Characterization of Glycerol Dehydrogenase from Thermoanaerobacterium Thermosaccharolyticum DSM 571 and GGG Motif Identification

J. Microbiol. Biotechnol. (2016), 26(6), 1077–1086 http://dx.doi.org/10.4014/jmb.1512.12051 Research Article Review jmb

Characterization of Glycerol Dehydrogenase from Thermoanaerobacterium thermosaccharolyticum DSM 571 and GGG Motif Identification Liangliang Wang1,2, Jiajun Wang1,2, Hao Shi1,2, Huaxiang Gu1,2, Yu Zhang1,2, Xun Li1,2, and Fei Wang1,2*

1College of Chemical Engineering, Nanjing Forestry University, Nanjing 210037, P.R. China 2Jiangsu Key Laboratory of Biomass-Based Green Fuels and Chemicals, Nanjing 210037, P.R. China

Received: December 17, 2015 Revised: March 5, 2016 Glycerol dehydrogenases (GlyDHs) are essential for glycerol metabolism in vivo, catalyzing Accepted: March 9, 2016 its reversible reduction to 1,3-dihydroxypropranone (DHA). The gldA gene encoding a putative GlyDH was cloned from Thermoanaerobacterium thermosaccharolyticum DSM 571 (TtGlyDH) and expressed in Escherichia coli. The presence of Mn2+ enhanced its enzymatic 171 254 271 First published online activity by 79.5%. Three highly conserved residues (Asp , His , and His ) in TtGlyDH were March 14, 2016 associated with metal ion binding. Based on an investigation of glycerol oxidation and DHA

*Corresponding author reduction, TtGlyDH showed maximum activity towards glycerol at 60°C and pH 8.0 and Phone: +86-25-85427649; towards DHA at 60°C and pH 6.0. DHA reduction was the dominant reaction, with a lower Fax: +86-25-85427649; K of 1.08 ± 0.13 mM and V of 0.0053 ± 0.0001 mM/s, compared with glycerol oxidation, E-mail: [email protected] m(DHA) max

with a Km(glycerol) of 30.29 ± 3.42 mM and Vmax of 0.042 ± 0.002 mM/s. TtGlyDH had an apparent activation energy of 312.94 kJ/mol. The recombinant TtGlyDH was thermostable, maintaining 65% of its activity after a 2-h incubation at 60°C. Molecular modeling and site-directed mutagenesis analyses demonstrated that TtGlyDH had an atypical dinucleotide binding motif (GGG motif) and a basic residue Arg43, both related to dinucleotide binding. pISSN 1017-7825, eISSN 1738-8872 Keywords: Dinucleotide binding, glycerol dehydrogenase, molecular modeling, site-directed Copyright© 2016 by The Korean Society for Microbiology mutagenesis, Thermoanaerobacterium thermosaccharolyticum and Biotechnology

Introduction closely related to Fe-ADHs. However, most reported GlyDHs are NAD+-linked and strictly zinc-dependent metalloenzymes. In vivo glycerol metabolism involves many different Moreover, most studies on GlyDH have been conducted in kinds of proteins, among which glycerol dehydrogenase the thermophilic species B. stearothermophilus, due to the (GlyDH, E.C.: 1.1.1.6) primarily catalyzes the conversion of availability of its crystal structure [5, 30]. However, glycerol to 1,3-dihydroxypropranone (DHA) coupled with biochemical assays in this species are conducted at 30°C, the reduction of nicotinamide adenine dinucleotide (NAD+). lower than its optimal growth temperature of 55°C [21, 26]. GlyDHs effectively regulate physiological processes related To date, biochemical characterization of GlyDHs in to energy production, exchange, and consumption and have thermophiles has not been conducted at high temperatures. been isolated from a variety of prokaryotic and eukaryotic The Rossmann fold in dehydrogenases is one of the most cells, including Escherichia coli [27], Bacillus megaterium [22], common structural features of supersecondary structures Bacillus stearothermophilus [26], Clostridium butyricum [18], in many oxidoreductases that bind NAD+, nicotinamide and Schizosaccharomyces pombe [13]. Based on its PROSITE adenine dinucleotide phosphate (NADP+), and related description, there are three known types of alcohol cofactors. Since Rossmann first described the dinucleotide dehydrogenases (ADHs): zinc-containing “long-chain” alcohol binding fold in 1974 based on the structural alignment dehydrogenases (Zn-ADHs), insect-type or “short-chain” of four dehydrogenases (lactate, malate, alcohol, and alcohol dehydrogenases, and iron-containing alcohol glyceraldehyde-3-phosphate dehydrogenases) [20], a great dehydrogenases (Fe-ADHs). Of these, bacterial GlyDHs are deal of structural data on classical dinucleotide binding

