Transcriptional Regulation Mechanisms Involved in Azole Resistance in Candida Species: Focusing on the Transcription Factors Rpn4 and Mrr1

Home , Glycerol dehydrogenase, Histidinol dehydrogenase

Transcriptional regulation mechanisms involved in azole resistance in Candida species: focusing on the transcription factors Rpn4 and Mrr1

Raquel da Silva Califórnia

Thesis to obtain the Master of Science Degree in Biotechnology

Supervisor: Prof. Dr. Miguel Nobre Parreira Cacho Teixeira

Examination Committee

Chairperson: Prof. Dr. Ana Cristina Anjinho Madeira Viegas Supervisor: Prof. Dr. Miguel Nobre Parreira Cacho Teixeira Member of the Committee: Dr. Catarina Isabel Ribeiro Pimentel

October 2018

Acknowledgements

For me the development of this thesis was very challenging and involved a very extensive work, whose purpose would not have been reached without the help of some people I will mention below. First of all, I would like to thank my supervisor Professor Miguel Teixeira for the opportunity given by accepting me in his team and in this project. His tremendous support, guidance and motivation, always available to help, were crucial for the success of this work. I would like to thank Professor Isabel Sá-Correia for giving me the chance to join the Biological Sciences Research Group to develop my master thesis work. The achievement of this thesis required an indispensable help from several parts, which deserve my recognition. For the collaboration in the transcriptomic analysis herein accomplished, I thank Professor Geraldine Butler and her team, from University College of Dublin. For the supply of Candida glabrata mutants used in this work, I have to thank Professor Hiroji Chibana, from University of Chiba, Japan. For the study developed in HPLC analysis of ergosterol levels, I thank also Professor Nuno Mira for his availability and assistance. My gratitude should also be expressed towards my colleague, Pedro Pais, for the great help he has given me throughout this period, always available to help and explain anything. Many of the knowledge I would take with me were given by him, so thank you. Also, I a big thank to Mafalda Cavalheiro, who helped in several steps of my work mainly with HPLC, for her inexhaustible support in the lab as well as to all my other lab partners. And last but not least, I thank to Mónica Galocha for her help and friendship unconditionally, and because without her work, this thesis would never have been possible. For all the friendship and laughs, to my fellow of this journey, I leave a big thanks to all my friends, in special to Cristiana Ulpiano, Susana Vagueiro, Rita Simões, Pedro Monteiro, Mariana São Pedro, João Lampreia, Alexandra Balola, João Carvalho e Inês Sá, that were always present during this important stage of my life, even because half developed his thesis in the same building. To my teammates, for making me leave my house with the desire to train, for the moments of distraction and for helping me unwind my head for a few hours. Without enough words, I thank my boyfriend, Alexandre, for the indefatigable and unequaled support and patience, for always listen me carefully even though he does not realize anything I was saying. Thank you for always stay by my side and believe in me, love you more than everything. Most of all, I would like to thank my family, specially to my parents, for all the love and support throughout the course of my life, thanks for believing in me more than myself. My little sister, Rita, I hope to be always an example for her and a sister he will always be proud of. I have no words to say how much I love you all. This work was financially supported by Fundação para a Ciência e Tecnologia (FCT), contracts PTDC/BBB-BIO/4004/2014, PTDC/BII-BIO/28216/2017 and UID/BIO/04565/2013, and Programa Operacional Regional de Lisboa 2020, contract LISBOA-01-0145-FEDER-022231. iii

Abstract

Candida glabrata has emerged as the second most common cause of invasive candidiasis mainly due to the ability of this pathogenic yeast to resist to azole antifungal drugs. The transcriptional control of fluconazole drug response in C. glabrata was analyzed due to preliminary data suggesting that two transcription factors are determinants of azole drug resistance in C. glabrata, CgRpn4 (ORF CAGL0K01727g) and CgMrr1 (ORF CAGL0B03421g). Using RNA- sequencing, the regulon of CgRpn4 and CgMrr1 in control conditions and fluconazole exposure was defined. As predicted based on the role of the Saccharomyces cerevisiae homolog, CgRpn4 was found to be a major regulator of proteasome genes. In the context of fluconazole resistance mechanisms, CgRpn4 was found to be required for the up-regulation of ERG11, encoding the molecular target of azole drugs, as well as many other genes required for ergosterol biosynthesis. Consistently, Δrpn4 deletion mutant display a lower ergosterol concentration under fluconazole exposure. CgMrr1 was found to control the expression of a wide variety of genes, making it difficult to ascertain its exact role. In the context of fluconazole resistance, Mrr1 was found to up-regulate genes involved in sphingo/glycerophospholipid biosynthesis. Consistent with a role in the control of plasma membrane lipid composition, Rpn4 and Mrr1 were found to contribute to lower the plasma membrane permeability and intracellular fluconazole accumulation. The obtained results establish two new effectors of azole drug resistance and suggest that their activity in this context is the control of the plasma membrane composition, leading to decreased intracellular accumulation of fluconazole.

Keywords: Candida glabrata, fluconazole resistance, CgRpn4, CgMrr1, ergosterol and sphingolipid biosynthesis.

Resumo

Candida glabrata emergiu como a segunda causa mais comum de candidíase invasiva, principalmente devido à sua reduzida suscetibilidade a antifúngicos. O controlo transcricional em resposta ao fluconazole em C. glabrata foi analisado, porque dados preliminares sugeriram dois fatores de transcrição determinantes na resistência aos azóis, CgRpn4 (ORF CAGL0K01727g) e CgMrr1 (ORF CAGL0B03421g). Através dos dados de RNA-seq, o regulão de CgRpn4 e CgMrr1 em condições de controlo e fluconazole foi definido. Como previsto com base no papel do homólogo de Saccharomyces cerevisiae, o CgRpn4 foi considerado um importante regulador dos genes do proteassoma. No contexto dos mecanismos de resistência ao fluconazole, o CgRpn4 mostrou ser necessário para a ativação do ERG11, codifica o alvo molecular dos azóis, assim como muitos outros genes necessários para a biossíntese do ergosterol. Consistentemente, o mutante de deleção Δrpn4 apresenta uma menor concentração de ergosterol sob exposição ao fluconazole. Quanto ao CgMrr1, constatou-se que controla a expressão de uma ampla variedade de genes, tornando difícil determinar o seu papel exato. No contexto da resistência ao fluconazole, verificou-se que o Mrr1 regula positivamente os genes envolvidos na biossíntese de esfingo/glicerofosfolípidos. Consistente com o papel no controlo da composição lipídica da membrana plasmática, Rpn4 e Mrr1 contribuíram para diminuir a permeabilidade da membrana plasmática e a acumulação de fluconazole intracelular. Os resultados obtidos estabelecem dois novos efetores da resistência aos azóis e sugerem que a sua atividade neste contexto é efetuada através do controlo da composição da membrana plasmática, levando à diminuição da acumulação intracelular de fluconazole.

