DOCSLIB.ORG

Genetics of Amyotrophic Lateral Sclerosis in the Han Chinese

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetics of Amyotrophic Lateral Sclerosis in the Han Chinese Genetics of amyotrophic lateral sclerosis in the Han Chinese Ji He A thesis submitted for the degree of Master of Philosophy at The University of Queensland in 2015 The University of Queensland Diamantina Institute 1 Abstract Amyotrophic lateral sclerosis is the most frequently occurring neuromuscular degenerative disorders, and has an obscure aetiology. Whilst major progress has been made, the majority of the genetic variation involved in ALS is, as yet, undefined. In this thesis, multiple genetic studies have been conducted to advance our understanding of the genetic architecture of the disease. In the light of the paucity of comprehensive genetic studies performed in Chinese, the presented study focused on advancing our current understanding in genetics of ALS in the Han Chinese population. To identify genetic variants altering risk of ALS, a genome-wide association study (GWAS) was performed. The study included 1,324 Chinese ALS cases and 3,115 controls. After quality control, a number of analyses were performed in a cleaned dataset of 1,243 cases and 2,854 controls that included: a genome-wide association analysis to identify SNPs associated with ALS; a genomic restricted maximum likelihood (GREML) analysis to estimate the proportion of the phenotypic variance in ALS liability due to common SNPs; and a gene- based analysis to identify genes associated with ALS. There were no genome-wide significant SNPs or genes associated with ALS. However, it was estimated that 17% (SE: 0.05; P=6×10-5) of the phenotypic variance in ALS liability was due to common SNPs. The top associated SNP was within GNAS (rs4812037; p =7×10-7). GNAS was also the most associated gene from the gene-based study (p =2×10-5). Based on GWAS data, a fragment-length and repeat-primed PCR was performed to determine GGGGCC copy number and expansion within the C9orf72 gene in the cohorts (1,092 sporadic ALS and 1,062 controls) from China. A haplotype analysis of 23 SNPs within and surrounding the C9orf72 gene was performed. The C9orf72 hexanucleotide (GGGGCC)n repeat expansion (HRE) was found in three sALS patients (0.3%) but not in control subjects (p = 0.25, Fisher’s exact test). Two cases 2 with HRE did not harbor four risk alleles that have previously been determined to be strongly associated with ALS in Caucasian populations. The presence of risk alleles (including rs2814707 and rs384992) of the 20-SNP consensus risk founder haplotype in Caucasians demonstrated that two of the three cases shared a novel haplotype carrying HRE. The low frequency (1.8%) of the 20-SNP consensus risk haplotype and the distinct allele distribution in Chinese ALS patients compared to Caucasian populations indicates that the C9orf72 HRE is not from the same single founder haplotype involved in Caucasian populations. In addition, using next generation sequencing, a population-specific mutational spectrum of ALS demonstrated that mutations in SOD1 are the most common causative mutations in fALS in the Han Chinese population. To identify further genetic associations, a novel strategy based on functional annotations and current understanding of ALS for specifically filtering candidate genes has been suggested. These findings broaden the spectrum of causative mutations in ALS and are essential for optimal design of strategies of mutational analysis and genetic counselling of Han Chinese ALS patients. To conclude, the presented study with the largest non-Caucasian ALS cohorts showed the heterogeneity of ALS in the Chinese Han population and laid the foundation for further genetic studies of ALS in Mainland China. 3 Declaration by author This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis. I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my research higher degree candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award. I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School. I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis. 4 Publications during candidature Amyotrophic Lateral Sclerosis Genetic Studies: From Genome-wide Association Mapping to Genome Sequencing. He J, Mangelsdorf M, Fan D, Bartlett P, Brown MA. Neuroscientist. 