June 2016 ⎪ Vol. 26⎪ No. 6 1078 Wang et al.

proteins have suggested that the initial βαβ fold is the most residue are critical for dinucleotide binding in TtGlyDH, conserved unit in the Rossmann fold [8] and typically based on rational design and site-directed mutagenesis. contains a phosphate binding motif (GXGXXG, where X is any amino acid) [3]. However, these traditional structural Materials and Methods features provide insufficient information to interpret the interactions between the Rossmann fold and nicotinamide Chemicals, Bacterial Strains, and Culture Conditions dinucleotides for all GlyDHs. All chemicals were purchased from Sangon Biotech (Shanghai, The lack of structural information on GlyDHs in China), unless otherwise stated. All DNA restriction enzymes, T4 thermophiles is the main bottleneck to determining the key polynucleotide kinase, and ligase were purchased from TaKaRa residues within its active and dinucleotide binding sites. To (Dalian, China). Phusion High-Fidelity DNA Polymerase was purchased from New England Biolabs (Ipswich, MA, USA). The date, only six delicate crystal structures of GlyDHs have BIOMEGA PCR Purification Kit and Mini Plasmid Extraction Kit been resolved and deposited in the Brookhaven Protein (Shanghai, China) were purchased for DNA purification and Data Bank (PDB), including three GlyDH structures from plasmid isolation. The genomic DNA from T. thermosaccharolyticum B. stearothermophilus (PDB entry: 1JQ5, 1JPU, and 1JQA) [5, DSM 571 was purchased from the German Collection of 21, 30] and one structure each from Thermotoga maritima Microorganisms and Cell Cultures (DSMZ; http://www.dsmz.de/). (PDB entry: 1KQ3) [11], Clostridium acetobutylicum (PDB E. coli TOP10 was used for plasmid propagation. E. coli BL21 entry: 3CE9), and Serratia plymuthica (PDB entry: 4MCA) (DE3) was used as the host for heterologous expression. The E. coli [14]. Moreover, the detailed mechanism of GlyDHs has strains were cultured at 37°C in LB medium supplemented with not been elucidated owing to the limitation of structural ampicillin (100 µg/ml) when required for plasmid maintenance. information and biochemical data. However, combining protein engineering techniques and protein structure Construction of Plasmids and Strains prediction could provide an alternative approach to DNA manipulations were performed by following standard procedures. A pair of specific oligonucleotide primers (see below) studying GlyDH function and mechanism. Rational design for amplifying gldA was designed based on its reference DNA has been performed with varying degrees of success to sequence (Gene ID: 9707383, Tthe_1821). The gldA coding sequence identify potential active residues and improve the given was amplified using genomic DNA from T. thermosaccharolyticum properties of enzymes based on in silico prediction and DSM 571 as a template: modeling. For example, redesigning the coenzyme specificity 5’-GGGAATTCCATATGACAAAAGCTATAATAGGCCCTTCG-3’ of a dehydrogenase using protein engineering was conducted (forward) in 1990 [24], and the coenzyme specificities of an ADH 5’-CCGCTCGAGTCTAGATCTCTTATTTTTGTACATTTTTCC-3’ from Rana perezi [19] and a xylitol dehydrogenase from (reverse) Pichia stipitis [29] were reversed completely by substituting The underlined letters represent the NdeI and XhoI restriction the key residues necessary for coenzyme binding, using the sites, respectively. The integrity and yield of the PCR products assistance of structural simulation. were assessed using agarose gel electrophoresis. The resulting Compared with mesophiles, thermophile-derived enzymes PCR fragments were digested with NdeI and XhoI and ligated into the commercial vector pET-20b in frame with the His tag. are relatively thermostable and tolerant to industrial 6 The ligation mixtures were transformed into E. coli TOP10 by heat production conditions such as high salt or solvent shocking the chemically competent cells for 90 sec at 42°C without concentrations and high operation temperatures [4, 25, 28], shaking. The transformants were screened on LB plates containing and considerable research efforts in recent years have 100 µg/ml ampicillin. The transformed gldA was confirmed by focused on thermostable enzymes. Thermoanaerobacterium DNA sequencing. thermosaccharolyticum is a thermophilic obligate anaerobic bacterium, and the genomic data from T. thermosaccharolyticum Expression and Purification of Recombinant TtGlyDH DSM 571 are accessible from the GenBank database [6, 16]. Expression strain BL21 (DE3) cells harboring pET-20b-gldA However, there have been few reports on the biochemical were grown in 50 ml of LB (100 µg/ml ampicillin) at 37°C and or structural characterization of T. thermosaccharolyticum 180 rpm. IPTG was added to a final concentration of 0.5 mM to GlyDH. induce expression until the culture reached the stationary phase (OD = 0.6–0.8) and was incubated for an additional 3 h at 25°C In this study, we examined a putative GlyDH from 600 at 120 rpm. The cultured cells were harvested and centrifuged at T. thermosaccharolyticum DSM 571 (TtGlyDH) and described 4°C and 10,000 ×g for 5 min. The cell pellets were washed twice its cloning, expression, and biochemical characterization. with ice-cold water to remove residual medium and suspended in We found that the GGG motif and a basic amino acid 5 ml of binding buffer (5 mM imidazole, 0.5 M NaCl, and 20 mM