Palavras-chave: Candida glabrata, resistência ao fluconazole, CgRpn4, CgMrr1, vias biossintéticas do ergosterol e dos esfingolipídios.

vii

viii

Table of contents

Acknowledgements ...... iii

Abstract...... v

Resumo ...... vii

1. Introduction ...... 1

1.1. Candida infections ...... 1

1.2. Candida glabrata ...... 1

1.3. Antifungal agents used in the treatment of Candida infections ...... 3

1.4. Molecular mechanisms of resistance to azole drugs: focus on fluconazole ...... 5

1.4.1. Efflux pump overexpression ...... 6

1.4.2. Drug target overexpression ...... 7

1.4.3. Drug target alteration ...... 7

1.4.4. Bypass pathways ...... 8

1.4.5. Sterol biosynthesis pathway alterations ...... 8

1.4.6. Mitochondrial DNA deficiency ...... 9

1.5. The network of transcription regulators that control azole drug resistance, including an inter- species comparison ...... 11

1.6. The predicted role and mode of action of new transcription factors involved in Candida glabrata resistance to azole drugs ...... 13

1.6.1. The possible role of CgRNP4 in azole resistance ...... 13

1.6.2. The possible role of CAGL0B03421g (CgMRR1) in azole resistance ...... 14

1.7. Thesis aim ...... 15

2. Materials and Methods ...... 17

2.1. Strains and growth media ...... 17

2.2. Total RNA extraction ...... 17

2.3. RNA-seq analysis ...... 17

2.3.1. Library preparation ...... 17

2.3.2. Computational analysis ...... 18

2.4. Quantitative Real-Time (qRT-) PCR ...... 18

2.5. S. cerevisiae and C. glabrata transformation ...... 19 ix

2.6. Cloning of the C. glabrata CgRPN4 gene (ORF CAGL0K01727g), under the control of PDC1 promoter ...... Erro! Marcador não definido.

2.7. Ergosterol quantification in yeast cell membranes ...... 20

2.8. Plasma membrane permeability ...... 20

2.9. [3H]-Fluconazole Accumulation Assays ...... 21

3. Results and Discussion ...... 22

3.1. Transcriptional response to fluconazole induced stress in C. glabrata ...... 22

3.2. Role of the transcription factors Rpn4 and Mrr1 in the response to fluconazole exposure... 24

3.2.1. Role of Rpn4 in the transcriptome-wide response to fluconazole in C. glabrata ...... 24

3.2.2. Role of Mrr1 in the transcriptome-wide response to fluconazole in C. glabrata ...... 29

3.3. Regulation of CgERG11 and CgRPN4 transcript levels under fluconazole stress ...... 34

3.4. Rpn4 contributes to maintain intracellular ergosterol levels in fluconazole stressed cells .... 35

3.5. CgRpn4 and CgMrr1 contribute to control plasma membrane permeability ...... 36

3.5.1. CgRpn4 and CgMrr1 contribute to restrain plasma membrane permeabilization caused by fluconazole ...... 36

3.5.2. CgRpn4 and CgMrr1 contribute to decrease the intracellular accumulation of radiolabeled fluconazole in C. glabrata ...... 38

4. Conclusion and Perspectives ...... 40

5. References ...... 44

6. Annexe ...... 51

List of Figures

Figure 1.1 – Plylogenetic supertree with maximum likelihood of Candida species using an alignment of 153 universally distributed fungal genes. Candida albicans, Candida glabrata and Saccharomyces cerevisiae are highlighted in gray. Both Candida (CTG) and Saccharomyces (WGD) clades are represented in this figure. Numbers on all nodes represent the bootstrap scores. Adapted from Fitzpatrick et al. (2006)13...... 2

Figure 1.2 - The ergosterol biosynthetic pathway. The target of azole drugs (Erg11) and the accumulative compound that compromise the pathogenic yeast growth upon exposure to the drug (14α-methyl-3,6-diol encoded by Erg3), are highlighted in blue. Adapted from Brad et. al (2005)...... 4

Figure 1.3 - Chemical structures of several azole drugs from the three generations of systemic azoles developed for use in humans. Adapted from Mast et. al (2013)31...... 5

Figure 1.4 – Illustrative summary of some mechanisms of resistance to azole compounds in Candida albicans, illustrated by Vandeputte et. al (2012)21...... 10

Figure 3.1 – Functional groups upregulated (A) and downregulated (B) in the presence of fluconazole drug in C. glabrata parental strain……….……………………………………………………………………22

Figure 3.2 – Ergosterol biosynthesis in C. glabrata. Genes highlighted in red are the ones found to be upregulated in fluconazole stress……………………………………………………………………………..24

Figure 3.3 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Rpn4 in the control conditions in C. glabrata………………………………………………………………...25

Figure 3.4 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata…………………………………………………..25

Figure 3.5 – Comparison between genes upregulated in wild-type (Wt Fluco) and genes upregulated by the transcription factor Rpn4 (Δrpn4 Fluco), both in fluconazole induced stress in C. glabrata…………………………………………………………………………………………………………..26

Figure 3.6 – Comparison of the regulon of Rpn4, in all environmental conditions, among the three species in study: C. glabrata (CG), C. albicans (CA) and S. cerevisiae (SC)……………………………...... 27

Figure 3.7 – Transcription regulatory pathway involving Rpn4 in C. glabrata. Black arrows represent upregulation relations and red arrows, downregulation associations. The genes ahead of the C. glabrata ORFs, regulated by Rpn4, are the corresponding S. cerevisiae orthologs genes…………….28

Figure 3.8 – Transcription regulatory pathway involving Rpn4 in S. cerevisiae. Black arrows represent relations only found in C. glabrata; blue arrows represent upregulation relations and red arrows, downregulation associations…………………………………………………………………………………..29 xi

Figure 3.9 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Mrr1 in the control conditions in C. glabrata……………………………………………………………………….30

Figure 3.10 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Mrr1 in the presence of fluconazole drug in C. glabrata…………………………………………………....30

Figure 3.11 – Comparison of the regulon of Mrr1, in all environmental conditions, among the three species in study: C. glabrata (CG), C. albicans (CA) and S. cerevisiae (SC)………...... 32

