoma in transgenic mice. 726–34. EMBO J 1997;16:2985–95. 2. Taverna SD, Li H, Ruthenburg AJ, Allis CD, Patel DJ. How chromatin- 25. National Cancer Institute. Surveillance epidemiology and end binding modules interpret histone modifications: lessons from pro- results (SEER) database; 2008. [cited 2012 Dec 1]. Available from: fessional pocket pickers. Nat Struct Mol Biol 2007;14:1025–40. http://seer.cancer.gov. 3. Marushige K. Activation of chromatin by acetylation of histone side 26. Maris JM. Recent advances in neuroblastoma. N Engl J Med 2010; chains. Proc Natl Acad Sci U S A 1976;73:3937–41. 362:2202–11. 4. Zeng L, Zhou MM. Bromodomain: an acetyl-lysine binding domain. 27. Schwab M, Alitalo K, Klempnauer KH, Varmus HE, Bishop JM, Gil- FEBS Lett 2002;513:124–8. bert F, et al. Amplified DNA with limited homology to myc cellular 5. Dey A, Nishiyama A, Karpova T, McNally J, Ozato K. Brd4 marks oncogene is shared by human neuroblastoma cell lines and a neuro­ select genes on mitotic chromatin and directs postmitotic transcrip- blastoma tumour. Nature 1983;305:245–8. tion. Mol Biol Cell 2009;20:4899–909. 28. Seeger RC, Brodeur GM, Sather H, Dalton A, Siegel SE, Wong KY, 6. Filippakopoulos P, Picaud S, Mangos M, Keates T, Lambert JP, Barsyte- et al. Association of multiple copies of the N-myc oncogene with rapid Lovejoy D, et al. Histone recognition and large-scale structural analy- progression of neuroblastomas. N Engl J Med 1985;313:1111–6. sis of the human bromodomain family. Cell 2012;149:214–31. 29. Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplifi- 7. Filippakopoulos P, Qi J, Picaud S, Shen Y, Smith WB, Fedorov O, et al. cation of N-myc in untreated human neuroblastomas correlates with Selective inhibition of BET bromodomains. Nature 2010;471:235–9. advanced disease stage. Science 1984;224:1121–4. 8. Delmore JE, Issa GC, Lemieux ME, Rahl PB, Shi J, Jacobs HM, et al. 30. Molenaar JJ, Koster J, Zwijnenburg DA, van Sluis P, Valentijn LJ, van BET bromodomain inhibition as a therapeutic strategy to target der Ploeg I, et al. Sequencing of neuroblastoma identifies chromo­ c-Myc. Cell 2011;146:904–17. thripsis and defects in neuritogenesis genes. Nature 2012;483:589–93. 9. Zuber J, Shi J, Wang E, Rappaport AR, Herrmann H, Sison EA, et al. 31. Cheung NK, Zhang J, Lu C, Parker M, Bahrami A, Tickoo SK, et al. RNAi screen identifies Brd4 as a therapeutic target in acute myeloid Association of age at diagnosis and genetic mutations in patients leukaemia. Nature 2011;478:524–8. with neuroblastoma. JAMA 2012;307:1062–71. 10. Ott CJ, Kopp N, Bird L, Paranal RM, Qi J, Bowman T, et al. BET 32. George RE, Sanda T, Hanna M, Frohling S, Luther W, Zhang J, et al. bromodomain inhibition targets both c-MYC and IL7R in high-risk Activating mutations in ALK provide a therapeutic target in neuro­ acute lymphoblastic leukemia. Blood 2012;120:2843–52. blastoma. Nature 2008;455:975–8. 11. Dawson MA, Prinjha RK, Dittmann A, Giotopoulos G, Bantscheff M, 33. Mosse YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, Chan WI, et al. Inhibition of BET recruitment to chromatin as an effec- et al. Identification of ALK as a major familial neuroblastoma predis- tive treatment for MLL-fusion leukaemia. Nature 2011;478:529–33. position gene. Nature 2008;455:930–5. 12. Mertz JA, Conery AR, Bryant BM, Sandy P, Balasubramanian S, Mele 34. Chen Y, Takita J, Choi YL, Kato M, Ohira M, Sanada M, et al. Oncogenic DA, et al. Targeting MYC dependence in cancer by inhibiting BET mutations of ALK kinase in neuroblastoma. Nature 2008;455:971–4. bromodomains. Proc Natl Acad Sci U S A 2011;108:16669–74. 35. Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Ford 13. French CA, Miyoshi I, Kubonishi I, Grier HE, Perez-Atayde AR, JM, et al. Efficacy and safety of a specific inhibitor of the BCR- Fletcher JA. BRD4-NUT fusion oncogene: a novel mechanism in ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med aggressive carcinoma. Cancer Res 2003;63:304–7. 2001;344:1031–7. 14. Weinstein JN, Myers TG, O’Connor PM, Friend SH, Fornace AJ, Kohn 36. Flaherty KT, Puzanov I, Kim KB, Ribas A, McArthur GA, Sosman JA, KW, et al. An information-intensive approach to the molecular phar- et al. Inhibition of mutated, activated BRAF in metastatic melanoma. macology of cancer. Science 1997;275:343–9. N Engl J Med 2010;363:809–19.

