DOCSLIB.ORG

Mouse Spata2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Spata2 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Spata2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Spata2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Spata2 gene (NCBI Reference Sequence: NM_170756 ; Ensembl: ENSMUSG00000047030 ) is located on Mouse chromosome 2. 3 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 3 (Transcript: ENSMUST00000057627). Exon 2~3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Spata2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-144E24 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous knockout leads to small testes, oligospermia, asthenozoospermia, reduced male fertility and decreased male germ cell numbers. It also affects necroptosis and increases inflammatory responses. Exon 2~3 covers 100.0% of the coding region. Start codon is in exon 2, and stop codon is in exon 3. The size of intron 1 for 5'-loxP site insertion: 7165 bp. The size of effective cKO region: ~2396 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele T A 5' gRNA region G 3' 1 2 3 Targeting vector T A G Targeted allele T A G Constitutive KO allele (After Cre recombination) Legends Exon of mouse Spata2 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(8623bp) | A(20.79% 1793) | C(26.42% 2278) | T(26.22% 2261) | G(26.57% 2291) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 167485726 167488725 3000 browser details YourSeq 258 124 823 3000 87.9% chr10 - 93526203 93722716 196514 browser details YourSeq 244 178 831 3000 94.7% chr1 - 155911610 156309830 398221 browser details YourSeq 244 291 831 3000 89.0% chr1 - 58384149 58384701 553 browser details YourSeq 243 178 823 3000 88.7% chr11 - 103696668 103842822 146155 browser details YourSeq 243 320 831 3000 91.1% chr10 + 81348187 81522369 174183 browser details YourSeq 221 311 831 3000 83.4% chr11 - 100543810 100544165 356 browser details YourSeq 217 323 831 3000 93.0% chr4 - 148035830 148036350 521 browser details YourSeq 204 338 830 3000 86.3% chr10 - 117730436 117731042 607 browser details YourSeq 202 127 831 3000 86.6% chr1 - 35703984 35748417 44434 browser details YourSeq 200 322 831 3000 94.7% chr16 - 90077940 90124239 46300 browser details YourSeq 197 327 830 3000 92.4% chr1 - 16609665 16610266 602 browser details YourSeq 196 377 831 3000 85.8% chr11 + 4853916 4854249 334 browser details YourSeq 185 336 831 3000 86.4% chr1 - 84875342 84875654 313 browser details YourSeq 184 327 831 3000 86.2% chr10 - 128450103 128450445 343 browser details YourSeq 174 178 831 3000 88.3% chr11 - 74855044 74866001 10958 browser details YourSeq 173 278 831 3000 86.1% chr10 + 128898300 128898547 248 browser details YourSeq 160 659 840 3000 95.6% chr4 - 116041858 116042072 215 browser details YourSeq 158 439 831 3000 95.0% chr1 - 59661544 59793311 131768 browser details YourSeq 157 657 831 3000 96.0% chr11 - 75646244 75646441 198 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 167480353 167483352 3000 browser details YourSeq 1481 1 1933 3000 92.0% chr9 - 15431502 15439994 8493 browser details YourSeq 933 1005 1954 3000 98.8% chr17 + 30505310 30506256 947 browser details YourSeq 733 1046 1919 3000 93.9% chr8 - 47626661 47627557 897 browser details YourSeq 187 2259 2587 3000 87.5% chr4 - 129425837 129694967 269131 browser details YourSeq 186 2258 2650 3000 88.1% chr2 + 26070915 26071354 440 browser details YourSeq 162 2258 2593 3000 86.1% chr7 - 97392524 97392928 405 browser details YourSeq 162 1791 1954 3000 99.4% chr10 + 116980646 116980809 164 browser details YourSeq 159 2247 2450 3000 89.2% chr18 - 35304836 35305037 202 browser details YourSeq 156 2250 2509 3000 86.0% chr11 + 120652821 120653362 542 browser details YourSeq 149 2244 2428 3000 91.2% chr8 - 111428833 111429025 193 browser details YourSeq 145 2293 2644 3000 83.0% chr5 + 92129952 92130556 605 browser details YourSeq 143 2247 2437 3000 89.9% chr1 + 165504329 165504533 205 browser details YourSeq 142 2258 2644 3000 86.3% chr5 + 128954105 128954597 493 browser details YourSeq 142 2257 2446 3000 89.1% chr10 + 118223732 118223920 189 browser details YourSeq 140 1925 2658 3000 80.2% chr12 + 21551783 21552164 382 browser details YourSeq 140 2254 2437 3000 93.7% chr11 + 95886154 95886341 188 browser details YourSeq 138 2280 2542 3000 90.1% chr9 + 56540836 56541270 