Figure 3.12 – CgRPN4 and CgERG11 transcriptional control. Comparison of the variation of the CgRPN4 (A) and CgERG11 (B) transcript levels in KUE100 C. glabrata strain and in the Δyap1 and Δrpn4 deletion mutants, respectively. In both biological samples, the transcriptome analysis was performed before (control) and after 1 hour of exposure to fluconazole (300 mg/L). The presented transcript levels were obtained by RT-PCR and the values were normalized according to CgACT1, relative to the values registered in the wild-type in control conditions. The indicated values are averages of at least three independent experiments. Error bars represent the corresponding standard deviations. *p < 0,05; **p ≤ 0,01; ****p ≤ 0,00……………………………………………………………...34

Figure 3.13 – Intracellular ergosterol content from exponentially-growing cells of the wild-type and the deletion mutant Δrpn4 in the absence and presence of fluconazole (250 mg/L). The ergosterol content was evaluated considering different times of exposure to fluconazole: 1 hour, 3 hours and 6 hours. Error bars represent standard deviation resultant from three biological replicates with at least two technical replicates each. Error bars represent the corresponding standard deviations. *p < 0,05; ***p ≤ 0,001; ****p ≤ 0,0001………………………………………………………………………………………..35

Figure 3.14 – Propidium iodide fluorescence in wild-type and deletion mutants Δrpn4 and Δmrr1 in control and fluconazole stress conditions. Distribution of propidium iodide fluorescence intensity cell by cell of the wild-type (⚫ dark gray) and deletion mutants Δrpn4 (⚫ gray) and Δmrr1 (⚫ light gray) in absence () or presence (⚫) of fluconazole (250 mg/L). Error bars represent the corresponding standard deviations. Statistical analysis was made based on one-way ANOVA with multiple comparisons. *p < 0,05; ****p ≤ 0,0001……………………………………………………………………..37

Figure 3.15 – Fluorescence images of the (mean) frequency distribution data of propidium iodide fluorescence intensity of the wild-type (A) and deletion mutants Δmrr1 (B) and Δrpn4 (C) in fluconazole stress conditions………………………………………………………………………………….38

Figure 3.16 – Time-course accumulation of radiolabeled [3H]-Fluconazole in strains KUE100 wild-type (), KUE100_Δrpn4 (⚫) (A) and KUE100_Δmrr1 (◼) (B), during cultivation in MMB liquid medium in the presence of 250 mg/L unlabeled fluconazole. Accumulation values are the average of at least three independent experiments. Error bars represent the corresponding standard deviations. *p < 0,05; **p ≤ 0,01…………………………………………………………………………………………………39

xii

Figure 3.16 – Model of CgRPN4 and CgMRR1 regulation and action in C. glabrata under fluconazole exposure. Azole drug exposure activates the pleiotropic drug resistance regulator CgPDR1, which besides regulates its own expression induces the expression of drug transporters such as ABC transporters. Recently, it was demonstrated that CgYAP1 also induce the expression of multidrug transporters. These two drug responsive genes activate the expression of the transcription factor CgRPN4 which activates proteasomal genes, such as in S. cerevisiae. In turn, the assembled proteasome degrades CgRpn4, in order to maintain a negative feedback loop (dark blue dashed line) to control proteome homeostasis and expression of Rpn4 target genes. Besides proteasome genes, CgRpn4 regulates the expression of genes involved in ergosterol biosynthesis, as possible determinant in azole resistance. CgPDR1 also activate the expression of CgMrr1 transcription factor, which regulates the expression of genes involved in sphingolipid biosynthesis. Possible transcriptional mechanisms through which CgRpn4 and CgMrr1 expression influences C. glabrata resistance toward azole antifungals are highlighted in a dashed blue box…………………………………………………….42

xiii

List of Tables

Table 3.1 – Genes upregulated in fluconazole stress in C. glabrata belong to functional group, sterol metabolism………………………………………………………………………………………………………23

Table 3.2 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Mrr1 in the presence of fluconazole drug in C. glabrata………………………………………………………….31

Table 3.3 – Statistical parameters of the frequency distribution data of propidium iodide fluorescence intensity cell by cell of the wild-type and deletion mutants Δrpn4 and Δmrr1 in control and fluconazole stress conditions. Graphical representations of these data are shown above…………………………..38

xiv

Acronyms

ABC – ATP-Binding Cassette

CGD – Candida Genome Database

DHA – Drug:H+ Antiporter

DRE – Drug response element

EPA – Epithelial adhesin

GOF – Gain-of-function

GPI – Glycosylphosphatidylinositol

MDR – Multidrug resistance genes

MFS – Major Facilitator Superfamily

MIC – Minimum Inhibitory Concentration

MMB – Minimal Medium. Contains (per liter): 1.7 g of yeast nitrogen base without amino acids or NH4+ (Difco), 5 g of glucose (Merck), 1 g of galactose (Sigma) and 2.7 g of (NH4)2SO4 (Merck)

PDRE – Pleiotropic drug response element

SGD – Saccharomyces Genome Database

YPD - Yeast extract –Peptone–Dextrose medium. Contains (per liter): 20 g of glucose (Merck), 20 g of bacterial peptone (Dickson) and 10 g of yeast extract (Merck)

xvi

1. Introduction

1.1. Candida infections

Fungal infections, mainly caused by opportunistic human pathogens of the Candida genus, have become more common due to enhanced number and susceptibility of immunocompromised patients, particularly HIV-infected, cancer and transplant patients1–3. Besides this genus, fungi belonging to the Aspergilllus spp. and Cryptococcus spp. are also important human pathogens4. Candida species are the third most common cause of nosocomial infections in patients requiring intensive care and the most common responsible agent of fungal-related biofilm infections. Infections by Candida spp., called candidiasis, can lead to both superficial (mucosal and cutaneous) and systemic infection (as reviewed in Pais et. al 2016)5. Candidiasis is the fourth leading cause of hospital-acquired bloodstream infections in USA, reaching a mortality rate of 40%6. During the illness period, 60 to 80% of immunodeficiency virus-infected patients acquire fungal infections, being oropharyngeal candidiasis the most common7,8. Excessive use of antifungal agents and repeated antifungal therapies usually results in chronic candidiasis due to the gain of resistance of the strains responsible for the infection8. Systemic infections translate into high mortality rates since candidemia can arise in any organ or tissue with various clinical manifestations. The absence of accurate diagnostic tools and the inefficient antifungal therapies, observed in most cases, contribute to the high mortality that occurs in patients with systemic candidemia9. Therefore, a primordial strategy in the fight against fungal pathogens should be the study of the regulatory networks behind antifungal drug resistance. This knowledge would certainly allow us to design better medical diagnosis tools and appropriated treatment options according to the specificities of the regulatory pathways in each pathogen.

