Rabbit Anti-SPATA2L/FITC Conjugated Antibody-SL17629R
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name spermatogenesis-associated protein 2 Gene Symbol Spata2 Organism Rat Gene Summary Sertoli cell mRNA expression is induced by FSH; may play a role in spermatogenesis; localized to the nucleus Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.201291 Ensembl Gene ID ENSRNOG00000009207 Entrez Gene ID 114210 Assay Information Unique Assay ID qRnoCEP0030238 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000012604 Amplicon Context Sequence ACTTCCGGAATAAGTCATCCTTGTACTTCGTATCCATTGAACTGGGCTTCCCCAA ATCAAACCCAAGGGCTACCTCATCTCCCCCATGGCTCTGGGGCTGGAGGCTGG CACATCACATGAAGAACTGGCATGGTGCCCATGGACCAGC Amplicon Length (bp) 118 Chromosome Location 3:170384245-170384392 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9996 cDNA Cq 23.47 cDNA Tm (Celsius) 85 gDNA Cq 25.95 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Spata2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. -
List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0 -
Genetics of Amyotrophic Lateral Sclerosis in the Han Chinese
Genetics of amyotrophic lateral sclerosis in the Han Chinese Ji He A thesis submitted for the degree of Master of Philosophy at The University of Queensland in 2015 The University of Queensland Diamantina Institute 1 Abstract Amyotrophic lateral sclerosis is the most frequently occurring neuromuscular degenerative disorders, and has an obscure aetiology. Whilst major progress has been made, the majority of the genetic variation involved in ALS is, as yet, undefined. In this thesis, multiple genetic studies have been conducted to advance our understanding of the genetic architecture of the disease. In the light of the paucity of comprehensive genetic studies performed in Chinese, the presented study focused on advancing our current understanding in genetics of ALS in the Han Chinese population. To identify genetic variants altering risk of ALS, a genome-wide association study (GWAS) was performed. The study included 1,324 Chinese ALS cases and 3,115 controls. After quality control, a number of analyses were performed in a cleaned dataset of 1,243 cases and 2,854 controls that included: a genome-wide association analysis to identify SNPs associated with ALS; a genomic restricted maximum likelihood (GREML) analysis to estimate the proportion of the phenotypic variance in ALS liability due to common SNPs; and a gene- based analysis to identify genes associated with ALS. There were no genome-wide significant SNPs or genes associated with ALS. However, it was estimated that 17% (SE: 0.05; P=6×10-5) of the phenotypic variance in ALS liability was due to common SNPs. The top associated SNP was within GNAS (rs4812037; p =7×10-7). -
Mouse Spata2 Conditional Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Spata2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Spata2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Spata2 gene (NCBI Reference Sequence: NM_170756 ; Ensembl: ENSMUSG00000047030 ) is located on Mouse chromosome 2. 3 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 3 (Transcript: ENSMUST00000057627). Exon 2~3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Spata2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-144E24 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous knockout leads to small testes, oligospermia, asthenozoospermia, reduced male fertility and decreased male germ cell numbers. It also affects necroptosis and increases inflammatory responses. Exon 2~3 covers 100.0% of the coding region. Start codon is in exon 2, and stop codon is in exon 3. The size of intron 1 for 5'-loxP site insertion: 7165 bp. The size of effective cKO region: ~2396 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele T A 5' gRNA region G 3' 1 2 3 Targeting vector T A G Targeted allele T A G Constitutive KO allele (After Cre recombination) Legends Exon of mouse Spata2 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Genome-Wide Pooling Approach Identifies SPATA5 As a New Susceptibility Locus for Alopecia Areata Regina C
Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata Regina C. Betz, Lina M. Forstbauer, Felix F. Brockschmidt, Valentina Moskvina, Christine Herold, Silke Redler, Alexandra Herzog, Axel M. Hillmer, Christian Meesters, Stefanie Heilmann, et al. To cite this version: Regina C. Betz, Lina M. Forstbauer, Felix F. Brockschmidt, Valentina Moskvina, Christine Herold, et al.. Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for alopecia areata. European Journal of Human Genetics, Nature Publishing Group, 2011, 10.1038/ejhg.2011.185. hal- 00691329 HAL Id: hal-00691329 https://hal.archives-ouvertes.fr/hal-00691329 Submitted on 26 Apr 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Genome-wide pooling approach identifies SPATA5 as a new susceptibility locus for 2 alopecia areata 3 4 Lina M. Forstbauer1*, Felix F. Brockschmidt1,2*, Valentina Moskvina3, Christine 5 Herold4, Silke Redler1, Alexandra Herzog1, Axel M. Hillmer5, Christian Meesters4,6, 6 Stefanie Heilmann1,2, Florian Albert1, Margrieta Alblas1,2, Sandra Hanneken7, Sibylle 7 Eigelshoven7, Kathrin A. Giehl8, Dagny Jagielska1,9, Ulrike Blume-Peytavi9, Natalie 8 Garcia Bartels9, Jennifer Kuhn10,11,12, Hans Christian Hennies10,11,12, Matthias 9 Goebeler13, Andreas Jung13, Wiebke K. -