2014 Nov 5. pii: 1073858414555404; Contributor Statement of contribution Ji He Data collection and analysis(80%) Wrote the paper (70%) Mangelsdorf M Data collection and analysis(20%) Wrote and edited paper (30%) Fan D, Bartlett P, Brown MA Edited paper (70%) Publications included in this thesis Chapter 1. Literature review: Amyotrophic Lateral Sclerosis Genetic Studies: From Genome-wide Association Mapping to Genome Sequencing. He J, Mangelsdorf M, Fan D, Bartlett P, Brown MA. Neuroscientist. 2014 Nov 5. pii: 1073858414555404; Contributor Statement of contribution Ji He Data collection and analysis(80%) Wrote the paper (70%) Mangelsdorf M Data collection and analysis(20%) Wrote and edited paper (30%) Fan D, Bartlett P, Brown MA Edited paper (70%) 5 Contributions by others to the thesis Dr. Marie Mangelsdorf, Prof. Dongsheng Fan, Prof Peter Visscher, Prof Naomi Wray, Prof. Perry Bartlett and, Prof. Matthew A. Brown were involved in the conception and design of studies in the thesis; and the acquisition, analysis and interpretation of data. Chapter 1: edited by Ji He, Dr. Marie Mangelsdorf, Prof. Dongsheng Fan, Prof. Perry Bartlett and Prof. Matthew A. Brown. Chapter 2: edited by Ji He, Dr. Marie Mangelsdorf, Dr Beben Benyamin, Prof. Dongsheng Fan and Prof. Matthew A. Brown. Katie Cremin, Jessica Haris, Lawrie Wheeler and Brooke Gardiner co-contributed in carrying out microarray genotyping assays. The analysis is also contributed by Dr. Xin Wu, Prof. Huji Xu, Dr. Beben Benyamin, Dr. Paul Leo. Chapter 3: Ji He, Dr. Marie Mangelsdorf, Prof. Dongsheng Fan and Prof. Matthew A. Brown wrote the manuscript. Repeat-Primed PCR study is co- contributed with Lu Tang and Prof. Dongsheng Fan, Haplotype SNP Analysis is co- contributed with Katie Cameron, Jessica Harris, Lawrie Wheeler, Brooke Gardiner, Dr. Xin Wu, Prof. Huji Xu, Dr. Beben Benyamin, Dr. Paul Leo and Professor Matthew A. Brown. Chapter 4: edited by Ji He, Dr. Marie Mangelsdorf, Prof. Dongsheng Fan and Prof. Matthew A. Brown. Whole Exome Sequencing with Next Generation Sequencing is co- contributed by Sharon Song, Lisa Anderson, Janette Edson and Brooke Gardener, variants analysis is co-contributed by Dr. Mhairi Marshall, Dr. Paul Leo and Dr. Marie Mangelsdorf. Chapter 5: edited by Ji He, Dr. Marie Mangelsdorf, Prof. Dongsheng Fan, Prof. Perry Bartlett and Prof. Matthew A. Brown. All authors read and approved the final manuscript. 6 Statement of parts of the thesis submitted to qualify for the award of another degree None 7 Acknowledgements The author gratefully acknowledges the receipt of a University of Queensland Postgraduate Research Scholarship (UQPRS) and MND scholarship (UQ Diamantina Institute) to support the work reported in this thesis. I would like to thank my supervisor Dr.Marie Mangelsdorf, Dr.Beben Benyamin and Prof. Matthew A. Brown for their guidance, support and complimentary insights into scientific and clinical aspects of my project. Also, I would like to thank Dr. Paul Leo for his support in statistic analysis and modelling, Prof. Dongsheng Fan and Prof Huji Xu for their support in the study, writing my thesis and paper. Likewise, I would like to thank the members, present and past, of the University of Queensland Diamantina Institute (UQDI) and Queensland Brain Institute (QBI) for their patience, assistance and friendship. I would like to thank my family, especially my father, mother and brother, and friends for their ongoing support, patience and understanding. This project would not have been possible without the time and blood samples cheerfully donated by amyotrophic lateral sclerosis patients of the Peking University Third Hospital. The people and institutions that made specific contribution to this thesis are acknowledged in the relevant chapters. 8 Keywords Neurodegenerative disease, amyotrophic lateral sclerosis, genetic study, genome-wide association study, haplotype analysis, next-generation sequencing study. Australian and New Zealand Standard Research Classifications (ANZSRC) ANZSRC code: 110904, Neurology and Neuromuscular Diseases, 40%, ANZSRC code: 060102, Bioinformatics, 30% ANZSRC code: 060405, Gene Expression, 30% Fields of Research