1.2. Candida glabrata

Candida glabrata was described as a yeast species of the human gut microbiota, and was first denominated as Cryptococcus glabratus by Harry Anderson in 191710. Interestingly, in the beginning this discovery did not have much impact, however, in 1995 it was considered an emerging pathogen when it began to cause a high number of deep fungal infections in immunocompromised patients11, perhaps due to its inherent higher resistance to commonly used antifungal drugs such as azoles. After the genome of C. glabrata (CBS138/American Type Culture Collection, ATCC2001) was sequenced, molecular evidences suggest that this species shares a common ancestor with Saccharomyces cerevisiae, being more closely related to this yeast than to Candida albicans12 (Figure 1.1). Unlike all Candida species, C. glabrata and C. krusei do not belong to the Candida clade13.

Interestingly, genes associated to extracellular enzymes and transmembrane transporters are in greater numbers in Candida clade pathogens, when compared to Saccharomyces species. However, genes involved in cell wall organization is significantly expanded in pathogenic yeasts like C. glabrata, which have been linked to its virulence and ability to resist to many types of stress14. Regarding its virulence, C. glabrata does not have hyphae formation capacity, which is an important factor in adhesion and tissue invasion, and is deficient in the secretion of hydrolases and biofilm formation, contributing to its lower virulence compared to the other Candida species15. In contrast, C. glabrata genome encodes putative glycosylphosphatidylinositol (GPI)-anchored cell wall proteins, like those of the epithelial adhesin (EPA) family, that are crucial for C. glabrata interaction with host tissue16. C. glabrata is an ubiquitous commensal of healthy humans, and is commonly found in the human microbiome. However, under specific circumstances this yeast can become pathogenic, leading to superficial or even systemic infections17. Among all Candida species, Candida albicans is responsible for a little more than half of the registered cases of candidaemia1,2,3. However, Candida glabrata has recently emerged as the second most common cause of invasive candidiasis, surpassed only by C. albicans, and there is an increasing number of reports showing its important role in mucosal or bloodstream infections, associating C. 2

glabrata infections with higher hospital costs with an estimated mortality rate of 40–50%9. In the case of C. glabrata, the epidemiology of infections is related to specific risk factors, such as prolonged hospitalization, prior antibiotic use, use of fluconazole in prophylaxis and treatment, patient exposure and hand carriage by hospital personnel18. Interestingly, C. glabrata is commonly associated with high minimum inhibitory concentrations (MIC) of fluconazole19. Indeed, the major treatment obstacle to C. glabrata infections is its intrinsic resistance and rapidly acquired resistance to azoles which are effective in eradicating infections caused by other Candida species19,20.

1.3. Antifungal agents used in the treatment of Candida infections

Five classes of antifungals have been developed during the past years to treat fungal infections, specifically azoles, polyenes, pyrimidine-analogs, echinocandins and allylamines (as reviewed in Vandeputte et. al 2012)21. Regarding their mechanism of action: i) azoles inhibit the synthesis of ergosterol by inhibiting the activity of the Erg11 enzyme; ii) polyenes bind to ergosterol in the fungal membrane, forming pores that alter the transmembrane potential and many dependent cellular functions; iii) pyrimidine-analogs destabilize nucleic acids synthesis and therefore result in growth arrest; iv) echinocandins, which are semisynthetic lipopeptides, inhibit the synthesis of a vital compound to the maintenance of structure and function of the fungal cell wall, β-1,3-D glucan, through the inhibition of Fks1 and Fks2 activity; v) allylamines, which block ergosterol biosynthesis by inhibiting the activity of Erg1, leading to accumulation of a toxic compound, squalene. Currently, azole drugs represent the most commonly used class of antifungals in the treatment of Candida infections, being itraconazole and fluconazole the most frequently selected. These drugs belong to a class of five-membered heterocyclic compounds containing a nitrogen atom and at least one other non-carbon atom, like a nitrogen, sulfur, or oxygen, as part of the ring. The extensive use of azole antifungal agents is associated with its high degree of oral bioavailability and its solubility in water7. However, the extensive and long-term use of these azole drugs can be accountable for the increased prevalence of azole resistance in Candida spp22. Azole drugs inhibit ergosterol biosynthesis (Figure 1.2) by binding to P450 dependent enzyme 14α-lanosterol demethylase encoded by the ERG11 gene23–26. This enzyme converts lanosterol into ergosterol, the major sterol in the fungal plasma membrane. The azole ring has nitrogen atoms that bind to the heme group in the active site of the enzyme, which in turn blocks the binding of the normal substrate27 (Figure 1.3). The decrease of ergosterol in the fungal membrane leads to loss in fluidity and the accumulation of the ergosterol intermediate 14α-methyl-3,6-diol, a toxic product, produced by Erg328,29. Depletion of ergosterol damages the cell membrane, which in turn results in defective structural properties, loss of fluidity and altered functions such as signaling, transport, exocytosis and endocytosis.

Azole drugs differ in their targets and pharmacokinetics properties. Two of the first-generation azoles were clotrimazole and ketoconazole30 (Figure 1.3). However, given the low efficiency and relatively high toxicity of first-generation azoles, improved azole drugs have been developed during the past decades. These include the second (fluconazole and itraconazole) and third (voriconazole and posaconazole) generation azoles, which have a triazole ring instead of the imidazole structure30,31 (Figure 1.3). The triazole-containing antifungals present improved safety profiles due to their increased affinities to the target enzyme in the invading pathogen along with a better oral bioavailability and pharmacokinetic properties as compared with the imidazole antifungals 30,32,33. Fluconazole has been extensively used in prophylaxis and in candidiasis therapy in transplanted and AIDS patients. Curiously, it is known today that prolonged fluconazole exposure may favor the emergence of C. glabrata infections34.

Figure 1.3 - Chemical structures of several azole drugs from the three generations of systemic azoles developed for use in humans. Adapted from Mast et. al (2013)31.