435 browser details YourSeq 138 2258 2433 3000 91.2% chr6 + 12658648 12658824 177 browser details YourSeq 138 1920 2443 3000 80.5% chr10 + 115258307 115258519 213 Note: The 3000 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Spata2 spermatogenesis associated 2 [ Mus musculus (house mouse) ] Gene ID: 263876, updated on 24-Oct-2019 Gene summary Official Symbol Spata2 provided by MGI Official Full Name spermatogenesis associated 2 provided by MGI Primary source MGI:MGI:2146885 See related Ensembl:ENSMUSG00000047030 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as AI504642; mKIAA0757 Expression Ubiquitous expression in large intestine adult (RPKM 17.1), colon adult (RPKM 16.8) and 28 other tissues See more Orthologs human all Genomic context Location: 2; 2 H3 See Spata2 in Genome Data Viewer Exon count: 5 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 2 NC_000068.7 (167481136..167493238, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 2 NC_000068.6 (167306636..167318374, complement) Chromosome 2 - NC_000068.7 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 6 transcripts Gene: Spata2 ENSMUSG00000047030 Description spermatogenesis associated 2 [Source:MGI Symbol;Acc:MGI:2146885] Location Chromosome 2: 167,481,133-167,492,887 reverse strand. GRCm38:CM000995.2 About this gene This gene has 6 transcripts (splice variants), 193 orthologues, 1 paralogue, is a member of 1 Ensembl protein family and is associated with 11 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Spata2-201 ENSMUST00000057627.15 4012 515aa ENSMUSP00000057095.9 Protein coding CCDS17100 Q8K004 TSL:1 GENCODE basic APPRIS P1 Spata2-202 ENSMUST00000109211.8 1531 414aa ENSMUSP00000104834.2 Protein coding - Q8K004 TSL:1 GENCODE basic Spata2-204 ENSMUST00000147051.1 733 No protein - Retained intron - - TSL:1 Spata2-206 ENSMUST00000155875.7 475 No protein - lncRNA - - TSL:2 Spata2-205 ENSMUST00000154770.1 462 No protein - lncRNA - - TSL:2 Spata2-203 ENSMUST00000126389.7 414 No protein - lncRNA - - TSL:2 Page 6 of 8 https://www.alphaknockout.com 31.75 kb Forward strand 167.48Mb 167.49Mb 167.50Mb Genes Slc9a8-201 >protein coding Rnf114-202 >protein coding (Comprehensive set... Slc9a8-202 >protein coding Slc9a8-203 >protein coding Slc9a8-206 >lncRNA Slc9a8-208 >lncRNA Slc9a8-210 >lncRNA Contigs AL589870.30 > Genes (Comprehensive set... < Spata2-201protein coding < Spata2-202protein coding < Spata2-204retained intron < Spata2-203lncRNA < Spata2-206lncRNA < Spata2-205lncRNA Regulatory Build 167.48Mb 167.49Mb 167.50Mb Reverse strand 31.75 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding processed transcript RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000057627 < Spata2-201protein coding Reverse strand 11.76 kb ENSMUSP00000057... Low complexity (Seg) PANTHER PTHR15326 Spermatogenesis-associated protein 2 Gene3D 1.20.58.2190 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 515 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name spermatogenesis-associated protein 2 Gene Symbol Spata2 Organism Rat Gene Summary Sertoli cell mRNA expression is induced by FSH; may play a role in spermatogenesis; localized to the nucleus Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.201291 Ensembl Gene ID ENSRNOG00000009207 Entrez Gene ID 114210 Assay Information Unique Assay ID qRnoCEP0030238 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000012604 Amplicon Context Sequence ACTTCCGGAATAAGTCATCCTTGTACTTCGTATCCATTGAACTGGGCTTCCCCAA ATCAAACCCAAGGGCTACCTCATCTCCCCCATGGCTCTGGGGCTGGAGGCTGG CACATCACATGAAGAACTGGCATGGTGCCCATGGACCAGC Amplicon Length (bp) 118 Chromosome Location 3:170384245-170384392 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9996 cDNA Cq 23.47 cDNA Tm (Celsius) 85 gDNA Cq 25.95 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Spata2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Genetics of Amyotrophic Lateral Sclerosis in the Han Chinese