J. Microbiol. Biotechnol. TtGlyDH Characterization and GGG Motif Identification 1079

Tris-HCl buffer, pH 7.9), followed by sonication on ice. The crude chelating agents (ethylenediamine tetraacetic acid and 2,6- extract was heat-treated (60°C, 30 min) and clarified by centrifugation pyridinedicarboxylic acid); and surfactants (SDS, Triton X-100, (15,000 ×g, 4°C, 20 min) to remove cell debris and precipitates. The and Tween 80 at a final concentration of 1.0% (w/v)). Enzyme soluble fraction was collected and loaded onto a nickel affinity activity in the absence of added chemical reagents was defined as column (Novagen, San Diego, CA, USA) equilibrated with 50 mM 100%. nickel sulfate. The recombinant TtGlyDH was step-wise eluted using elution buffers containing imidazole (100, 200, 400, and Determination of DHA Reduction Activation Energy 1,000 mM), 0.5 M NaCl, and 20 mM Tris-HCl buffer (pH 7.9). The The activation energy of DHA reduction was measured at molecular weight and purity of TtGlyDH were analyzed by SDS- temperatures of 25-55°C. The Arrhenius curve was plotted as relative PAGE using a prestained protein molecular weight ladder activity versus temperature (K), and logarithmic transformation (Thermo, Waltham, MA, USA) as the marker. Protein concentration was conducted to calculate the activation energy. was measured using the Bradford assay with bovine serum albumin as the standard (Bio-Rad, Hercules, CA, USA) [15]. All Determination of the Apparent Kinetic Parameters protein purification procedures were performed at 4°C. For glycerol oxidation, the apparent Michaelis-Menten constants for glycerol were measured in Tris-HCl buffer (50 mM, pH 8.0) Activity Assays with a glycerol concentration gradient of 2.7–82.2 mM at 60°C. One enzymatic unit was defined as the formation or consumption For DHA reduction, the apparent kinetic parameters for DHA of 1 µmol/min NADPH under the tested assay conditions. Glycerol were determined in acetate buffer (50 mM, pH 6.0) containing oxidation activity was assayed using purified enzyme (4.45 µg) at gradient concentrations of DHA (0.017–1.5 mM) with a fixed 60°C in Tris-HCl buffer (50 mM, pH 8.0) containing 2.5 mM NADP+ concentration of NADPH (0.1 mM) at 60°C. The apparent kinetic and 137 mM glycerol. DHA reduction activity was assayed using parameters for NADPH were measured in acetate buffer (50 mM, purified enzyme (0.021 µg) at 60°C in acetate buffer (50 mM, pH pH 6.0) with various final concentrations of NADPH (0.006– 6.0), supplemented with 0.1 mM NADPH and 2.0 mM DHA. The 0.3 mM) and a constant DHA concentration (4.0 mM) at 60°C. -1 -1 initial absorbance shift of NADPH at 340 nm (εNADPH =6.22mM cm ) All apparent kinetic parameters of TtGlyDH for glycerol, DHA, in 5 min was monitored. To eliminate the effect of autoxidation or and NADPH were calculated by fitting the plots to the Michaelis- the background rate shift of NADPH, the mixture was prepared Menten equation. without enzyme as a control for each assay. The pH of the assays was adjusted to the desired values at 60°C. All activity assays Multiple Sequence Alignment, Phylogenetic Analysis, and Structure were performed in triplicates. Simulation All related protein sequences were retrieved from UniProtKB/ Biochemical Characterization Swiss-Prot (http://www.uniprot.org/) for the sequence alignment For glycerol oxidation, the optimal pH was determined in Tris- and phylogenetic analyses, using the TtGlyDH amino acid sequence HCl buffers (50 mM) at various pH values (7.0–9.0) at 60°C. The as a BLAST query [1]. Iron-containing alcohol dehydrogenases optimum temperature was determined in Tris-HCl buffer (50 mM, were aligned using ClustalX 2.0 [9]. The alignment was displayed pH 8.0) at temperatures ranging from 55°C to 75°C. with ESPript (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). For DHA reduction, the optimal pH was determined at 60°C in The phylogenetic tree of metal-containing alcohol dehydrogenases two buffers (50 mM), acetate (pH 4.5–6.5) and imidazole (pH 5.5– was constructed using MEGA 6.0. The amino acid sequence of 7.5). The optimum temperature was determined in acetate buffer TtGlyDH was submitted to the server SWISS-MODEL (http:// (50 mM, pH 6.0) at temperatures of 40-75°C. The desired pH swissmodel.expasy.org/workspace/) for homology modeling [2, 7, values were adjusted according to temperature. 12, 23]. The PyMOL Molecular Graphics System was programmed The effect of temperature on TtGlyDH stability was examined for structural visualization and superposition. by measuring residual DHA reduction activity. Recombinant TtGlyDH (0.021 µg) was pre-incubated at various temperatures Site-Directed Mutagenesis of TtGlyDH (55–70°C) without the addition of substrates or cofactors. Samples Mutants R43V (valine substituting arginine at position 43) and were collected every 30 min and quickly placed on ice for 10 min triG/A (AAA triplet substituting GGG triplet at positions 92–94) before conducting the activity assay. The relative activity of un- were created following the inverse PCR method using 5’ mutant- incubated TtGlyDH was set as 100%. specific primers. The purified blunt-end PCR products were The effects of various additives on activity were examined by phosphorylated in the presence of ATP (1.0 mM) and T4 measuring residual DHA reduction activity. Recombinant TtGlyDH polynucleotide kinase (1 U) at 37°C. The phosphorylation reaction (0.021 µg) was incubated with various compounds at a 1.0 mM was deactivated at 70°C for 5 min and cooled to room concentration, unless otherwise specified, including metal divalent temperature. A self-ligation mixture was electroporated into the cation salts (BaCl2, CaCl2, CoCl2, CuSO4, MgCl2, MnCl2, NiSO4, TOP10 host cells, and positive transformants were screened on LB