1.4. Molecular mechanisms of resistance to azole drugs: focus on fluconazole

Antifungal drug resistance can be primary (intrinsic) or secondary (acquired). Primary resistance is found naturally among certain fungi without prior exposure to the drug, as is the case of fluconazole resistance in Candida krusei. Secondary resistance develops among previously susceptible strains after exposure to the antifungal agent. The development of fluconazole resistance among Candida albicans and C. neoformans is an example of this type of resistance35. In order to be able to develop new strategies for more effective treatments, the different molecular mechanisms responsible for the triggering of intrinsic and acquired resistance must be investigated. The mechanisms of resistance have been studied most extensively in S. cerevisiae, however fungal resistance mechanisms to azoles are distinct and can be dependent on the type of azole and on the yeast species. The following topics review the molecular basis of the resistance mechanisms to azole drugs in C. glabrata, C. albicans and S. cerevisiae.

1.4.1. Efflux pump overexpression

One of the most important molecular mechanisms of azole resistance in C. glabrata is the activation of drug efflux pumps from the ATP-Binding Cassette (ABC) superfamily and Major Facilitator Superfamily (MFS). The basis of this mechanism consists in the reduction of intracellular drug concentration, through the activation of active efflux mediated by multidrug transporters (Figure 1.4). In Candida species, the MFS transporters encoded by the Drug:H+ Antiporter (DHA) genes and the ABC superfamily transporters are the two most important classes involved in azole resistance7. In C. glabrata, the transcriptional activation of three ABC drug transporter encoding genes CgCDR1 and CgCDR2 (homologous to S. cerevisiae PDR5), and CgSNQ2 (highly similar to SNQ2 from S. cerevisiae) leads to enhanced azole efflux, which contribute to lower fluconazole accumulation and consequent fluconazole resistance36–38. Interestingly, in fluconazole resistant clinical isolates the upregulation of both CgCDR1 and CgCDR2 genes has been observed 25. The deletion of CgSNQ2 in a fluconazole resistant isolate was found to lead to increased azole susceptibility, which is surpassed by the reintroduction of the CgSNQ2 gene38. In this case study, the disruption of CgPDR1, encoding the major transcription factor controlling multidrug resistance genes (MDR) in C. glabrata, led to significant decrease in the expression of CgSNQ2, CgCDR1 and CgCDR2 genes and to a higher susceptibility to fluconazole38. Another study also indicated CgPdr1 as an essential regulator of CgCDR1 and CgCDR2, its absence leading to a decrease in azole MIC values15. From these reports, fluconazole resistance in C. glabrata seems to be mostly controlled by gain-of-function (GOF) mutations in PDR1 gene, which lead to the increase of the CgCDR1, CgCDR2 and CgSNQ2 expression. In addition, the transcript levels of C. glabrata DHA encoding genes CgQDR2 and CgTPO3 were also found to be controlled by CgPdr139,40, being significantly upregulated in clotrimazole resistant isolates, when compared to susceptible ones, demonstrating their relevance to clinical acquisition of azole drug resistance41. Both transporters, as well as the DHA transporters CgTpo1_1, CgTpo1_242 and CgFlr243 were found to confer azole resistance. It was also reported a C. glabrata clinical isolate of fluconazole resistant whose expression of CgCDR1, CgCDR2 and CgERG11 genes was increased44. Overexpression of these genes may indicate that the mechanism of resistance to fluconazole can be achieved from the development of multiple molecular mechanisms within a single clinical isolate. In C. albicans, the expression of CDR1 and CDR2 are regulated by the transcription factor Tac1, which binds to a distinct cis sequence, named the drug response element (DRE), found in their promoters. In addition, a genome-wide analysis of the C. albicans Tac1 regulon was performed in order to identify other TAC1-dependent genes apart from CDR1 and CDR2. In four azole-resistant clinical isolates eight genes whose expression was modulated by Tac1 were identified, including GPX1, a putative glutathione peroxidase; LCB4, putative sphingosine kinase; and RTA3, a putative phospholipid flippase45. This insight suggest that Tac1p acts in others signaling pathways, such as

lipid metabolism and oxidative stress response in C. albicans, and that these may be related to acquisition of azole resistance. In C. albicans, the first multidrug efflux pump identified was MDR1 that belongs to the MFS transporters, which are also linked to fluconazole resistance in C. albicans clinical isolate46. This isolate has a GOF mutation in MRR1, encoding the transcription factor that controls MDR1 expression. This mutation led to an increase of resistance to fluconazole, but not to others azole drugs, possibly being a more specific mechanism of fluconazole. Besides that, studies demonstrated that Mdr1 is involved in the clinical acquisition of resistance to fluconazole, since it is overexpressed in fluconazole-resistant isolates47.

1.4.2. Drug target overexpression

The overexpression of Erg11, which leads to higher intracellular concentration of this drug target, is also considered a possible mechanism of azole resistance. C. albicans azole resistant isolates, when compared to azole-susceptible strains, were found to display upregulation of ERG11 (Figure 1.4). The consequent increase on the number of azole target molecules reduces the efficacy of azole drugs in inhibiting ergosterol synthesis48,49. Although this mechanism is normally correlated with increased expression of genes encoding efflux pumps, in a study develop in 2007, it was proved that the up-regulation of ERG11 gene is an independent mechanism of azole resistance in C. albicans50. Besides that, the UPC2 gene of C. albicans, which encodes a homologue of two transcriptional activators of the expression of genes involved in ergosterol synthesis in S. cerevisiae, Upc2/Ecm22, is responsible for fluconazole resistance by increasing the expression of ERG genes by directly binding to their promoters51. In C. glabrata the conditions of sterol import differ from S. cerevisiae. The ortholog CgUpc2 is the main regulator of sterol synthesis, whereas both Upc2a and Upc2b are required for full expression of the sterol transporter CgAus152. Marichal et al. (1997) found an example of C. glabrata chromosomal duplication containing the ERG11 gene which was demonstrated to be at least a partial cause of azole resistance53. However, no other similar case was ever registered in C. glabrata clinical isolates. Although this is true for C. albicans, mutation or overexpression of Erg11 in C. glabrata is not a mechanism of clinical acquisition of azole resistance.

1.4.3. Drug target alteration

Currently, more than 140 different amino acid changes in Erg11 in Candida albicans clinical isolates have been described, and this high genetic polymorphism suggests that ERG11 is highly permissive to structural changes54,55. Several evidences indicate that the amino acid substitutions do not contribute equally to azole resistance, some of these alterations are unique to azole-resistant strains such as K143R, S405F,

G464S, R467K, or I471T. The amino acid changes that are found in both azole-resistant and azole- susceptible strains, like E266D or V488I, cannot be considered relevant for azole resistance56,57. In a study realized by Morio et al. (2010), a screening of amino acid substitutions in ERG11 gene demonstrate the involvement of some substitutions (Y132F, Y132H, K143R, G307S, S405F, G448E, G448V, and G450E) in azole resistance, having potential use as predictive markers of fluconazole resistance54. Additionally, the amino acid substitution Y447H, found in a strain with reduced susceptibility to azoles, displayed resistance to both fluconazole and itraconazole but that remained susceptible to voriconazole54. Thus, it seems plausible to assume that certain mutations only confer resistance to some antifungal agents. In C. glabrata, one specific isolate CG156 was found to persist as a slow-growing agent in chronic infections because it exhibited low affinity to azoles caused by a G944A mutation in CgERG11, leading to a lack of cellular ergosterol, a major resistance to polyenes and the capacity to survive without sterol auxotrophy by growing in lanosterol-type sterols28.

