First Morphological and Molecular Report of Aphelenchoides Blastophthorus on Strawberry Plants in Switzerland
Total Page：16
File Type：pdf, Size：1020Kb
Plant Disease • XXXX • XXX:X-X • https://doi.org/10.1094/PDIS-07-18-1241-RE First Morphological and Molecular Report of Aphelenchoides blastophthorus on Strawberry Plants in Switzerland Erika Consoli,1 Andrea C. Ruthes,2 Eder Reinhard,1 and Paul Dahlin1,† 1 Agroscope, Research Division Plant Protection, Phytopathology and Zoology in Fruit and Vegetable Production, Wadenswil,¨ Switzerland 2 Independent Researcher, Wadenswil,¨ Switzerland Abstract Foliar nematodes represent a minor feeding group within the genus Aphe- barcoding of 18S ribosomal RNA (18S), 28S ribosomal RNA (28S), lenchoides Fischer, 1894. The facultative plant parasitic species A. blas- and cytochrome c oxidase I (COI) gene fragment analyses. Phylogenetic tophthorus can cause crinkling of leaves, reduced vigor, and stunting of analysis of 18S indicated that A. blastophthorus was grouped within agricultural and ornamental plants. Here we report the first finding of A. close distance to A. fragariae, a well-known foliar nematode affecting blastophthorus in leaves, crowns, and roots of strawberry plants collected strawberry plants. Furthermore, the newly generated molecular barcodes in Switzerland in 2018. Species identification was confirmed by morpho- of the partial 28S and COI of A. blastophthorus will support species iden- logical and morphometric characterization supported by molecular tification in the future. The genus Aphelenchoides is found worldwide and is commonly 2015). Symptoms attributable to the presence of A. blastophthorus known to comprise fungal-feeding nematodes (Hunt 1993). None- in Norwegian strawberries were reported in 1972, 1987, and 2000 theless, a few Aphelenchoides spp. are known to also feed on but investigations documented a negative effect on strawberry leaves, sprouts, or buds of plants (Hunt 1993; Sanchez-Monge´ yields and runner production only in 2000 (Haukeland and Brekke et al. 2015). These facultative plant parasitic nematodes can cause 2000; Støen 1987). Although A. blastophthorus is widespread on severe crinkling of leaves, reduced vigor, and stunting of plants. strawberry, it has not yet been reported in Switzerland. Here, we These so-called foliar, leaf, or bud nematodes are migratory ecto- provide the first report of A. blastophthorus isolated from straw- and endoparasites that reproduce sexually (Chanu et al. 2015; berry (Fragaria × ananassa) in Switzerland. Hooper 1975; Hunt 1993). Under optimal conditions, their life cy- cle takes approximately 2 weeks depending on temperature, hu- Materials and Methods midity, and other environmental factors (Hooper 1975; Hunt This study examined Fragaria × ananassa ‘Darselect and Kim- 1993). In humid and warm conditions, these nematodes travel in berley’ in Switzerland. water films on plant surfaces and finally enter leaf tissue, stomata, Nematode isolation and culture. Live specimens were collected and plant axes for feeding and reproduction (Jagdale and Grewal from strawberry leaves, crowns, and roots during the early growth 2006; Wallace 1959). Ornamental and agricultural plants are hosts season. Cut plant material was placed in water for 12 h, followed for foliar nematodes such as A. fragariae (Ritzema Bos, 1890) by sieving in a 20-mm sieve. Specimens were picked under a light Christie, 1932 (Christie 1932); A. besseyi Christie, 1942 (Christie microscope for culturing on Botrytis cinerea and for morphological 1942); A. ritzemabosi (Schwartz, 1911) Steiner & Buhrer, 1932 and molecular analysis. Approximately 10 female and 10 male spec- (Steiner and Buhrer 1932); A. blastophthorus Franklin, 1952; imens were placed on B. cinerea plates, grown on potato dextrose and a few other species (Hunt 1993; Sanchez-Monge´ et al. agar medium, and kept in the dark at 20°C. 2015). Early detection of foliar nematodes is challenging because Fixation and morphological observation. For morphological Aphelenchoides spp. can survive in dry plant materials and seeds observations, specimens were heat-killed and directly mounted on for numerous years and symptoms can take weeks or months to ap- temporary slides using water. Permanent slides for higher resolution pear on plants (Browne et al. 2004; Jagdale and Grewal 2006; of particular nematode structures were prepared according to De McCuiston et al. 2007). A. fragariae, A. besseyi,andA. ritzema- Grisse (1969). Briefly, heat-relaxed nematodes were treated with a bosi are found globally, causing severe plant damage on important 4% paraformaldehyde solution and then transferred to anhydrous agronomic crops (Sanchez-Monge´ et al. 2015). In 1952, Mary T. glycerine. Images were taken with a Zeiss AXIO Imager Z1 optical Franklin reported a disease on Scabiosa caucasica