ZnSO4, and Fe(NH4)2(SO4)2 at a final concentration of 0.05 mM); plates with ampicillin (100 µg/ml). Mutated plasmids were extracted

June 2016 ⎪ Vol. 26⎪ No. 6 1080 Wang et al.

from single colonies and confirmed by DNA sequencing. The mutagenic oligonucleotide primers used are as follows: R43V forward: 5’-GTGACAAAATCTATAATTGAAGAAAG-3’ (valine codon underlined) R43V reverse: 5’-ATTACTACTAGCAATAACAAGAAAA-3’ triG/A forward: 5’-GCGGCGGCGAAAATATTTGATACTGTA-3’ (alanine codons underlined) triG/A reverse: 5’- AATGCCAACTATGACATCAGAGTTTGT -3’

Nucleotide Sequence Accession Number All DNA information was retrieved from the NCBI GenBank database. The Gene ID of gldA reported in this paper is 9707383 (Tthe_1821), and the genome accession number of T. thermosaccharolyticum DSM 571 is CP002171.1.

Results and Discussion

Cloning gldA Full-length gldA was PCR-amplified from the genomic Fig. 1. SDS-PAGE analysis of recombinant TtGlyDH expressed DNA of T. thermosaccharolyticum DSM 571; the PCR fragment in E. coli BL21 (DE3). (1,107 bp) was ligated into the commercial vector pET-20b Lane M: prestained protein marker. Lane 1: crude extract from cell in frame with the C-terminal hexahistidine (His ) tag after lysate. Lane 2: supernatant after treatment at 60°C for 30 min. Lane 3: 6 cell-free solution prepared by nickel affinity chromatography. double digestion with NdeI and XhoI. The resulting construct was designated as pET-20b-gldA. The translated amino acid sequence of gldA indicated that TtGlyDH Biochemical Properties of Recombinant TtGlyDH belonged to the dehydroquinate synthase-like and iron- Substrate specificity was assessed using different containing alcohol dehydrogenase superfamily (DHQ_Fe- substrates, including primary alcohols (methanol, ethanol, ADH superfamily), using the Protein BLAST program. It and propanol), diols (ethylene glycol, 1,2-propanediol, 1,3- shared amino acid sequence similarities of 98% and 74% propanediol, 2,3-butanediol, and 1,4-butanediol), a triol with GlyDHs from Thermoanaerobacterium saccharolyticum (glycerol), and DHA. The results showed that TtGlyDH (GenBank No. WP_045408662.1) and Thermosediminibacter preferentially catalyzed DHA reduction rather than alcohol oceani (GenBank No. WP_041424025.1). SignalP 4.0 (http:// compound oxidation. Glycerol oxidization activity was www.cbs.dtu.dk/services/SignalP/) [17] failed to recognize faintly detected in the presence of a high concentration of a signal peptide within the amino acid sequence, suggesting glycerol (137 mM). However, no activity was detected with that TtGlyDH participates in intracellular metabolic processes. primary alcohols or diols (data not shown). The highest glycerol oxidation activity was observed at the optimal TtGlyDH Expression and Purification growth temperature of 60°C in Tris-HCl buffer (50 mM, The gldA from T. thermosaccharolyticum DSM 571 was pH 8.0). Maximum DHA reduction activity was also heterologously expressed in E. coli BL21(DE3) after induction observed at 60°C, and TtGlyDH exhibited the highest with isopropyl-β-D-thiogalactopyranoside (IPTG; 0.5 mM) activity in an acetate buffer, compared with 91% maximum for 3 h. After sonication and centrifugation, the soluble activity in an imidazole buffer at the same pH of 6.0 fraction was heat-treated at 60°C, followed by purification (Figs. 2A and 2B). using a nickel affinity column. The flow-through eluted The thermostability of TtGlyDH