    Genetics of amyotrophic lateral sclerosis in the Han Chinese Ji He A thesis submitted for the degree of Master of Philosophy at The University of Queensland in 2015 The University of Queensland Diamantina Institute 1 Abstract Amyotrophic lateral sclerosis is the most frequently occurring neuromuscular degenerative disorders, and has an obscure aetiology. Whilst major progress has been made, the majority of the genetic variation involved in ALS is, as yet, undefined. In this thesis, multiple genetic studies have been conducted to advance our understanding of the genetic architecture of the disease. In the light of the paucity of comprehensive genetic studies performed in Chinese, the presented study focused on advancing our current understanding in genetics of ALS in the Han Chinese population. To identify genetic variants altering risk of ALS, a genome-wide association study (GWAS) was performed. The study included 1,324 Chinese ALS cases and 3,115 controls. After quality control, a number of analyses were performed in a cleaned dataset of 1,243 cases and 2,854 controls that included: a genome-wide association analysis to identify SNPs associated with ALS; a genomic restricted maximum likelihood (GREML) analysis to estimate the proportion of the phenotypic variance in ALS liability due to common SNPs; and a gene- based analysis to identify genes associated with ALS. There were no genome-wide significant SNPs or genes associated with ALS. However, it was estimated that 17% (SE: 0.05; P=6×10-5) of the phenotypic variance in ALS liability was due to common SNPs. The top associated SNP was within GNAS (rs4812037; p =7×10-7).
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Genome-Wide Pooling Approach Identifies SPATA5 As a New Susceptibility Locus for Alopecia Areata Regina C
    Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata Regina C. Betz, Lina M. Forstbauer, Felix F. Brockschmidt, Valentina Moskvina, Christine Herold, Silke Redler, Alexandra Herzog, Axel M. Hillmer, Christian Meesters, Stefanie Heilmann, et al. To cite this version: Regina C. Betz, Lina M. Forstbauer, Felix F. Brockschmidt, Valentina Moskvina, Christine Herold, et al.. Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata. European Journal of Human Genetics, Nature Publishing Group, 2011, 10.1038/ejhg.2011.185. hal- 00691329 HAL Id: hal-00691329 https://hal.archives-ouvertes.fr/hal-00691329 Submitted on 26 Apr 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for 2 alopecia areata 3 4 Lina M. Forstbauer1*, Felix F. Brockschmidt1,2*, Valentina Moskvina3, Christine 5 Herold4, Silke Redler1, Alexandra Herzog1, Axel M. Hillmer5, Christian Meesters4,6, 6 Stefanie Heilmann1,2, Florian Albert1, Margrieta Alblas1,2, Sandra Hanneken7, Sibylle 7 Eigelshoven7, Kathrin A. Giehl8, Dagny Jagielska1,9, Ulrike Blume-Peytavi9, Natalie 8 Garcia Bartels9, Jennifer Kuhn10,11,12, Hans Christian Hennies10,11,12, Matthias 9 Goebeler13, Andreas Jung13, Wiebke K.
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20
    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
    [Show full text]
  • Genome-Wide Pooling Approach Identifies SPATA5 As A
    European Journal of Human Genetics (2012) 20, 326–332 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata Lina M Forstbauer1,20, Felix F Brockschmidt1,2,20, Valentina Moskvina3, Christine Herold4, Silke Redler1, Alexandra Herzog1, Axel M Hillmer5, Christian Meesters4,6, Stefanie Heilmann1,2, Florian Albert1, Margrieta Alblas1,2, Sandra Hanneken7, Sibylle Eigelshoven7, Kathrin A Giehl8, Dagny Jagielska1,9, Ulrike Blume-Peytavi9, Natalie Garcia Bartels9, Jennifer Kuhn10,11,12, Hans Christian Hennies10,11,12, Matthias Goebeler13, Andreas Jung13, Wiebke K Peitsch14, Anne-Katrin Kortu¨m15, Ingrid Moll15, Roland Kruse16, Gerhard Lutz17, Hans Wolff7, Bettina Blaumeiser18, Markus Bo¨hm19, George Kirov3, Tim Becker4,6, Markus M No¨then1,2 and Regina C Betz*,1 Alopecia areata (AA) is a common hair loss disorder, which is thought to be a tissue-specific autoimmune disease. Previous research has identified a few AA susceptibility genes, most of which are implicated in autoimmunity. To identify new genetic variants and further elucidate the genetic basis of AA, we performed a genome-wide association study using the strategy of pooled DNA genotyping (729 cases, 656 controls). The strongest association was for variants in the HLA region, which confirms the validity of the pooling strategy. The selected top 61 single-nucleotide polymorphisms (SNPs) were analyzed in an independent replication sample (454 cases, 1364 controls). Only one SNP outside of the HLA region (rs304650) showed significant association. This SNP was then analyzed in a second independent replication sample (537 cases, 657 controls).