1.4.4. Bypass pathways

In addition, the development of bypass pathways may be another solution for these pathogenic yeasts to survive against azole drugs. Knowing that the accumulation of 14α-methyl-3,6-diol, a toxic ergosterol synthesis intermediate produced by Erg3, occurs during exposure to azole drugs, mutations in the ERG3 gene have been found to lead to the inactivation of Δ-5,6-desaturase (C5 sterol desaturase), resulting in lower drug toxicity58. As a result of ERG3 mutation, a different non-toxic sterol, 14α-methyl fecosterol, becomes incorporated into the membrane, allowing fungal cell growth and survival to azole treatment58,59 (Figure 1.4). In S. cerevisiae, upon mutation of Erg3 ergosta-7,22-dien-3β-ol becomes the major sterol in the plasma membrane, which results in increased resistance to azole and polyene antifungal agents60. Interestingly, the base substitution G423A in CgERG3 gene was found to lead to increased resistance to fluconazole in C. glabrata strains61. This alteration prevents azole action since the toxic sterols that accumulate upon the inhibition of Erg11 can no longer be synthesized by this pathway.

1.4.5. Sterol biosynthesis pathway alterations

Other documented mechanisms of resistance to azoles involve changes in phospholipids and sterol composition, making the membrane more impermeable to azole drugs7,62. In fact, a study performed on a clinical isolate of C. glabrata that persisted under treatment with high doses of fluconazole, voriconazole, and amphotericin B demonstrated that it displayed increased capacity to uptake sterols in order to overcome the blockage of ergosterol biosynthesis28. This isolate was found to be an ERG11 mutant, harboring a single-amino-acid substitution (G315D) which abolished the function of Erg11. This alteration in cellular sterol composition affects intracellular signaling and trafficking pathways, including the distribution and function of membrane-anchored proteins, as well as 8

the efflux machinery and transport proteins that are proposed to mediate azole import via facilitated diffusion28. Moreover, a putative sterol transporter gene for C. glabrata was identified, AUS1, which may contribute to lower azole susceptibility, being a protection against azole toxicity63. Repression of CgAUS1 gene expression leads to inability of serum cholesterol to protect cells against the antifungal effects of fluconazole63. The survival of C. glabrata to azole treatment may be involved with the incorporation of endogenous sterol from serum. In another case study, seven isolates of C. glabrata that grew in a media containing cholesterol and an antifungal agent, two were defective in squalene epoxidase activity, which is encoded by the ERG1 gene, and three were defective in lanosterol synthase activity, which is encoded by the ERG7 gene. All 7 isolates produced profiles that contained cholesterol transported from the media. Since these two genes participate in ergosterol biosynthesis, the mutants lose the ability to produce this sterol. Curiously, even with the block of ergosterol biosynthesis caused by the azole drug, the mutants could grow by sterol supplementation, such as cholesterol. This finding suggests that the cholesterol uptake mitigates the effect caused by the blockage of ergosterol synthesis26. The ability of C. glabrata to replace ergosterol with host sterol may be responsible for its elevated azole resistance. Focusing on the ergosterol content, a study using strains with mutations in the mitochondrial DNA leading to a specific phenotype of respiratory deficiency was also performed. When the two cell populations, parent and mutant isolates, were exposed to fluconazole, the mutants exhibited an ergosterol content of 92% of the overall sterol composition, while in the parental strain free ergosterol represented only 17%29. However, major differences were not just seen in ergosterol content, but also in esterification of the biosynthesis intermediates. Indeed, petite mutant cells exhibited a marked increase in ergosterol content, with undetectable biosynthesis of intermediates. In contrast, the parental isolate esterified 54% of the biosynthesis intermediates29. Once again, the gain of resistance to fluconazole by the mutants could be explained by the increase in ergosterol biosynthesis.

1.4.6. Mitochondrial DNA deficiency

Mitochondrial dysfunction has been also linked to mechanisms of azole resistance in a C. glabrata isolate, exhibiting petite mutations upon exposure to fluconazole. It was reported that resistant colonies of C. glabrata displayed respiratory deficiency due to mutations in mitochondrial DNA, which promote the exhibited azole resistance, by indirectly resulting in increased expression of CgCDR1 and CgCDR229. In another study, an azole resistant C. glabrata strain (BPY41) besides exhibiting mitochondrial dysfunction, it also showed an overexpression of the ABC transporter genes CgCDR1, CgCDR2, CgSNQ2 and of the transcription factor gene CgPDR1. Interestingly, other transcription factors like ScROX1 and ScHAP1 were also found to be upregulated in BPY41, both controlling genes in response to heme and oxygen, their regulation appearing as a compensatory mechanisms due to mitochondrial dysfunction64. Moreover, BPY41 was found to be more virulent that the azole 9

susceptible isolate, and this may suggest that mitochondrial dysfunction could confer a selective advantage during host infection. A microarray analysis revealed that genes involved in cell wall integrity, adherence to mammalian cells and survival in macrophages are upregulated in BPY41 when compared to the susceptible isolate and these results may partially explain the enhanced virulence of BPY4164. A functional genomics analysis also allowed the identification of some genes related to mitochondrial function, which upon mutation, confer altered fluconazole susceptibility in C. glabrata. Interestingly, some of the mutants found were defective in mitochondrial assembly and organization, exhibiting very high levels of fluconazole resistance. C. glabrata mutants exhibiting the highest level of fluconazole resistance had insertions in genes SUV3, MRPL4, and SHE9, but they were disrupted for mitochondrial function27. Suv3p is a mitochondrial RNA helicase, meaning that suv3 mutant strains lack mitochondrial functions. This study proposes that mutants that do not result in a petite phenotype may, however, be linked to acquired resistance to fluconazole if they result in an increased loss of mitochondrial function. These authors also discovered that although C. glabrata can lose reversibly the mitochondrial function this may not involve loss of mitochondrial genome, and that C. glabrata can switch between states of mitochondrial competence and incompetence in response to fluconazole exposure27.