was investigated at four using elution buffer containing 400 mM imidazole was temperatures (55°C, 60°C, 65°C, and 70°C). At 70°C, dialyzed against potassium phosphate buffer (10 mM, pH TtGlyDH activity decreased to 60% maximum activity for 7.4), and the cell-free preparation was subjected to sodium the first 30 min and further decreased to 19% after 2 h. dodecyl sulfate polyacrylamide gel electrophoresis. One band However, over 80% of activity was retained during the first corresponding to a size of approximately 40 kDa (Fig. 1) was 30 min at 65°C, 60°C, and 70°C. In addition, 65% of activity observed clearly on the gel, consistent with its estimated was maintained after incubating at the optimal temperature molecular mass of 40.4 kDa in the monomer form. of 60°C for 2 h, which was similar to the 70% activity

J. Microbiol. Biotechnol. TtGlyDH Characterization and GGG Motif Identification 1081

Fig. 2. Biochemical properties of TtGlyDH. (A) The effects of pH on enzymatic activity. (B) The effect of temperature on enzymatic activity. Filled squares, glycerol oxidation activity; open circles, DHA reduction activity. (C) Thermal stability. (D) Effect of chemical reagents on TtGlyDH. The results are displayed as averages and standard deviations of three independent replicates. maintained at 55°C for 2 h (Fig. 2C). These results indicate that TtGlyDH is fairly thermostable at high temperatures from 55°C to 65°C. Furthermore, the effect of various additives on TtGlyDH activity was examined (Fig. 2D). Activity was significantly increased by ~79.5% in the presence of Mn2+. In addition, Co2+ and Cu2+ enhanced activity by 31.4% and 37.0%, respectively. Conversely, Ca2+, Zn2+, and two surfactants (SDS, Tween 80) inhibited enzyme activity to varying degrees. In particular, activity was inhibited by 24.0% by 1.0 mM Zn2+. The other chemical reagents had no significant influence on TtGlyDH. Many dehydrogenases require metal divalent cations to stabilize intermediates and facilitate conversion. Bacterial Fig. 3. Activation energy of TtGlyDH. polyol dehydrogenases, including GlyDHs, are grouped The results are displayed as averages and standard deviations.

June 2016 ⎪ Vol. 26⎪ No. 6 1082 Wang et al.

into the Fe-ADH family, which is not well annotated [21]. Table 1. Summary of the biochemical parameters of TtGlyDH. Biochemical evidence indicates that TtGlyDH differs from Apparent kinetic Glycerol DHA other ADHs and GlyDHs, as it is activated by Mn2+ and parameters oxidization reduction shows no preference for Fe2+, although sequence analysis Optimal temperature (°C) 60 60 suggests it is a member of the Fe-ADH family. To explain Optimal pH 8.0 6.0 a b this, the atomic orbit arrangement of manganese and iron Km (substrate) (mM) 30.29 ± 3.42 1.08 ± 0.13 2+ 2+ c must be considered. The ionic radii of Mn and Fe are Km (cofactor) (mM) ND 0.06 ± 0.01 nearly identical, given that manganese and iron are located Vmax (mM/s) 0.042 ± 0.002 0.0053 ± 0.0001 -1 d e in the same period on the periodic table and have similar kcat (s ) 1.89 98.44 2+ -1 -1 atomic numbers. In addition, Fe ions are readily oxidized kcat/Km (substrate) (mM s ) 0.06 91.15 in the presence of oxygen and converted to Fe(OH)3, which ND, not detected. precipitates at physiological pH and high temperatures. a,dglycerol as a substrate. b,eDHA as a substrate. Finally, Fe(OH)3 precipitates have a detrimental impact on cNADPH as a cofactor.