HHS Public Access Author Manuscript
HHS Public Access Author manuscript Author Manuscript Author ManuscriptJAMA Psychiatry Author Manuscript. Author Author Manuscript manuscript; available in PMC 2015 August 03. Published in final edited form as: JAMA Psychiatry. 2014 June ; 71(6): 657–664. doi:10.1001/jamapsychiatry.2014.176. Identification of Pathways for Bipolar Disorder A Meta-analysis John I. Nurnberger Jr, MD, PhD, Daniel L. Koller, PhD, Jeesun Jung, PhD, Howard J. Edenberg, PhD, Tatiana Foroud, PhD, Ilaria Guella, PhD, Marquis P. Vawter, PhD, and John R. Kelsoe, MD for the Psychiatric Genomics Consortium Bipolar Group Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis (Nurnberger, Koller, Edenberg, Foroud); Institute of Psychiatric Research, Department of Psychiatry, Indiana University School of Medicine, Indianapolis (Nurnberger, Foroud); Laboratory of Neurogenetics, National Institute on Alcohol Abuse and Alcoholism Intramural Research Program, Bethesda, Maryland (Jung); Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis (Edenberg); Functional Genomics Laboratory, Department of Psychiatry and Human Behavior, School of Medicine, University of California, Irvine (Guella, Vawter); Department of Psychiatry, School of Medicine, Corresponding Author: John I. Nurnberger Jr, MD, PhD, Institute of Psychiatric Research, Department of Psychiatry, Indiana University School of Medicine, 791 Union Dr, Indianapolis, IN 46202 ([email protected]). Author Contributions: Drs Koller and Vawter had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Nurnberger, Koller, Edenberg, Vawter. Acquisition, analysis, or interpretation of data: All authors. Drafting of the manuscript: Nurnberger, Koller, Jung, Vawter. -
Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation. -
Downloaded from Ftp://Ftp.Uniprot.Org/ on July 3, 2019) Using Maxquant (V1.6.10.43) Search Algorithm
bioRxiv preprint doi: https://doi.org/10.1101/2020.11.17.385096; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The proteomic landscape of resting and activated CD4+ T cells reveal insights into cell differentiation and function Yashwanth Subbannayya1, Markus Haug1, Sneha M. Pinto1, Varshasnata Mohanty2, Hany Zakaria Meås1, Trude Helen Flo1, T.S. Keshava Prasad2 and Richard K. Kandasamy1,* 1Centre of Molecular Inflammation Research (CEMIR), and Department of Clinical and Molecular Medicine (IKOM), Norwegian University of Science and Technology, N-7491 Trondheim, Norway 2Center for Systems Biology and Molecular Medicine, Yenepoya (Deemed to be University), Mangalore, India *Correspondence to: Professor Richard Kumaran Kandasamy Norwegian University of Science and Technology (NTNU) Centre of Molecular Inflammation Research (CEMIR) PO Box 8905 MTFS Trondheim 7491 Norway E-mail: [email protected] (Kandasamy R K) Tel.: +47-7282-4511 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.17.385096; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract CD4+ T cells (T helper cells) are cytokine-producing adaptive immune cells that activate or regulate the responses of various immune cells. -
The DNA Sequence and Comparative Analysis of Human Chromosome 20
articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M. -
Genome-Wide Association Analysis in Asthma Subjects Identifies PS ATS2L As a Novel Bronchodilator Response Gene Robert C
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2013 Genome-wide association analysis in asthma subjects identifies PS ATS2L as a novel bronchodilator response gene Robert C. Strunk Washington University School of Medicine in St. Louis et al Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Strunk, Robert C. and et al, ,"Genome-wide association analysis in asthma subjects identifies SPATS2L as a novel bronchodilator response gene." PLoS Genetics.,. e1002824. (2013). https://digitalcommons.wustl.edu/open_access_pubs/1502 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Genome-Wide Association Analysis in Asthma Subjects Identifies SPATS2L as a Novel Bronchodilator Response Gene Blanca E. Himes1,2,3*, Xiaofeng Jiang4, Ruoxi Hu4, Ann C. Wu5, Jessica A. Lasky-Su1, Barbara J. Klanderman3, John Ziniti1, Jody Senter-Sylvia1, John J. Lima6, Charles G. Irvin7, Stephen P. Peters8, Deborah A. Meyers8, Eugene R. Bleecker8, Michiaki Kubo9, Mayumi Tamari9, Yusuke Nakamura10, Stanley J. Szefler11, Robert F. Lemanske Jr.12, Robert S. Zeiger13, Robert C. Strunk14, Fernando D. Martinez15, John P. Hanrahan16, Gerard H. Koppelman17, Dirkje S. Postma18, Maartje A. E. Nieuwenhuis18, Judith M. Vonk19, Reynold A. Panettieri Jr.20, Amy Markezich21,