Aquagene 22.09.10 07:08 Seite 3

Total Page:16

File Type:pdf, Size:1020Kb

Aquagene 22.09.10 07:08 Seite 3 Hagen_Aquagene 22.09.10 07:08 Seite 3 CORD HAGEN AQUAGENE Thriller WILHELM HEYNE VERLAG MÜNCHEN Hagen_Aquagene 22.09.10 07:08 Seite 2 DAS BUCH Drohende Vorzeichen: In China versammeln sich unheimliche »Regenhäute« auf dem größten Staudamm der Erde, auf Grön- land beschwören Schamanen der Inuit die Rückkehr der Meeres- göttin. Und während Europa im Hochwasser versinkt, planen die Großmächte den arktischen Krieg, denn es geht um die letz- ten Erdölreserven der Erde. Als der Hydrotechniker Brandel auf der Bohrinsel Devon III im grönländischen Scoresbysund ein- trifft, wird er von den Ereignissen überrollt. Auch die polizeilich gesuchte Umweltaktivistin Jenna Resch weiß nicht, was sie auf Grönland erwartet. Als sie an der Ostküste landet, führt sie ihr Weg mitten hinein in einen arktischen Krieg, in dem rebellische Inuit gegen Söldner der Erdölindustrie kämpfen. Zusammen mit Glenner, einem amerikanischen Globetrotter, stößt Jenna auf finanzstarke Sektierer, die den steigenden Meeresspiegel als evolutionäre Chance begreifen. Doch welche Ziele verfolgt die- ser »Devonische Zirkel« wirklich, und welche Gene braucht der Mensch, um in einer Wasserwelt zu überleben? Ein radikaler Ökothriller über die Folgen des Klimawandels und den Kampf um die letzten Erdölreserven. DER AUTOR Cord Hagen, geboren 1963, ist das Pseudonym eines bekannten deutschen Bestsellerautors. Er hat neben Romanen auch Dreh - bücher, Hörspiele, Erzählungen und poetische Reportagen ge- schrieben. Cord Hagen lebt in Berlin und auf der Kanareninsel La Palma, auf der sein erster Öko-Thriller Der Schlund spielt. LIEFERBARE TITEL Der Schlund Hagen_Aquagene 22.09.10 07:08 Seite 5 Ich glaube an die friedliche Koexistenz von Menschen und Fischen. – GEORGE W. B USH, 43. Präsident der USA Der zornige Gott Jubmel aber sprach: Ich werde die Welt umdrehen. Ich werde den Flüssen gebieten, bergauf zu fließen; ich werde das Meer heißen, sich zusammenzuraffen zu einer riesenhoch aufragenden Mauer, um sie auf euch verderbte Erdenkinder zu schleudern und euch zu vernichten. – Aus LAPPLANDS WELTSCHÖPFUNGSEPOS, übersetzt von Léonne de Cambrey, 1926 Hagen_Aquagene 22.09.10 07:08 Seite 7 1. Teil Wasserbabys Wenn man einen Sumpf trockenlegen will, darf man damit nicht die Frösche beauftragen. – MARK TWAIN Hagen_Aquagene 22.09.10 07:08 Seite 8 Darstellung der Entwicklungsreihe des Frosches zum Menschen aus dem Jahre 1832. Quelle: C. F. Meisner: De amphibiorum quorundam papil- lis glandulisque femorabilus, Basel, Schweighauser, 1832. Hagen_Aquagene 22.09.10 07:08 Seite 9 CGTCCCAGGGTATTCCCCATGCTTCCGACTTAGTATTCCCCA ACCGGGTAAGGGT VORZEICHENVORZEICHEN AGGACGGAGTAC CTTCCATCGGGGTATTCCAACCCAGCTTCTCATCGGGGTATT Qui vivra, verra. Die Zukunft wird es zeigen. – FRANZÖSISCHES SPRICHWORT Kulusuk, Ostgrönland, März 1982 »Alarm! Los, los, alle Mann raus aus den Kojen! Wir haben eine Situation!« Die verzerrte Stimme aus den Deckenlautsprechern passte so gar nicht zu Reynar Frithjof, dem Chef der Rettungszentrale des Heliports Kulusuk, der an diesem Abend direkt an einer Schlechtwetterfront lag. Schon als der leuchtende Punkt der immer tiefer fliegenden Cessna von den Radarschirmen verschwand, wusste Frithjof, der ruhige Abend bei Rentiergulasch und herbem »Viking«-Bier war fürs Erste gelaufen. Trotz vager Angaben über die Absturzstelle – sie lag dicht vor der Küste in grönländischen Hoheitsgewässern –, hatte er sich entschieden, sofort einen Heli zu schicken. »Der Pilot hat ein SOS absetzen können«, meldete Brynjar, der wachhabende Offizier, »bei der Wassertemperatur ist es aller - dings fraglich, ob es Überlebende gibt.