Fig. 4. Sequence alignment of TtGlyDH and Fe-ADH family members. The amino acid sequences are GlyDH from T. thermosaccharolyticum DSM 571 (TtGlyDH), alcohol dehydrogenase II from Zymomonas mobilis (ADH2, Accession No. F8DVL8), 1,3-propanediol dehydrogenase from Klebsiella pneumoniae (DHAT, Accession No. Q59477), lactaldehyde reductase from E. coli (FUCO, Accession No. P0A9S2), alcohol dehydrogenase IV from Saccharomyces cerevisiae (ADH4, Accession No. P10127), and alcohol dehydrogenase from T. maritima (ADH, Accession No. Q9X022). Residues involved in dinucleotide binding and metal divalent cation binding are labeled with triangles and stars, respectively.

J. Microbiol. Biotechnol. TtGlyDH Characterization and GGG Motif Identification 1083

TtGlyDH. Because of this, 0.05 mM Fe(NH4)2(SO4)2 was GlyDH [26], DHA reduction was dominant over glycerol added to investigate its effect on TtGlyDH activity. oxidization mediated by TtGlyDH, with a lower Km (DHA) of

Although zinc is widely reported to be an essential 1.08 ± 0.13 mM and a more effective turnover number (kcat) component for most ADHs and GlyDHs, the likely of 98.44 s-1. explanation for its inhibitory effect is that accommodation of Zn2+ may interfere with the formation or stability of the Multiple Sequence Alignment and Phylogenetic Analysis intermediate, resulting in decreased enzymatic activity. Multiple sequence alignment of TtGlyDH with The apparent activation energy of TtGlyDH DHA representative Fe-ADHs revealed a glycine-rich consensus reduction was calculated as 312.94 kJ/mol after logarithmic sequence (GGG motif) located in the N-terminal region. In transformation of the Arrhenius plot from 25°C to 45°C addition, three polar residues (Asp171, His254, and His271) in (Fig. 3). TtGlyDH were highly conserved across five species (Fig. 4). The apparent kinetic constants for the reversible redox To investigate the evolutionary relationship of metal- reaction of TtGlyDH were determined at the optimum containing ADHs, a phylogenetic tree was generated using temperature and pH using glycerol and DHA as substrates the Poisson substitution model with the neighbor-joining and NADP+/NADPH as cofactors. Table 1 lists the Michaelis- method, and the confidence of the tree was evaluated by Menten parameters. In contrast to B. stearothermophilus bootstrapping with 1,000 replicates. In total, 30 candidate

Fig. 5. Neighbor-joining tree constructed from 30 metal-containing ADHs. From top to bottom, the four monophyletic clades represent zinc-containing ADH classes I, II, and III and the iron-containing ADH family. The values adjacent to the nodes indicate the percentage bootstrap for 1,000 replicates.

June 2016 ⎪ Vol. 26⎪ No. 6 1084 Wang et al.

metal-containing ADHs grouped clearly into four clades: the zinc-containing ADH family (classes I, II, and III) and the iron-containing ADH family. TtGlyDH was well classified in the Fe-ADH family and exhibited a closer relationship with GlyDH from T. maritima (UniProtKB entry: Q9WYQ4) at an evolutionary level (Fig. 5). The GGG motif derived from the above alignment also existed in all Fe-ADH family members used for the phylogenetic tree construction (data not shown), but not in any of the Zn-ADH families. This suggests that the GGG motif could be used as a fingerprint for identifying Fe-ADH family members.