Figure 1.4 – Illustrative summary of some mechanisms of resistance to azole compounds in Candida albicans, 10 illustrated by Vandeputte et. al (2012)21.

The acquisition of azole resistant is complex because it develops gradually and through a diversity of molecular mechanisms65. It is, thus, important to understand the impact of clinical management on the increase of fungal pathogens that acquire antifungal resistance. Additionally, it is extremely important to discover new therapies against pathogenic fungi, either by designing novel drugs, or by identifying sensitizers of drug resistance mechanisms.

1.5. The network of transcription regulators that control azole drug resistance, including an inter-species comparison

The capacity of pathogenic yeasts to acquire drug resistance entails a complex regulatory pathway. The understanding of these transcription regulatory networks is expected to help in the fight against resistant yeast strains, enabling the design of new, more efficient, therapeutic choices. In C. glabrata, one of the main regulators of drug resistance is the transcription factor CgPdr1. CgPdr1 is a zinc finger transcription factor, activator of drug resistance genes, such as CDR1 and CDR2, acting by binding to a consensus sequence, called pleiotropic drug response element (PDRE), in the promoters of their target genes66,67. S. cerevisiae has two zinc cluster transcription factors homologues to CgPdr1: ScPdr1 and ScPdr367,25. Although CgPdr1 has a more identical sequence with ScPdr1, studies indicate that it shares many regulatory properties with ScPdr3 as well25,68. For that reason, in Paul et al. (2011), CgPdr1 was suggested to act as a combination of the two S. cerevisiae homologues67. Interestingly, GOF mutations in CgPDR1 can provoke elevated azole resistance, leading to the constitutive upregulation of multidrug efflux pumps67,68. These single point mutations in CgPDR1 were found to lead to a transcriptional up-regulation of their targets: CgCDR1, CgPDH1, and CgSNQ215,68. Other targets of Pdr1 include genes encoding drug:H+ antiporters of the Major Facilitator Superfamily (MFS), including QDR239 and TPO340. Altogether, both ATP-binding cassette efflux pumps and the multidrug transporters from the MFS contribute to the overall resistance phenotype, reinforcing the importance of CgPDR1 as one of the major regulator of drug resistance in C. glabrata. In Caudle et al. (2011), CgPDR1 was found to regulate several genes encoding proteins that participate in the ergosterol biosynthetic pathway, such as ERG1166. Interestingly, S. cerevisiae Pdr1 and Pdr3 were found to control the lipid composition and fluidity of membranes, preventing the intracellular accumulation of cytotoxic compounds69. As observed for CgPdr1, C. albicans transcription factor Tac1 is a Zn(2)-Cys(6) transcriptional activator of drug-responsive genes (CDR1 and CDR2) via binding to drug response element (DRE)70. A genome-wide location analysis of Tac1p shown that the promoters of CDR1 and CDR2, as well as of TAC1 itself were bound by Tac1p in an azole-susceptible strain45, suggesting that the control of these genes can be made by increasing the TAC1 expression or by GOF mutations. C. albicans has also another multidrug resistance Zn(II)2Cys6 transcription factor MRR1, a regulator that controls MDR1, which encodes a multidrug efflux pump of the major facilitator superfamily. Besides that, it was already demonstrated in azole resistant clinical C. albicans isolates

that upregulation of MRR1 and subsequently MDR1, is correlated with point mutations in the MRR1 gene, leading to increase of protein activity and acquisition of multidrug resistance71. Likewise, CDR1 whose expression is controlled by the transcription factor Mrr2 that, despite not sharing significant homology, shows functional conservation with MRR172. MRR1 appears to have other targets besides drug efflux pumps, as indeed has already been the case of Tac1. It was previously demonstrated in clinical isolates that inactivation of Mrr1 suppressed MDR1 expression, affecting more strongly fluconazole resistance then to deletion of MDR1 itself. This evidence indicates the existence of additional Mrr1p target genes, that influence fluconazole resistance71. In S. cerevisiae, YAP1 gene is basic leucine zipper (bZIP) transcription factor required for oxidative stress tolerance and resistance to drugs. Yap1 is activated by H2O2 through the multistep formation of disulfide bonds and transit from the cytoplasm to the nucleus. In C. glabrata, the ortholog gene is CgAP1, encoding a transcription factor involved in various stress responses73. It was discovered that deletion of CgAP1 led to decreased resistance to hydrogen peroxide, benomyl, and cadmium chloride74. Besides that, deletion CgFLR1, which encodes a plasma membrane transporter of MFS conferring resistance to several drugs and is controlled by CgAP1, only results in increased sensitivity to benomyl, but not cycloheximide or fluconazole74. CgFlr1 and CgFlr2 are close homologs of the S. cerevisiae Flr1 DHA transporter, playing direct roles in drug extrusion and conferring flucytosine resistance43. Recently, it was demonstrated that the expression of CgFLR1 and CgFLR2 is controlled by the transcription factors CgPdr1 and CgYap143. As mentioned in the previous chapter, one of the mechanisms of azole drug resistance is associated to upregulation of ergosterol biosynthetic genes. In fact, the zinc cluster transcription factor Upc2p mediates upregulation of ergosterol biosynthesis genes in response to ergosterol depletion in the fungal pathogen Candida albicans75, being an important player in azole resistance. In addition, Upc2 is a transcriptional activator of the multidrug efflux pump MDR1. In C. glabrata two UPC2 homologues were identified, designated CgUPC2A and CgUPC2B. Although C. glabrata appears phylogenetically closer to S. cerevisiae than C. albicans, CgUPC2A is more functionally similar to C. albicans UPC2. C. glabrata CgUPC2A, but not in CgUPC2B, displays an important role in the maintenance of sterol homeostasis and resistance against azoles76. Only the CgUpc2Ap is required for the up-regulation of ERG2 and ERG3 expression in response to sterol biosynthesis inhibitors, whereas both CgUpc2Ap and CgUpc2Bp are required for expression of CgAUS1, a sterol transporter76. This observation suggests that both genes possibly play crucial roles in sterol biosynthesis and exogenous sterol uptake in bloodstream infections involving C. glabrata.

1.6. The predicted role and mode of action of new transcription factors involved in Candida glabrata resistance to azole drugs

In a recent screening for new players in antifungal drug resistance in C. glabrata, two uncharacterized transcription factors were found to confer azole drug resistance. These transcription factors are CgRpn4, encoded by ORF CAGL0K01727g, and the protein encoded by ORF CAGL0B03421g, which was denominated CgMrr1 based on its homology to C. albicans Mrr1. Given that they are mostly uncharacterized in C. glabrata, an overview of the function of their homologs in S. cerevisiae and C. albicans is provided bellow.