« 9 Hagen_Aquagene 22.09.10 07:08 Seite 10 »Das werden wir sehen«, sagte Frithjof. Es war ohnehin seine Aufgabe, bis zuletzt an die Rettung der Verunglückten zu glau- ben, aber diesmal kam noch etwas dazu: Die Maschine gehörte einem gewissen Paulino Hernando Pesceros, seines Zeichens Öl- baron, Großaktionär und neuerdings auch Regierungsberater. Der gebürtige Kolumbianer gehörte zu den als »unabkömmlich« eingestuften Personen des dänischen Königreichs. Frithjof war geradezu in der Pflicht, denn der Milliardär und seine Familie waren persönlich an Bord des Unglücksvogels gewesen. »So ein Mist …« Das Gewitter, das sich draußen zusammen- gebraut hatte, drückte seine hässliche, von Blitzen vernarbte Visage gegen die Panzerglasscheibe und vergegenwärtigte dem Rettungschef, dass er diesmal seine besten Männer aufbieten musste. »Verdammt, Reynar, das ist ein Fall für die Küstenwache! Die sollen ein Boot schicken und die Leute aus dem Wasser fischen!« Wenn man vom Teufel spricht, dachte Frithjof. Der Mann, der in diesem Moment in die Einsatzzentrale polterte, hörte auf den Namen Sig Bendikson. Er hatte den klassischen Werdegang eines Helipiloten durchlaufen – erst Mechanikerlehre, dann Helikoptermonteur bei der Luftwaffe, ein Job, der es ihm später ermöglicht hatte, die Pilotenlaufbahn einzuschlagen. Inzwischen galt er als Ass des Luftrettungsdienstes und »größter Hubschrau- berpilot« Skandinaviens – ein spitzfindiger Nörgler am Boden, doch einmal in der Luft unschlagbar, wenn es darum ging, Men- schenleben zu retten. So wie damals – Frithjof erinnerte sich – an der Südspitze Grönlands, als Bendikson seine Maschine über einen eingenebelten Gletscher dirigiert und dann – wegen be- schlagener Scheiben – halb aus dem Fenster hängend, Proviant und Verbandszeug abgeworfen hatte. Auch dass er einmal dreißig Schiffbrüchige in einer leckenden Rettungsinsel am Seil in den 10 Hagen_Aquagene 22.09.10 07:08 Seite 11 Hafen eingeschleppt hatte, war Frithjof noch lebhaft in Erinne- rung geblieben. »Nun, halt mal die Luft an«, knurrte Frithjof. »Glaubst du, ich würde dich da rausjagen, wenn ich eine Wahl hätte? Wo der Vogel abgestürzt ist, wimmelt es von Klippen … Das Skagerrak ist ein Dreck dagegen! Du bist meine einzige Chance. Tut mir leid, alter Schwede.« »Und mir erst!« Bendikson raufte sich seine grauen Stoppel- haare, aber dann marschierte er ab, ganz so wie es Frithjof von ihm gewohnt war. Ein Expresslift bracht Bendikson aus der Tiefe des Berges hinauf zur Landplattform des Heliports. Im Hangar, der wie eine wür- felförmige Festung an der Steilküste klebte, war der Copter, ein nagelneuer US-Coast-Guard-»HH 65A«, schon betankt und startklar. Sein frisch eingewachster Rumpf funkelte im Licht der Scheinwerfer. Zwei AVCO-Lycoming-Triebwerke mit jeweils sie- benhundertunddreißig Pferdestärken verliehen dem auch »Polar- Heli« genannten Hubschrauber die nötige Kraft, auch bei orkan- artigem Wetter zu fliegen. Der Weg über die beleuchtete fünf mal fünf Meter messende Plattform erschien Bendikson diesmal länger als sonst. Ohne zu grüßen, schwang er sich in den Sitz, schnallte sich an. »Vergesst mir die Wärmflaschen nicht«, war das Einzige, was er sagte, und Gunnar Steinkehl, der Flughelfer nickte. Auch die Thermodecken gehörten zum Vorbereitungsmaterial auf der Liste, die er täglich gewissenhaft checkte. Sollte es ihnen gelin- gen, Menschen aus Seenot zu bergen, dann war die Wiederbele- bung durch Wärme die Medizin, die sofort anschlug, um den Kreislauf zu stabilisieren. Als Piloten brauchte man Flughelfer wie Gunnar, die an alles dachten und im Laufe ihrer Dienstzeit 11 Hagen_Aquagene 22.09.10 07:08 Seite 12 ein fast kybernetisches Verhältnis mit der Maschine eingingen. Sie verbreiteten das Gefühl von Sicherheit. Nicht zuletzt saßen sie im selben »fliegenden Boot«, das sie in Technikkursen immer wieder auseinandergenommen und zusammengesetzt hatten. Der junge Blondschopf neben Gunnar hieß Enok Jensen, er war Marine-Rettungstaucher, doch was echte Einsätze anbelang- te noch ein unbeschriebenes