Structure Prediction and Site-Directed Mutagenesis Analysis We predicted the structure of TtGlyDH and performed site-directed mutagenesis to illustrate the relationship between sequence and structural features of TtGlyDH. The crystal structure of S. plymuthica GlyDH (PDB entry: 4MCA; resolution, 1.9 Å) was used as a template, with 57.2% sequence identity among 366 overlapping residues. The structure of TtGlyDH in its apoenzyme form was predicted using the SWISS-MODEL server. A partial structural Local superposition of the T. maritima ADH structure superposition of TtGlyDH (residues 70–116) and T. maritima Fig. 6. (grey ribbon) and TtGlyDH predicted model (magenta ribbon). Fe-ADH (PDB entry: 1VHD; chain A; residues 72–136) was The NADPH molecule and residues associated with dinucleotide represented as a ribbon diagram with a root mean square binding and metal ion binding are depicted in the stick model. deviation of 1.40 (Fig. 6). A classical βαβ unit was observed Carbon, oxygen, nitrogen, and phosphorus atoms are colored white, in the TtGlyDH structure, whereas an extra loop (residues red, blue, and orange, respectively. The zinc ion is shown as a cyan 110–127) disrupted the βαβ fold in T. maritima Fe-ADH. sphere. We introduced two mutations (R43V and triG/A) into TtGlyDH to investigate the residues critical for dinucleotide binding. The mutants R43V and triG/A only possessed chain, the GGG motif forms a more flexible turn and 6.3% and 0.7% of the enzymatic activity of the wild type, provides enough space to accommodate the pyrophosphate respectively, indicating that both the basic residue Arg43 moiety of dinucleotides. The mutation analysis indicated and GGG motif are essential for proper TtGlyDH function. that, although alanine is structurally similar to glycine with Nicotinamide dinucleotides contribute mainly to electron an extra methyl group, the mutant triG/A interfered with transfer as electron donors or acceptors in redox reactions. the formation of the flexible loop, due to steric hindrance The GXGXXG (where X is any amino acid) motif generally caused by the side chain of alanine, and failed to recognize occurs in most ADHs, serving to accommodate nicotinamide the pyrophosphate moiety, resulting in significant loss of dinucleotides [10]. However, the GXGXXG motif is not enzymatic activity. present in TtGlyDH or other members of the Fe-ADH Arg43 is located in close proximity to the nicotinamide family. Structural alignment revealed an overall similarity moiety, with a calculated distance of 3.8 Å. The hydrogen between TtGlyDH and T. maritima Fe-ADH of only 17.5%, bond contacts are located between the arginine side chain although the core structural units (βαβ) were almost the and nicotinamide moiety, and their interactions facilitate same. Interestingly, the GGG consensus sequence was and stabilize dinucleotide binding. Mutant R43V disrupted highly conserved, located between the first β-strand and the hydrogen bond interaction owing to the strongly first α-helix of the initial βαβ unit. Herein, the GGG motif is hydrophobic side chain of valine. This resulted in a weak purported to be involved in dinucleotide binding and orientation and recognition of dinucleotide molecules. accounts for the absence of the GXGXXG motif in the Fe- Despite TtGlyDH having been modeled in its apoenzyme ADH family. Moreover, because of the missing glycine side form, three conserved residues (Asp171, His254, and His271) in