Load more

Recommended publications
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name spermatogenesis-associated protein 2 Gene Symbol Spata2 Organism Rat Gene Summary Sertoli cell mRNA expression is induced by FSH; may play a role in spermatogenesis; localized to the nucleus Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.201291 Ensembl Gene ID ENSRNOG00000009207 Entrez Gene ID 114210 Assay Information Unique Assay ID qRnoCEP0030238 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000012604 Amplicon Context Sequence ACTTCCGGAATAAGTCATCCTTGTACTTCGTATCCATTGAACTGGGCTTCCCCAA ATCAAACCCAAGGGCTACCTCATCTCCCCCATGGCTCTGGGGCTGGAGGCTGG CACATCACATGAAGAACTGGCATGGTGCCCATGGACCAGC Amplicon Length (bp) 118 Chromosome Location 3:170384245-170384392 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9996 cDNA Cq 23.47 cDNA Tm (Celsius) 85 gDNA Cq 25.95 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Spata2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name ring finger protein 114 Gene Symbol RNF114 Organism Human Gene Summary Description Not Available Gene Aliases PSORS12, ZNF313 RefSeq Accession No. NC_000020.10, NT_011362.10 UniGene ID Hs.144949 Ensembl Gene ID ENSG00000124226 Entrez Gene ID 55905 Assay Information Unique Assay ID qHsaCED0044029 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000244061 Amplicon Context Sequence TCTCGGGAGGACCCAAAAGTTAAGGTCAGCTTGTTCACTGTAATTTCTGGAAGAA GTTCACTCAGACCTTCCTGAATTCAGATCATCTCAGAAGTCTGGAGGGAAATCT Amplicon Length (bp) 79 Chromosome Location 20:48570127-48570235 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9999 cDNA Cq 20.21 cDNA Tm (Celsius) 78.5 gDNA Cq 24.64 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report RNF114, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Mouse Spata2 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Spata2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Spata2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Spata2 gene (NCBI Reference Sequence: NM_170756 ; Ensembl: ENSMUSG00000047030 ) is located on Mouse chromosome 2. 3 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 3 (Transcript: ENSMUST00000057627). Exon 2~3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Spata2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-144E24 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous knockout leads to small testes, oligospermia, asthenozoospermia, reduced male fertility and decreased male germ cell numbers. It also affects necroptosis and increases inflammatory responses. Exon 2~3 covers 100.0% of the coding region. Start codon is in exon 2, and stop codon is in exon 3. The size of intron 1 for 5'-loxP site insertion: 7165 bp. The size of effective cKO region: ~2396 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele T A 5' gRNA region G 3' 1 2 3 Targeting vector T A G Targeted allele T A G Constitutive KO allele (After Cre recombination) Legends Exon of mouse Spata2 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Genome-Wide Pooling Approach Identifies SPATA5 As a New Susceptibility Locus for Alopecia Areata Regina C
    Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata Regina C. Betz, Lina M. Forstbauer, Felix F. Brockschmidt, Valentina Moskvina, Christine Herold, Silke Redler, Alexandra Herzog, Axel M. Hillmer, Christian Meesters, Stefanie Heilmann, et al. To cite this version: Regina C. Betz, Lina M. Forstbauer, Felix F. Brockschmidt, Valentina Moskvina, Christine Herold, et al.. Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata. European Journal of Human Genetics, Nature Publishing Group, 2011, 10.1038/ejhg.2011.185. hal- 00691329 HAL Id: hal-00691329 https://hal.archives-ouvertes.fr/hal-00691329 Submitted on 26 Apr 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for 2 alopecia areata 3 4 Lina M. Forstbauer1*, Felix F. Brockschmidt1,2*, Valentina Moskvina3, Christine 5 Herold4, Silke Redler1, Alexandra Herzog1, Axel M. Hillmer5, Christian Meesters4,6, 6 Stefanie Heilmann1,2, Florian Albert1, Margrieta Alblas1,2, Sandra Hanneken7, Sibylle 7 Eigelshoven7, Kathrin A. Giehl8, Dagny Jagielska1,9, Ulrike Blume-Peytavi9, Natalie 8 Garcia Bartels9, Jennifer Kuhn10,11,12, Hans Christian Hennies10,11,12, Matthias 9 Goebeler13, Andreas Jung13, Wiebke K.