Blatt. Beim Winschen hatte er sich schon ein paar Mal bewährt, doch dieser Einsatz war seine Feuer - taufe, und er machte einen etwas in sich gekehrten Eindruck. Der vierte an Bord hieß mit vollem Namen Hanak Amaalik Innunguaq, doch wurde er von allen – wegen seiner Neigung zu Alleingängen – spöttisch Han Solo genannt. Er kauerte in seinem Kaltwasseranzug hinter Gunnar auf dem Rettungsmaterial, den Notfallsack und sein Schwimmbrett zwischen die Beine ge- klemmt. Han war ein gebürtiger Inuit, der seinen Weg aus einem kleinen Dorf namens Brandeliteqilaq in die westliche Zi- vilisation gemacht hatte. Seine bärenhafte Statur trat in dem hautengen Anzug deutlich hervor. Zu seinem Phlegma gehörte die typische Gutmütigkeit der Inuit, vermischt mit einer Prise schwarzen Humors. Abgesehen von seinem Job hatte er nur ein einziges Hobby – die Robbenjagd , die sein Clan, die kukiit inui oder Claw People, bereits seit über zweihundert Jahren in Ost- grönland betrieb. Ein einziges Mal war Bendikson einer Ein - ladung von Han gefolgt und dabei Zeuge eines Tupilak-Rituals der Jäger geworden. Das Christentum hatte auf Grönland schon lange verspielt, selbst in Nuuk, der Hauptstadt, war man längst wieder zur alten naturheidnischen Religion zurückgekehrt. Be- sonders die Jüngeren beteten wieder zu dem Mondgott Igaluk, der diejenigen, die ein sinnvolles Leben gelebt hatten, ins Qud- livun, dem Paradies der Eskimos, heimführen würde. Er war auch der Gott der Liebe, der Gott der Lampenlöschspiele. 12 Hagen_Aquagene 22.09.10 07:08 Seite 13 Han gehörte zu einem anderen Kult, einem Kult, der die See- göttin Sedna wie die Heilige Jungfrau Maria verehrte. Die Zere- monie, der Bendikson beiwohnen sollte, hatte sich auf dem of- fenen Eis abgespielt, an einem großen Luftloch, in dem die See schmatzte und gurgelte. Ein Schamane versuchte die frosch- mäulige, gefräßige Göttin vom Meeresgrund an die Oberfläche zu locken, in dem er – Robbengekröse mit einer
Recommended publications
  • Cosmology and Shamanism and Shamanism INTERVIEWING INUIT ELDERS
    6507.3 Eng Cover w/spine/bleed 5/1/06 9:23 AM Page 1 INTERVIEWINGCosmology INUIT ELDERS and Shamanism Cosmology and Shamanism INTERVIEWING INUIT ELDERS Mariano and Tulimaaq Aupilaarjuk, Lucassie Nutaraaluk, Rose Iqallijuq, Johanasi Ujarak, Isidore Ijituuq and Michel Kupaaq 4 Edited by Bernard Saladin d’Anglure 6507.5_Fre 5/1/06 9:11 AM Page 239 6507.3 English Vol.4 5/1/06 9:21 AM Page 1 INTERVIEWING INUIT ELDERS Volume 4 Cosmology and Shamanism Mariano and Tulimaaq Aupilaarjuk, Lucassie Nutaraaluk, Rose Iqallijuq, Johanasi Ujarak, Isidore Ijituuq and Michel Kupaaq Edited by Bernard Saladin d’Anglure 6507.3 English Vol.4 5/1/06 9:21 AM Page 2 Interviewing Inuit Elders Volume 4 Cosmology and Shamanism Copyright © 2001 Nunavut Arctic College, Mariano and Tulimaaq Aupilaarjuk, Bernard Saladin d’Anglure and participating students Susan Enuaraq, Aaju Peter, Bernice Kootoo, Nancy Kisa, Julia Saimayuq, Jeannie Shaimayuk, Mathieu Boki, Kim Kangok, Vera Arnatsiaq, Myna Ishulutak, and Johnny Kopak. Photos courtesy Bernard Saladin d’Anglure; Frédéric Laugrand; Alexina Kublu; Mystic Seaport Museum. Louise Ujarak; John MacDonald; Bryan Alexander. Illustrations courtesy Terry Ryan in Blodgett, ed. “North Baffin Drawings,” Art Gallery of Ontario; 1923 photo of Urulu, Fifth Thule Expedition. Cover illustration “Man and Animals” by Lydia Jaypoody. Design and production by Nortext (Iqaluit). All rights reserved. The use of any part of this publication, reproduced, transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, or stored in a retrieval system, without written consent of the publisher is an infringement of the copyright law. ISBN 1-896-204-384 Published by the Language and Culture Program of Nunavut Arctic College, Iqaluit, Nunavut with the generous support of the Pairijait Tigummivik Elders Society.