OF15 | CANCER DISCOVERY March 2013 www.aacrjournals.org

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 15 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

BET Bromodomain Inhibitors Target MYCN in Neuroblastoma RESEARCH ARTICLE

. 37 Kwak EL, Bang YJ, Camidge DR, Shaw AT, Solomon B, Maki RG, 45. Boland CR, Thibodeau SN, Hamilton SR, Sidransky D, Eshleman JR, et al. Anaplastic lymphoma kinase inhibition in non–small-cell lung Burt RW, et al. A National Cancer Institute Workshop on Mi­crosatellite cancer. N Engl J Med 2010;363:1693–703. Instability for cancer detection and familial predisposition: devel- 38. Trochet D, Bourdeaut F, Janoueix-Lerosey I, Deville A, de Pontual L, Sch- opment of international criteria for the determination of mic- leiermacher G, et al. Germline mutations of the paired-like homeobox 2B rosatellite instability in colorectal cancer. Cancer Res 1998;58: (PHOX2B) gene in neuroblastoma. Am J Hum Genet 2004;74:761–4. 5248–57. 39. Raabe EH, Laudenslager M, Winter C, Wasserman N, Cole K, LaQuaglia 46. Greenman CD, Bignell G, Butler A, Edkins S, Hinton J, Beare D, et al. M, et al. Prevalence and functional consequence of PHOX2B muta- PICNIC: an algorithm to predict absolute allelic copy number varia- tions in neuroblastoma. Oncogene 2008;27:469–76. tion with microarray cancer data. Biostatistics 2010;11:164–75. 40. van Limpt V, Schramm A, van Lakeman A, Sluis P, Chan A, van Noesel 47. Wellcome Trust Sanger Institute. Characterization of the cancer cell lines M, et al. The Phox2B homeobox gene is mutated in sporadic neuro­ collection available from the Cancer Genome Project webpages. [cited 2012 blastomas. Oncogene 2004;23:9280–8. Dec 1] Available from: http://www.sanger.ac.uk/genetics/CGP/CellLines/. 41. Korshunov A, Remke M, Werft W, Benner A, Ryzhova M, Witt H, et al. 48. McDermott U, Sharma SV, Dowell L, Greninger P, Montagut C, Lamb Adult and pediatric medulloblastomas are genetically distinct and J, et al. Identification of genotype-correlated sensitivity to selective require different algorithms for molecular risk stratification. J Clin kinase inhibitors by using high-throughput tumor cell line profiling. Oncol 2010;28:3054–60. Proc Natl Acad Sci U S A 2007;104:19936–41. 42. Weng AP, Ferrando AA, Lee W, Morris JP IV, Silverman LB, Sanchez- 49. Banerji V, Frumm SM, Ross KN, Li LS, Schinzel AC, Hahn CK, et al. Irizarry C, et al. Activating mutations of NOTCH1 in human T cell The intersection of genetic and chemical genomic screens identifies acute lymphoblastic leukemia. Science 2004;306:269–71. GSK-3alpha as a target in human acute myeloid leukemia. J Clin 43. Puente XS, Pinyol M, Quesada V, Conde L, Ordonez GR, Villamor Invest 2012;122:935–47. N, et al. Whole-genome sequencing identifies recurrent mutations in 50. GENE-E version 1, GenePattern version 3.5.0, GSEA version 13, chronic lymphocytic leukaemia. Nature 2011;475:101–5. Cytoscape version 2.8.3 and MSigDB version 3.1. [cited 2012 Dec 1]. 44. Berry T, Luther W, Bhatnagar N, Jamin Y, Poon E, Sanda T, et al. The Available from: http://www.genomespace.org. ALK(F1174L) mutation potentiates the oncogenic activity of MYCN 51. Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern in neuroblastoma. Cancer Cell 2012;22:117–30. 2.0. Nat Genet 2006;38:500–1.

March 2013 CANCER DISCOVERY | OF16

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research. 15-CD-12-0418_p308-323.indd 16 22/02/13 12:15 AM Published OnlineFirst February 21, 2013; DOI: 10.1158/2159-8290.CD-12-0418

Targeting MYCN in Neuroblastoma by BET Bromodomain Inhibition

Alexandre Puissant, Stacey M. Frumm, Gabriela Alexe, et al.

Cancer Discovery Published OnlineFirst February 21, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/2159-8290.CD-12-0418

Supplementary Access the most recent supplemental material at: Material http://cancerdiscovery.aacrjournals.org/content/suppl/2013/02/26/2159-8290.CD-12-0418.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerdiscovery.aacrjournals.org/content/early/2013/02/21/2159-8290.CD-12-0418. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from cancerdiscovery.aacrjournals.org on October 2, 2021. © 2013 American Association for Cancer Research.