    [Show full text]
  • Mitochondrial Genetics
    Mitochondrial genetics Patrick Francis Chinnery and Gavin Hudson* Institute of Genetic Medicine, International Centre for Life, Newcastle University, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK Introduction: In the last 10 years the field of mitochondrial genetics has widened, shifting the focus from rare sporadic, metabolic disease to the effects of mitochondrial DNA (mtDNA) variation in a growing spectrum of human disease. The aim of this review is to guide the reader through some key concepts regarding mitochondria before introducing both classic and emerging mitochondrial disorders. Sources of data: In this article, a review of the current mitochondrial genetics literature was conducted using PubMed (http://www.ncbi.nlm.nih.gov/pubmed/). In addition, this review makes use of a growing number of publically available databases including MITOMAP, a human mitochondrial genome database (www.mitomap.org), the Human DNA polymerase Gamma Mutation Database (http://tools.niehs.nih.gov/polg/) and PhyloTree.org (www.phylotree.org), a repository of global mtDNA variation. Areas of agreement: The disruption in cellular energy, resulting from defects in mtDNA or defects in the nuclear-encoded genes responsible for mitochondrial maintenance, manifests in a growing number of human diseases. Areas of controversy: The exact mechanisms which govern the inheritance of mtDNA are hotly debated. Growing points: Although still in the early stages, the development of in vitro genetic manipulation could see an end to the inheritance of the most severe mtDNA disease. Keywords: mitochondria/genetics/mitochondrial DNA/mitochondrial disease/ mtDNA Accepted: April 16, 2013 Mitochondria *Correspondence address. The mitochondrion is a highly specialized organelle, present in almost all Institute of Genetic Medicine, International eukaryotic cells and principally charged with the production of cellular Centre for Life, Newcastle energy through oxidative phosphorylation (OXPHOS).
    [Show full text]
  • Genome-Wide Linkage and Association Study Implicates the 10Q26 Region As a Major Genetic Contributor to Primary Nonsyndromic
    www.nature.com/scientificreports OPEN Genome-wide linkage and association study implicates the 10q26 region as a major Received: 6 July 2017 Accepted: 6 October 2017 genetic contributor to primary Published: xx xx xxxx nonsyndromic vesicoureteric refux John M. Darlow1,2, Rebecca Darlay3, Mark G. Dobson1,2, Aisling Stewart3, Pimphen Charoen4,5, Jennifer Southgate 6, Simon C. Baker 6, Yaobo Xu3, Manuela Hunziker2,7, Heather J. Lambert8, Andrew J. Green1,9, Mauro Santibanez-Koref3, John A. Sayer 3, Timothy H. J. Goodship3, Prem Puri2,10, Adrian S. Woolf 11,12, Rajko B. Kenda13, David E. Barton1,9 & Heather J. Cordell3 Vesicoureteric refux (VUR) is the commonest urological anomaly in children. Despite treatment improvements, associated renal lesions – congenital dysplasia, acquired scarring or both – are a common cause of childhood hypertension and renal failure. Primary VUR is familial, with transmission rate and sibling risk both approaching 50%, and appears highly genetically heterogeneous. It is often associated with other developmental anomalies of the urinary tract, emphasising its etiology as a disorder of urogenital tract development. We conducted a genome-wide linkage and association study in three European populations to search for loci predisposing to VUR. Family-based association analysis of 1098 parent-afected-child trios and case/control association analysis of 1147 cases and 3789 controls did not reveal any compelling associations, but parametric linkage analysis of 460 families (1062 afected individuals) under a dominant model identifed a single region, on 10q26, that showed strong linkage (HLOD = 4.90; ZLRLOD = 4.39) to VUR. The ~9Mb region contains 69 genes, including some good biological candidates.
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]
  • Mitochondrial Medicine 2019: Washington DC Scientific and Clinical Meetings June 26-29, 2019 Hilton Alexandria Mark Center Alexandria, VA
    Mitochondrial Medicine 2019: Washington DC Scientific and Clinical Meetings June 26-29, 2019 Hilton Alexandria Mark Center Alexandria, VA 2019 Course Chairs: Amel Kara, MD and Carla Koehler, PhD 2019 CME Chair: Bruce H. Cohen, MD Mitochondrial Medicine 2019: Washington DC Scientific/Clinical Program June 26-29, 2019 Course Description The United Mitochondrial Disease Foundation and PeerPoint Medical Education Institute have joined efforts to sponsor and organize a CME-accredited symposium. Mitochondrial diseases are more common than previously recognized and mitochondrial pathophysiology is now a recognized part of many disease processes, including heart disease, cancer, AIDS and diabetes. There have been significant advances in the molecular genetics, proteomics, epidemiology and clinical aspects of mitochondrial pathophysiology. This conference is directed toward the scientist and clinician interested in all aspects of mitochondrial science. The content of this educational program was determined by rigorous assessment of educational needs and includes surveys, program feedback, expert faculty assessment, literature review, medical practice, chart review and new medical knowledge. The format will include didactic lectures from invited experts intermixed with peer-reviewed platform presentations. There will be ample time for professional discussion both in and out of the meeting room, and peer-reviewed poster presentations will be given throughout the meeting. This will be a four-day scientific meeting aimed at those with scientific and
    [Show full text]