    [Show full text]
  • Cahier D'accompagnement Pédagogique
    Cahier d’accompagnement pédagogique Ce cahier vous propose des activités de préparation et de suivi pour la pièce Noyade(s) de Samsara Théâtre. Table des matières Genèse d’un projet p.3 Créer à deux voix p.4 Les mythes fondateurs p.5 Le mythe de Sedna p.6 Le Sedna IV p.7 Le mythe de Narcisse p.8 Narcissisme et psychanalyse p.9 Le lycanthrope et la meute p.10 Devenir homme, devenir femme p.11 L’identité virtuelle p.12 L’intimidation p.13 Activités pour aller plus loin p.14 Annexe : fiche de personnage p.15 Crédits et remerciements p.16 Équipe du spectacle NOYADE(S) Texte et mise en scène : Jean-François Guilbeault et Andréanne Joubert Conseillère dramatique : Rébecca Déraspe Interprétation : Anne Trudel, Alex Trahan et Marc-André Poliquin, avec la collaboration de Cassandre Émanuel Concepteurs : Mathieu Doyon, Jean-François Pedneault, Joëlle Péloquin, Gabrielle Bossé-Beal et Julie Brosseau-Doré Équipe technique : Émilie Boyer-Beaulieu, Mélissa Perron, Joëlle Tougas, Mathieu Doyon, Radhanatha Gagnon/Art Partage, Anne-Marie Boucher Noyade(s) Noyade(s) : Genèse d’un projet Elle et lui naviguent entre la réalité et leur connexion Relecture contemporaine de mythes anciens, le internet. spectacle a pour trame de fond l'omniprésence des réseaux sociaux. Les auteurs ont voulu aborder par Il semble être un bon garçon, sociable et heureux. Mais cette histoire les thématiques de la construction de derrière son écran d'ordinateur, il se sent prisonnier de l'identité et de la prise de parole, notion délicate à l'image parfaite qu'il projette.
    [Show full text]
  • Arctic Journeys, Ancient Memories : Sculpture
    NB 249 .A,75 A4 2012 ANTH ■DLUI|JIUIC by Abraham Anghik Ruben Arctic Journeys Arctic Journeys Ancient Memories The Arctic Studies Center National Museum of Natural History National Museum of the American Indian Smithsonian Institution Kipling Gallery Published by ARCTIC STUDIES CENTER Department of Anthropology National Museum of Natural History Smithsonian Institution PO Box 30712, MRC 1 12 Washington, D.C. 2001 3-7012 www.mnh.si.edu/arctic ISBN- 978-0-9816142-1-2 Copyright © 2012 by Arctic Studies Center Smithsonian Institution Catalogue of an exhibition organized by the Smithsonian's Arctic Studies Center with assistance from Kipling Gallery, Woodbridge, ON and presented October 4, 2012 - January 2,2013 at The National Museum of the American Indian Curated by Bernadette Driscoll Engelstad Arctic Journeys, Ancient Memories: Sculpture by Abraham Anghik Ruben was produced by Perpetua Press, Santa Barbara Edited by Letitia Burns O'Connor Designed by Dana Levy Printed in Canada by Colour Innovations Object photography by Daniel Dabrowski, Silvio Calcagno, Alan Bibby, and Ernest R Mayer Front cover: To Northwestern Shores, 2008 (Detail) Back cover: Far left: Inuvialuit Inuit Way of Life, 201 I Clockwise from top left: Celtic Monk Keeper of Light, 2007 Memories:An Ancient Past, 2010 Sedna: Life Out of Balance, 2006 Odin, 2008 Study for Shaman's Message III, 201 I Migration: Umiak with Spirit Figures, 2008 CONTENTS 7 Preface by Kevin Gover 9 Foreword by William W. Fitzhugh I 2 Artist's Statement by Abraham Anghik Ruben I 5 Arctic Journeys, Ancient Memories by Bernadette Driscoll Engelstad 32 Catalogue 83 Exhibition History 85 Bibliography 87 Acknowledgments 5 PREFACE !\ AS THE DIRECTOR OFTHE NATIONAL MUSEUM OFTHE AMERICAN INDIAN, I frequently watch as exhibitions grow out of good ideas that gather energy as they are researched and discussed, written and organized and installed.