causedbyan microscope (Zeiss, Oberkochen, Germany) equipped with a Zeiss Aphelenchoides sp. that was described as A. blastophthorus AxioCam MRm camera. Final morphometric measurements were (Franklin 1952). Until now, this species was found in various plant recorded using the ZEN Pro program (2012; Zeiss). families such as Begoniaceae, Ranunculaceae, Asparagaceae, Molecular and phylogenetic analysis. DNA was extracted from a Rosaceae, Violaceae, and Caprifoliaceae (Sanchez-Monge´ et al. single nematode specimen using the modified method of Kawasaki de- scribed in Frey and Frey (1995) and Holterman et al. (2012). Partial 18S ribosomal RNA (18S), 28S ribosomal RNA (28S), and cytochrome c † Corresponding author: P. Dahlin; [email protected] oxidase I (COI) gene fragments were obtained by PCR. The first 18S fragment was amplified using primers 988F (CTCAAAGATTAAGC- *The e-Xtra logo stands for “electronic extra” and indicates that five supple- CATGC) and 1912R (TTTACGGTCAGAACTAGGG) selected from mentary figures are published online. Holterman et al. (2006). The second 18S fragment was used to extend the sequence downstream, with the modified forward primer 1096F The author(s) declare no conflict of interest. (GGTAATTCTGGAGCCAATAC; Holterman et al. 2006) in combi- Accepted for publication 21 May 2019. nation with a newly designed reverse primer Aph3004R (GCATT- TACTTGGAATTCCTC). The 28S fragment was amplified using the primer combinations 28-81for (TTAAGCATATCATTTAGCG- © 2019 The American Phytopathological Society GAGGAA) and 28-1006rev (GTTCGATTAGTCTTTCGCCCCT; 1 Holterman et al. 2008). The COI fragment was amplified using the Measurements of A. blastophthorus isolated from strawberries are primer pairs COI-F1 (CCTACTATGATTGGTGGTTTTGGTAATTG) shown in Table 1. and COI-R2 (GTAGCAGCAGTAAAATAAGCACG; Kanzaki and Females. The ~710-mm-long elongated body is slightly curved on Futai 2002). the ventral side when heat relaxed. The lip region is offset and ap- The 18S, 28S, and COI PCRs were carried out with the HotStart- proximately double as wide as high. The cuticle is finely annulated Taq Master Mix Kit (Qiagen, Hilden, Germany) in the SensoQuest with a lateral field with four incisures stretching about one-seventh Labcycler (SensoQuest, Gottingen,¨ Germany). The 20-ml reaction of the midbody (Fig. 1; Table 1). The conical tail, ending in a single contained the following: 10 ml of HotStarTaq Master Mix plus mucro, is approximately four anal body widths long. The stylet with 0.5 ml of each primer (final concentration, 0.4 mM), 1 ml of template its distinct basal knobs is 12.9 ± 0.5 mm long (Table 1). The pharynx DNA, and 8 ml of molecular-grade water. The PCR program for both has a strong median bulb with a well-developed valve and a short 18S and 28S was first set at 95°C for 5 min for the initial denatur- isthmus surrounded by the nerve ring just anterior to the pharyngoin- ation step, followed by five cycles of 95°C for 30 s, annealing at testinal junction and dorsally overlapping pharyngeal glands. The 45°C for 30 s, and extension at 72°C for 30 s. This first amplification nerve ring is located over one bulb length posterior to the median step was followed by 45 cycles of denaturation at 95°C for 30 s, bulb (approximately four body widths long). The monoprodelphic annealing at 54°C for 30 s, and extension at 72°C for 30 s, with a final reproductive system has an outstretched ovary with oocytes arranged elongation step at 72°C for 5 min (Holterman et al. 2006). COI was in a single row. A postvulval sac extends approximately half-way to amplified following Kanzaki and Futai (2002). Amplified PCR two-thirds of the vulva-anus distance. The vulva is located at ~68% fragments were purified with the NucleoFast 96 PCR Clean-up of the total body length. Kit (Macherey-Nagel, Duren,¨ Germany) and sequenced using Ap- Males. Males have similar morphological structures as females, plied Biosystems Hitachi 3130xl Genetic Analyzers (Applied Bio- aside from reproductive system and caudal region. With a body systems, Foster City, CA). length of ~660 mm, males are shorter on average than females, even Original partial sequences of 18S, 28S, and COI were BLASTed though the longest measured individual in this study (847 mm) was against the NCBI database and aligned with selected published ho- male. Contrary to females, the tail of males is ventrally curled by mologous gene sequences of Aphelenchoides spp. using the Genei- 90° or more. Similar to females, the tail carries a simple mucro. ous R11 program (Kearse et al. 2012). The 20.6 ± 1.3 mm spicula are curved ventrally and rose thorn shaped For phylogenetic analysis, 79 nucleotide sequences of 18S, 32 se- with a moderately developed apex and rostrum. The male posterior quences of COI, and 50 sequences of 28S were aligned using the end presents three caudal