J. Microbiol. Biotechnol. TtGlyDH Characterization and GGG Motif Identification 1085

TtGlyDH were clustered in the vicinity of Zn2+ in T. maritima 11. Lesley SA, Kuhn P, Godzik A, Deacon AM, Mathews I, Fe-ADH, with all side chains orientated towards the center Kreusch A, et al. 2002. Structural genomics of the Thermotoga of Zn2+. These orientations led us to assume that Asp171, maritima proteome implemented in a high-throughput His254, and His271 are associated with metal ion binding in structure determination pipeline. Proc. Natl. Acad. Sci. USA TtGlyDH. 99: 11664-11669. 12. Mariani V, Kiefer F, Schmidt T, Haas J, Schwede T. 2011. Assessment of template based protein structure predictions Acknowledgments in CASP9. Proteins 79 Suppl 10: 37-58. 13. Matsuzawa T, Ohashi T, Hosomi A, Tanaka N, Tohda H, This work was financially supported by the National Takegawa K. 2010. The gld1+ gene encoding glycerol Natural Science Foundation of China (No. 31270612, dehydrogenase is required for glycerol metabolism in 31170537), and the Research and Innovation Program of Schizosaccharomyces pombe. Appl. Microbiol. Biotechnol. 87: 715-727. Graduate Students in Jiangsu Province (CXZZ12_0538) as 14. Musille P, Ortlund E. 2014. Structure of glycerol dehydrogenase well as the Priority Academic Program Development of from Serratia. Acta Crystallogr. F Struct. Biol. Commun. 70: Jiangsu Higher Education Institutions (PAPD). Top-notch 166-172. 15. Noble JE, Bailey MJ. 2009. Quantitation of protein. Methods Academic Programs Project of Jiangsu Higher Education Enzymol. 463: 73-95. Institutions (TAPP). 16. Pei J, Pang Q, Zhao L, Fan S, Shi H. 2012. Thermoanaerobacterium thermosaccharolyticum beta-glucosidase: a glucose-tolerant References enzyme with high specific activity for cellobiose. Biotechnol. Biofuels 5: 31. 1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. 17. Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. Basic local alignment search tool. J. Mol. Biol. 215: 403-410. SignalP 4.0: discriminating signal peptides from transmembrane 2. Arnold K, Bordoli L, Kopp J, Schwede T. 2006. The SWISS- regions. Nat. Methods 8: 785-786. MODEL workspace: a web-based environment for protein 18. Raynaud C, Lee J, Sarcabal P, Croux C, Meynial-Salles I, structure homology modelling. Bioinformatics 22: 195-201. Soucaille P. 2011. Molecular characterization of the glycerol- 3. Bellamacina CR. 1996. The nicotinamide dinucleotide binding oxidative pathway of Clostridium butyricum VPI 1718. J. motif: a comparison of nucleotide binding proteins. FASEB Bacteriol. 193: 3127-3134. J. 10: 1257-1269. 19. Rosell A, Valencia E, Ochoa WF, Fita I, Pares X, Farres J. 4. Bruins ME, Janssen AE, Boom RM. 2001. Thermozymes and 2003. Complete reversal of coenzyme specificity by concerted their applications: a review of recent literature and patents. mutation of three consecutive residues in alcohol Appl. Biochem. Biotechnol. 90: 155-186. dehydrogenase. J. Biol. Chem. 278: 40573-40580. 5. Burke J, Ruzheinikov SN, Sedelnikova S, Baker PJ, Holmes 20. Rossmann MG, Moras D, Olsen KW. 1974. Chemical and D, Muir NM, et al. 2001. Purification, crystallization and biological evolution of nucleotide-binding protein. Nature quaternary structure analysis of a glycerol dehydrogenase 250: 194-199. S305C mutant from Bacillus stearothermophilus. Acta Crystallogr. 21. Ruzheinikov SN, Burke J, Sedelnikova S, Baker PJ, Taylor R, D Biol. Crystallogr. 57: 165-167. Bullough PA, et al. 2001. Glycerol dehydrogenase: structure, 6. Chimtong S, Tachaapaikoon C, Pason P, Kyu KL, Kosugi A, specificity, and mechanism of a family III polyol dehydrogenase. Mori Y, Ratanakhanokchai K. 2011. Isolation and characterization Structure 9: 789-802. of endocellulase-free multienzyme complex from newly 22. Scharschmidt M, Pfleiderer G, Metz H, Brummer W. 1983. isolated Thermoanaerobacterium thermosaccharolyticum strain Isolation and characterization of glycerol dehydrogenase NOI-1. J. Microbiol. Biotechnol. 21: 284-292. from Bacillus megaterium. Hoppe Seylers Z. Physiol. Chem. 364: 7. Guex N, Peitsch MC. 1997. SWISS-MODEL and the Swiss- 911-921. PdbViewer: an environment for comparative protein modeling. 23.Schwede T, Kopp J, Guex N, Peitsch MC. 2003. SWISS- Electrophoresis 18: 2714-2723. MODEL: an automated protein homology-modeling server. 8. Hanukoglu I. 2015. Proteopedia: Rossmann fold: a beta- Nucleic Acids Res. 31: 3381-3385. alpha-beta fold at dinucleotide binding sites. Biochem. Mol. 24. Scrutton NS, Berry A, Perham RN. 1990. Redesign of the Biol. Educ. 43: 206-209. coenzyme specificity of a dehydrogenase by protein 9. Larkin MA, Blackshields G, Brown NP, Chenna R, engineering. Nature 343: 38-43. McGettigan PA, McWilliam H, et al. 2007. Clustal W and 25. Sellek GA, Chaudhuri JB. 1999. Biocatalysis in organic Clustal X version 2.0. Bioinformatics 23: 2947-2948. media using enzymes from extremophiles. Enzyme Microb. 10. Lesk AM. 1995. NAD-binding domains of dehydrogenases. Technol. 25: 471-482. Curr. Opin. Struct. Biol. 5: 775-783. 26. Spencer P, Bown KJ, Scawen MD, Atkinson T, Gore MG. 1989.

June 2016 ⎪ Vol. 26⎪ No. 6 1086 Wang et al.

Isolation and characterisation of the glycerol dehydrogenase 29. Watanabe S, Kodaki T, Makino K. 2005. Complete reversal from Bacillus stearothermophilus. Biochim. Biophys. Acta 994: of coenzyme specificity of xylitol dehydrogenase and 270-279. increase of thermostability by the introduction of structural 27. Truniger V, Boos W. 1994. Mapping and cloning of gldA, the zinc. J. Biol. Chem. 280: 10340-10349. structural gene of the Escherichia coli glycerol dehydrogenase. 30. Wilkinson KW, Baker PJ, Rice DW, Stillman TJ, Gore MG, J. Bacteriol. 176: 1796-1800. Krauss O, Atkinson T. 1995. Crystallization of glycerol 28. Vieille C, Burdette DS, Zeikus JG. 1996. Thermozymes. dehydrogenase from Bacillus stearothermophilus. Acta Crystallogr. Biotechnol. Annu. Rev. 2: 1-83. D Biol. Crystallogr. 51: 830-832.

J. Microbiol. Biotechnol.