    [Show full text]
  • The Poetry Posse
    The Year of the Poet VI June 2019 The Poetry Posse inner child press, ltd. The Poetry Posse 2019 Gail Weston Shazor Shareef Abdur Rasheed Teresa E. Gallion hülya n. yılmaz Kimberly Burnham Tzemin Ition Tsai Elizabeth Esguerra Castillo Jackie Davis Allen Joe Paire Caroline ‘Ceri’ Nazareno Ashok K. Bhargava Alicja Maria Kuberska Swapna Behera Albert ‘Infinite’ Carrasco Eliza Segiet William S. Peters, Sr. ii General Information The Year of the Poet VI June 2019 Edition The Poetry Posse 1st Edition : 2019 This Publishing is protected under Copyright Law as a “Collection”. All rights for all submissions are retained by the Individual Author and or Artist. No part of this Publishing may be Reproduced, Transferred in any manner without the prior WRITTEN CONSENT of the “Material Owners” or its Representative Inner Child Press. Any such violation infringes upon the Creative and Intellectual Property of the Owner pursuant to International and Federal Copyright Laws. Any queries pertaining to this “Collection” should be addressed to Publisher of Record. Publisher Information 1st Edition : Inner Child Press [email protected] www.innerchildpress.com This Collection is protected under U.S. and International Copyright Laws Copyright © 2019 : The Poetry Posse ISBN-13 : 978-1-970020-84-7 (inner child press, ltd.) $ 12.99 iii iv Dedication This Book is dedicated to Poetry . The Poetry Posse past, present & future our Patrons and Readers the Spirit of our Everlasting Muse & the Power of the Pen to effectuate change! v In the darkness of my life I heard the music I danced . and the Light appeared and I dance Janet P.
    [Show full text]
  • HEALTH CAFE DELIVERY in --AN INUIT SETTLE= : a STUDY of (Thflict and CCNGRLIENCE in INUIT ADAPTATICN 1D the CCSMJPOLITAN MEDICAL SYSTEM
    HEALTH CAFE DELIVERY IN --AN INUIT SETTLE= : A STUDY OF (ThFLICT AND CCNGRLIENCE IN INUIT ADAPTATICN 1D THE CCSMJPOLITAN MEDICAL SYSTEM A Thesis Submitted to the Faculty of Graduate Studies and Research in Partial Fulfillment of the Requirements For the Degree of Master of Arts in the Department of Anthropology and Archaeology by John D . O'Neil Saskatoon, Saskatchewan c 1979 . J . D . O'NEIL UNIVERSITY OF SASKATCHEWAN PERMISSION TO USE POSTGRADUATE THESES TITLE OF THESIS HPa7th(',:;nn- f, 7iT7Arijin anInuit Settlement ; A.Stndu of 1* .0 - . U . NAME OF AUTHOR John Donald O'Neil DEPARTMENT OR COLLEGE Anthronoloqu and Archaeo7oarz .7 DEGREE ' Master of Arts In presenting this thesis in partial fulfilment of the requirements for a postgraduate degree from the University of Saskatchewan, I agree that the Libraries of this University may make it freely avail- able for inspection . I further agree that permission for extensive copyingof this thesis for scholarly purposes may be granted by the professor or professors who supervised my thesis work or, in their absence, by the Head of the Department or the Dean of the College in which my thesis work was . done . It is understood that any copying or publication or use of this thesis or parts thereof for financial gain shall not be allowed without my written permission . It is also understood that due recognition shall be given to me and to the University of Saskatchewan in any scholarly use which may be made of any material in my thesis . SIGNATURE ADDRESS 31 Avenue E . North Saskatoon,9aSkatr'hF,jyan DATE June 22, 1979 .