    [Show full text]
  • Promoter Chip-Chip Analysis in Mouse Testis Reveals Y Chromosome Occupancy by HSF2
    Promoter ChIP-chip analysis in mouse testis reveals Y chromosome occupancy by HSF2 Malin Åkerfelt*†‡, Eva Henriksson*†‡, Asta Laiho*, Anniina Vihervaara*†, Karoliina Rautoma*†, Noora Kotaja§ and Lea Sistonen*†¶ *Turku Centre for Biotechnology, University of Turku and Åbo Akademi University, FIN-20520 Turku, Finland; †Department of Biology, Åbo Akademi University, FIN-20520 Turku, Finland; and §Department of Physiology, University of Turku, FIN-20520, Turku, Finland Edited by David C. Page, Massachusetts Institute of Technology, Cambridge, MA, and approved May 21, 2008 (received for review January 21, 2008) The mammalian Y chromosome is essential for spermatogenesis, High-resolution chromatin immunoprecipitation on microarray which is characterized by sperm cell differentiation and chromatin (ChIP-chip) screens have successfully been used for identifying condensation for acquisition of correct shape of the sperm. Dele- direct target genes for many transcription factors (10). For example, tions of the male-specific region of the mouse Y chromosome long Ϸ3% of the genomic loci were found to be targets for HSF in arm (MSYq), harboring multiple copies of a few genes, lead to Saccharomyces cerevisiae and Drosophila exposed to heat stress (11, sperm head defects and impaired fertility. Using chromatin immu- 12). In mammals, however, the existence of three differently noprecipitation on promoter microarray (ChIP-chip) on mouse expressed HSFs (HSF1, HSF2, and HSF4) requires a strategy testis, we found a striking in vivo MSYq occupancy by heat shock to investigate each HSF in a tissue-specific manner. Here, we factor 2 (HSF2), a transcription factor involved in spermatogenesis. chose to dissect the specific role for HSF2 in spermato- HSF2 was also found to regulate the transcription of MSYq resident genesis and to map the in vivo targets for HSF2, by using mouse genes, whose transcriptional regulation has been unknown.
    [Show full text]
  • Tepzz 8Z6z54a T
    (19) TZZ ZZ_T (11) EP 2 806 054 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 26.11.2014 Bulletin 2014/48 C40B 40/06 (2006.01) C12Q 1/68 (2006.01) C40B 30/04 (2006.01) C07H 21/00 (2006.01) (21) Application number: 14175049.7 (22) Date of filing: 28.05.2009 (84) Designated Contracting States: (74) Representative: Irvine, Jonquil Claire AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HGF Limited HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL 140 London Wall PT RO SE SI SK TR London EC2Y 5DN (GB) (30) Priority: 28.05.2008 US 56827 P Remarks: •Thecomplete document including Reference Tables (62) Document number(s) of the earlier application(s) in and the Sequence Listing can be downloaded from accordance with Art. 76 EPC: the EPO website 09753364.0 / 2 291 553 •This application was filed on 30-06-2014 as a divisional application to the application mentioned (71) Applicant: Genomedx Biosciences Inc. under INID code 62. Vancouver, British Columbia V6J 1J8 (CA) •Claims filed after the date of filing of the application/ after the date of receipt of the divisional application (72) Inventor: Davicioni, Elai R.68(4) EPC). Vancouver British Columbia V6J 1J8 (CA) (54) Systems and methods for expression- based discrimination of distinct clinical disease states in prostate cancer (57) A system for expression-based discrimination of distinct clinical disease states in prostate cancer is provided that is based on the identification of sets of gene transcripts, which are characterized in that changes in expression of each gene transcript within a set of gene transcripts can be correlated with recurrent or non- recur- rent prostate cancer.