    [Show full text]
  • The Inuit Way
    the inuit way a guide to inuit culture P RODUCED BY P AUKTUUTIT I NUIT W OMEN OF C ANADA R EVISED 2006 Xs4©t5 PAUKTUUTIT wkw5 x3Nw5 vNbu INUIT WOMEN OF CANADA FORWARD The Inuit Way has become one of the most popular and important documents Pauktuutit has produced in our twenty-two year history. With more than ten thousand copies in print, The Inuit Way has helped a broad range of Canadians gain a better understanding and appreciation of our culture. The Inuit Way is much more than a simple introduction to traditional Inuit culture. It provides the reader a starting point for understanding the cultural underpinnings of modern Inuit. As a people, we have undergone immense changes in a generation. Despite the many changes our society has encountered, we retain strong ties to the land and our traditions. People coming to the north today see Inuit taking part in many aspects of modern life— working in an office environment, watching hockey on television, shopping at local stores, making political speeches. What they may not see at first is that Inuit continue to have a strong, unique culture that guides us in our everyday life— our close ties to the land, a dedication to community and a strong sense of self-reliance. The Inuit north has changed with astonishing speed since The Inuit Way was first published in 1989. At times, the rapidity of these changes has threatened to overwhelm us. However, Inuit are known for our tenacity and ability to adapt. Today our communities are strong and vibrant.
    [Show full text]
  • Sedna and the Seal1 (An Inuit Oral Tradition)
    Sedna and the Seal1 (An Inuit Oral Tradition) Your last piece of soap stone is brought out. With eyes focused, the stone is held in hand under the flickering light of the oil lamp. It's turned this way, then that, catching the eye and the light in the contours of the stone. Who's within the stone, to be released as the stone is chipped away? Held under the flickering light . , it's her! There's no mistaking it. It's Sedna, she who lives at the bottom of the sea! And the hands become busy. With steel axe and knife, the stone covering is carefully removed from Sedna. The chips fly from and fall to the floor of the igloo. In no time, the image of Sedna is released from the soap stone and held close in hand. * * * * * The world is an empty place.... All is dark.. There is nothing, flat earth in all directions. There are no animals, no seals, no fishes, no birds. All is empty,... earth everywhere. There are two men. They are already full-grown when they came from the ground. They live together there, but it is not a very satisfactory life... With the words of a song,..2 they sing. "A human being here A penis here. May its opening be wide And roomy. 1The story text is from the Iglulik and Netsilik Inuit, two central Eskimo peoples. This account is similar to that found throughout the oral literature of all Eskimo peoples. For additional ethnographic background, see Boas 1888, Nelson 1983, Rasmussen 1929 and 1931, and Speck 1935.
    [Show full text]
  • Falta, Castigo Y Penitencia En La Religión Esquimal. La Fiesta De Las Vejigas
    pp. 13-35. Alonso de la Fuente. 6/9/04 19:40 Página 13 Falta, castigo y penitencia en la religión esquimal. La fiesta de las Vejigas José Andrés ALONSO DE LA FUENTE Universidad Complutense de Madrid [email protected] RESUMEN La cultura esquimal proporciona multitud de ejemplos que ilustran las teorías científicas del complejo mundo animista y shamánico. De hecho, tradicionalmente los esquimales han sido considerados el paradigma ideal de sociedad animista y shamánica junto a algunas otras poblaciones siberianas. Pese a que en repetidas ocasiones se ha afirmado sin tapujos que es un pueblo sin religión, los esqui- males poseen un amplísimo repertorio de rituales, ceremonias y festejos que reflejan a la perfección su profundo sentido religioso. La “fiesta de las vejigas” es uno de esos acontecimientos. Los motivos que conducen a su celebración, así como las consecuencias de no llevarlo a cabo, constituyen los tres pilares básicos de la mentalidad religiosa esquimal: la falta, el castigo y la penitencia. Palabras clave: religión esquimal, animismo, celebraciones, rituales. Fault, punishment and penitence in the Eskimo religion. The Bladder Festival ABSTRACT Eskimo culture gives us a wide range of examples which illustrate the scientific theories on the com- plex world of animism and shamanism. As a matter of fact Eskimos have been historically considered as the ideal paradigm of an animistic and shamanic society along some other peoples from Siberia. In spite of the fact that it has been normally affirmed that they are a people without religion, Eskimos have a more than wide repertoire of rituals, ceremonies and celebrations which perfectly reflect on their profound religious feelings.
    [Show full text]
  • Foundation Review of Science Fiction 121 Foundation the International Review of Science Fiction
    The InternationalFoundation Review of Science Fiction 121 Foundation The International Review of Science Fiction In this issue: Emma England introduces a special section on diversity in world sf with articles by Garfi eld Benjamin, Christopher Kastensmidt, Lejla Kucukalic, Silvia G. Kurlat Ares, Foundation Gillian Polack and Dale J. Pratt Conference reports by Fran Bigman and Andrea Dietrich, Anna McFarlane, Carolann North and Allan Weiss 44.2 No:121 2015 Vol: Andrew M. Butler investigates the meaning of fun with Eduardo Paolozzi Paul March-Russell explores Africa sf and sf now with Mark Bould and Rhys Williams In addition, there are reviews by: Chelsea Adams, Cherith Baldry, Stephen Baxter, Lucas Boulding, Bodhisattva Chat- topadhyay, Maia Clery, Iain Emsley, Richard Howard, Erik Jaccard, David Seed, Allen Stroud and Michelle K. Yost Of books by: Noga Applebaum, Jack Fennell, Paul Kincaid, Cixin Liu, James Lovegrove, William H. Patterson Jr., Joshua Raulerson, Robert Silverberg, Johanna Sinisalo, Gavin Smith, Ivo Stourton and Peter Szendy Cover image/credit: Sara Al Hazmi, from The Hijab Girl (2014). All rights reserved. Diversity in World SF Foundation is published three times a year by the Science Fiction Foundation (Registered Charity no. 1041052). It is typeset and printed by The Lavenham Press Ltd., 47 Water Street, Lavenham, Suffolk, CO10 9RD. The Foundation Essay Prize 2016 Foundation is a peer-reviewed journal. We are pleased to announce the return of our essay competition. The award is open to all post-graduate research students and to all early career researchers (up to five years Subscription rates for 2015 after the completion of your PhD) who have yet to find a full-time or tenured position.
    [Show full text]
  • Traditional Inuit Myths and Legends
    Traditional Inuit Myths and Legends What are Inuit Traditional Stories? ᐊᐃᖓᐃ, ᑕᐃᔅᓱᒪᓂ ᓱᕈᓯᐅᑎᓪᓗᑕ ᐅᓂᒃᑳᖅᑐᐊᕐᕕᐅᕙᓚᐅᖅᓯᒪᒐᑦᑕ Inuit traditional stories have been passed on from person ᐃᓕᓐᓂᐊᕐᕕᒃᑯᑎᒍᑦ. ᐃᓐᓇᐃᑦ ᐃᓕᓐᓂᐊᕐᕕᓕᐊᖅᑎᑕᐅᕙᒃᑐᑎᒃ to person for generations in the Arctic. These stories are ᐊᖏᕐᕋᖏᓐᓄᓪᓘᓐᓃᑦ ᐳᓛᕆᐊᖅᐸᒃᑐᑕ ᓈᓚᒋᐊᖅᑐᑕ ᐅᓂᒃᑳᖅᑐᐊᖅᑐᓂᒃ. part of Inuit oral history and could include cautionary ᐊᒥᓱᑲᓪᓚᖕᓂᒃ ᑕᐃᒫᒃ ᑐᓵᔪᓐᓇᓚᕿᓯᒪᔪᒍᑦ ᓱᕈᓯᐅᑎᓪᓗᖓ. tales, stories of how the world and all its inhabitants were created, experiences with supernatural beings, or stories ᒫᓐᓇᒃᑯᑦ ᓱᕈᓰᑦ ᑐᓵᖃᑦᑕᖏᓐᓂᖅᓴᐅᓕᕐᒪᑕ ᐅᓂᒃᑳᖅᑐᐊᖅᑐᓂᒃ, that chronicle great journeys. These stories are encoded ᑭᓯᐊᓂᓕ ᖁᕕᐊᓱᒃᐳᖓ ᐊᒥᓱᑲᓪᓚᐅᓕᕐᒪᑕ ᐅᓂᒃᑳᖅᑐᐊᑦ with traditional knowledge and Inuit values. ᐅᖃᓕᒫᒐᓕᐊᕆᓯᒪᔭᕗᑦ ᑐᓴᖅᑕᐅᔪᓐᓇᖅᑐᑦ. ᐅᓂᒃᑳᖅᑐᐊᑦ ᑐᓴᕐᓂᖅᑑᑎᐊᓗᐃᑦ ᐃᓚᖏᓪᓗ ᐅᓂᒃᑳᖃᐅᖅᑐᑦ ᐱᖖᒍᕐᓂᕕᓃᑦ ᒥᒃᓵᓄᑦ, ᓲᕐᓗ ᖃᓄᖅ ᑕᒃᓯᖅ ᐱᖖᒍᕐᓂᕐᒪᖔᑦ. ᐅᓂᒃᑳᖅᑐᐊᑦ ᐅᓂᒃᑳᑐᖃᐃᓪᓘᓐᓃᑦ ᐃᓕᓐᓂᐊᖅᑎᑦᑎᔾᔪᑎᖃᐅᕐᒪᑕ ᒫᓐᓇ ᓱᓕ ᐃᓕᑦᑎᕕᐅᔪᓐᓇᖅᑐᓂᒃ, Titles preceded by this ᓲᕐᓗ ᐱᒃᑯᓕᒋᐊᖃᖏᓐᓂᕐᒥᒃ ᐅᓂᒃᑳᕐᒥᑎᑐᑦ ᐅᒃᐱᒡᔪᐊᖅ ᐊᕕᖖᒐᕐᓗ, symbol are written by Elders. ᓯᓚᑦᑑᓂᕐᒥᓄᑦ ᕿᒪᕉᑎᔪᓐᓇᖅᓯᒪᔪᑯᓗᒃ. ᐊᑏᑐᖅ ᐅᑯᐊ ᑐᓴᕐᓂᕆᓂᐊᖅᐸᓯᐅᒃ ᑐᓴᕐᓂᕆᒐᒃᑭᑎᑐᑦ. ᓗᐃᔅ ᕝᓚᕼᐅᕐᑎ Hey there, When I was a child, we used to listen to storytellers arranged by the school. The elders would come to our classes, or we would have to go visit them at their houses to listen to them tell stories. I was fortunate to hear quite a few as a child. Nowadays, not very many children are exposed to these sto- ries. I’m happy to share a list of our publications about these traditional stories that can be heard now. There are creation stories, such as how fog came to be. We also have stories that can teach us, such as The Owl and the Lemming, in which the lemming was able to use his smarts to get away from an over- ly confident owl, teaching children not to be boastful.