    [Show full text]
  • Evolutionary History of Novel Genes on the Tammar Wallaby Y Chromosome: Implications for Sex Chromosome Evolution
    Downloaded from genome.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Evolutionary history of novel genes on the tammar wallaby Y chromosome: implications for sex chromosome evolution Veronica J. Murtagh1,2, Denis O’Meally1,9, Natasha Sankovic1,2,3, Margaret L. Delbridge1,2, Yoko Kuroki4, Jeffrey L. Boore5, Atsushi Toyoda6, Kristen S. Jordan1, Andrew J. Pask2,3,7, Marilyn B. Renfree2,3, Asao Fujiyama6,8, Jennifer A. Marshall Graves1,2,3 and Paul D. Waters1,2§ 1 Evolution, Ecology and Genetics, Research School of Biology, The Australian National University, Canberra, ACT 2601, Australia 2 ARC Centre of Excellence for Kangaroo Genomics 3 Department of Zoology, The University of Melbourne, Victoria 3010, Australia 4 RIKEN Research Center for Allergy and Immunology, Immunogenomics, Yokohama, Japan 5 Genome Project Solutions, 1024 Promenade Street, Hercules, California, 94547 USA and DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598 USA 6 National Institute of Genetics, Mishima, Japan 7 Department of Molecular and Cellular Biology, University of Connecticut, Storrs, Connecticut 06260, USA 8 National Institute of Informatics, Tokyo, Japan 9 Institute for Applied Ecology, University of Canberra, ACT 2601, Australia §Corresponding author Evolution, Ecology and Genetics, Research School of Biology, The Australian National University, GPO Box 475, ACT 2601 Canberra, Australia e-mail: [email protected] phone: +61-2-6125 2371 fax: +61-2-6125 8525 - 1 - Downloaded from genome.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press keywords: Y chromosome, Comparative genomics, Marsupials, X chromosome - 2 - Downloaded from genome.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract We report here the isolation and sequencing of ten Y-specific tammar wallaby (Macropus eugenii) BAC clones, revealing five hitherto undescribed tammar wallaby Y genes (in addition to the five genes already described) and several pseudogenes.
    [Show full text]
  • Supplemental Table 3 Two-Class Paired Significance Analysis of Microarrays Comparing Gene Expression Between Paired
    Supplemental Table 3 Two‐class paired Significance Analysis of Microarrays comparing gene expression between paired pre‐ and post‐transplant kidneys biopsies (N=8). Entrez Fold q‐value Probe Set ID Gene Symbol Unigene Name Score Gene ID Difference (%) Probe sets higher expressed in post‐transplant biopsies in paired analysis (N=1871) 218870_at 55843 ARHGAP15 Rho GTPase activating protein 15 7,01 3,99 0,00 205304_s_at 3764 KCNJ8 potassium inwardly‐rectifying channel, subfamily J, member 8 6,30 4,50 0,00 1563649_at ‐‐ ‐‐ ‐‐ 6,24 3,51 0,00 1567913_at 541466 CT45‐1 cancer/testis antigen CT45‐1 5,90 4,21 0,00 203932_at 3109 HLA‐DMB major histocompatibility complex, class II, DM beta 5,83 3,20 0,00 204606_at 6366 CCL21 chemokine (C‐C motif) ligand 21 5,82 10,42 0,00 205898_at 1524 CX3CR1 chemokine (C‐X3‐C motif) receptor 1 5,74 8,50 0,00 205303_at 3764 KCNJ8 potassium inwardly‐rectifying channel, subfamily J, member 8 5,68 6,87 0,00 226841_at 219972 MPEG1 macrophage expressed gene 1 5,59 3,76 0,00 203923_s_at 1536 CYBB cytochrome b‐245, beta polypeptide (chronic granulomatous disease) 5,58 4,70 0,00 210135_s_at 6474 SHOX2 short stature homeobox 2 5,53 5,58 0,00 1562642_at ‐‐ ‐‐ ‐‐ 5,42 5,03 0,00 242605_at 1634 DCN decorin 5,23 3,92 0,00 228750_at ‐‐ ‐‐ ‐‐ 5,21 7,22 0,00 collagen, type III, alpha 1 (Ehlers‐Danlos syndrome type IV, autosomal 201852_x_at 1281 COL3A1 dominant) 5,10 8,46 0,00 3493///3 IGHA1///IGHA immunoglobulin heavy constant alpha 1///immunoglobulin heavy 217022_s_at 494 2 constant alpha 2 (A2m marker) 5,07 9,53 0,00 1 202311_s_at
    [Show full text]