    [Show full text]
  • Traditional Inuit Stories by Noel K. Mcdermott a Thesis
    Unikkaaqtuat: Traditional Inuit Stories By Noel K. McDermott A thesis submitted to the Graduate Program in Cultural Studies in conformity with the requirements for the Degree of Doctor of Philosophy Queen’s University Kingston, Ontario, Canada April, 2015 Copyright © Noel McDermott, 2015 Abstract Commentary on Inuit language, culture and traditions, has a long history, stretching at least as far back as 1576 when Martin Frobisher encountered Inuit on the southern shores of Baffin Island. The overwhelming majority of this vast collection of observations has been made by non-Inuit, many of whom spent limited time getting acquainted with the customs and history of their objects of study. It is not surprising, therefore, that the lack of Inuit voice in all this literature, raises serious questions about the credibility of the descriptions and the validity of the information. The Unikkaaqtuat: Traditional Inuit Stories project is presented in complete opposition to this trend and endeavours to foreground the stories, opinions and beliefs of Inuit, as told by them. The unikkaaqtuat were recorded and translated by professional Inuit translators over a five day period before an audience of Inuit students at Nunavut Arctic College, Iqaluit, Nunavut in October 2001. Eight Inuit elders from five different Nunavut communities told stories, discussed possible meanings and offered reflections on a broad range of Inuit customs and beliefs. What emerges, therefore, is not only a collection of stories, but also, a substantial body of knowledge about Inuit by Inuit, without the intervention of other voices. Editorial commentary is intentionally confined to correction of spellings and redundant repetitions.
    [Show full text]
  • Rescuing Sedna: Doorslamming, Fingerslicing, and the Moral of the Story Keavy Martin University of Alberta
    Rescuing Sedna: Doorslamming, Fingerslicing, and the Moral of the Story Keavy Martin University of Alberta 186 I remember one woman came into our house who had run away from her husband. She had walked about 50 miles-it was early spring. At that time I was too young to under- stand what was going on. I remember though, my mother welcomed this woman to our house and fed her and gave her some clothes. I heard of another woman who also ran away from her husband and she was never found. -Rev. Armand Tagoona In the final moments of Ibsen’sA Doll House, Nora Helmer walks out on her hus- band and three children, punctuating her departure with a now-famous slam of the door. Joan Templeton, author of Ibsen’s Women, describes the impact of this scene on the original nineteenth century audience: “When Betty Hennings, the first Nora, slammed the door in Copenhagen’s Royal Theatre on December 21, 1879, her con- temporaries were not, in what we have come to identify as the usual Victorian way, ‘shocked’; they were deeply shaken” (112). Indeed, the contemporary critical response to the play was consistent in its condemnation of Nora’s decision to abandon her duties as wife and mother: she was unscrupulous, unfeminine, and likely hysterical, and Ibsen, in creating her, had flouted the conventions not only of morality but of literary composition (Templeton 112-118; Marker and Marker 85-89). Almost immediately, Ibsen’s original ending was deemed unsuitable, and although the play continued to be staged, it appeared with a variety of alternate endings.
    [Show full text]