1.6.1. The possible role of CgRNP4 in azole resistance

In S. cerevisiae, Rpn4p is a transcription factor that modulates the expression of many genes involved in the ubiquitin-proteasome system and is transcriptionally regulated in response to different stresses. RPN4 promoter contains as regulatory sequences two functional PDREs, that are bound by Pdr1p and Pdr3p, which mediate multiple drug resistance69. Additionally, RPN4 promoter contains an additional sequence that is bound by Yap1p (YRE) that plays an important role in the oxidative stress response and multidrug resistance. These evidences demonstrate that ubiquitin–proteasome system is controlled by transcriptional regulators of multidrug resistance (Pdr1p, Pdr3p and Yap1p) via RPN4 expression69. The ubiquitin–proteasome system appears to play a role in the defense against cellular damage caused by xenobiotics. In conclusion, Rpn4 is required for tolerance to cytotoxic compounds and may regulate multidrug resistance via the proteasome. The role of Rpn4 is not unique to proteasome-related genes. In fact, studies indicate that Rpn4 also regulates genes involved in multidrug resistance and ergosterol biosynthesis. Pdr1, Pdr3 and Upc2, which induces transcription of sterol biosynthesis genes, were discovered to be upregulated by Rpn4 in S. cerevisiae. Secondly, Flr1, a plasma membrane multidrug transporter of the major facilitator superfamily and involved in efflux of fluconazole, is also upregulated by Rpn4 in S. cerevisiae77. In C. albicans, Rpn4 seems to play a role in regulation of CDR2, an ABC multidrug transporter that is capable of phospholipid transport, being overexpressed in azole-resistant isolates. Additionally, MRR2, encoding a Zn(II)2Cys6 transcription factor, is involved in regulation of multidrug resistance via control of CDR1 expression, and HSP70, which encodes a heat-shock protein that is ketoconazole- induced, both being upregulated by Rpn4. All these results suggest other possible regulation pathways used to resist to fluconazole stress via Rpn4. The current knowledge about C. glabrata RPN4 homologue is not very extensive, however, it has been described as a putative transcription factor for proteasome genes and was found to be upregulated in azole-resistant strains73. In fact, Rpn4 is upregulated in C. glabrata strains expressing Pdr1 and S. cerevisiae strains expressing Pdr1–Pdr3 gain-of-function mutants15.

Furthermore, a study revealed the transcriptional regulation of PDR1 by Rpn4p. Pdr1p is a pleiotropic drug response factor conserved in C. glabrata78. The induction of the C. glabrata homologues of YAP1, RPN4 and PDR1 was proved by a microarray analysis that investigate the expression patterns of CgYAP1, CgRPN4 and CgPDR1 in response to stress caused by the antifungal drug benomyl78. All these results strongly suggest that the regulatory interplay between Pdr1, Yap1 and Rpn4 may be conserved from S. cerevisiae to C. glabrata.

1.6.2. The possible role of CAGL0B03421g (CgMRR1) in azole resistance

C. glabrata ORF CAGL0B03421g has as closest homologue in C. albicans the MRR1 gene. It is however a much closer homologue to S. cerevisiae HAP1. C. albicans MRR1 is a Zn(II)2Cys6 transcription factor that regulates MDR1 transcription, a plasma membrane multidrug efflux pump73. In addition, it is known that this transcription factor is upregulated in drug-resistant clinical isolates. Additionally, the constitutive upregulation of MDR1 due to gain-of-function mutation in MRR1 has been reported in different Candida species. However, the regulation of MDR1 expression is dependent on other transcription factors, such as Cap1 and Upc279. On the other hand, S. cerevisiae HAP1, encodes a zinc finger transcription factor involved in the complex regulation of gene expression in response to levels of heme and oxygen77. Interestingly, a report showed that HAP1 deletion mutant in S. cerevisiae causes a decreased expression of ergosterol-related genes and decreased cellular ergosterol content80. Additionally, it was also proved that both Upc2 and Ecm22p depend on Hap1 for basal expression of ERG genes81.

1.7. Thesis aim

Given the increasing number of immunocompromised patients and increasing antifungal drug resistance, especially exhibited by C. glabrata, there is an urgent need for the development of new effective treatments. Since C. glabrata has the ability to resist an increasing number of azole drugs, the study of the mechanisms of resistance and the different modes of action of these drugs are one of our concerns. The major goal of this master thesis is to unveil new transcriptional regulation mechanisms involved in azole resistance, focusing especially on the transcription factors Rpn4 and Mrr1 as intervenients in these pathways. In C. glabrata, the role of these putative transcription factors is not well understood, and for this reason, and because they were found to confer azole drug resistance in a recent screening for new players in antifungal drug resistance in C. glabrata, these two genes were the focus of this work. Within the scope of this Master Thesis, we intend to understand the role of CgRpn4 and CgMrr1 in fluconazole resistance. In other to achieve this goal, the regulon of CgRpn4 (ORF CAGL0K01727g) and CgMrr1 (ORF CAGL0B03421g) in control conditions and under fluconazole stress were defined, using RNA-sequencing. From these results, the lipid metabolism functional group stands out for Mrr1, and ergosterol biosynthesis appeared as the most represented group among Rpn4upregulated genes. Afterwards, RT-PCR was used to confirm the role of CgRpn4 in ERG11 expression. Thereafter, to understand if CgRpn4 has an influence on ergosterol biosynthesis, an intracellular ergosterol content assay was assessed. Additionally, since CgMrr1 and CgRpn4 may contribute to the normal functioning of lipid metabolism, a plasma membrane permeability analysis using propidium iodide and a study of the accumulation of radiolabeled fluconazole inside the cells were performed. So, the main aim of this project is the discovery of new drug targets and drug resistance mechanisms, providing the guidelines for more efficient therapeutic choices. After analyzing all the results obtained during this work, a model of CgRpn4 and CgMrr1 activation and action were hypothesized. Finally, general remarks considering the work developed and future perspectives are made, together with the contributions that this work offered in the comprehension of azole resistance mechanisms in C. glabrata.

2. Materials and Methods

2.1. Strains and growth media

Saccharomyces cerevisiae parental strain BY4741 (MATa, ura3Δ0, leu2Δ0, his3Δ1, met15Δ0) and the derived single deletion mutant BY4741_Δrpn4 were obtained from the Euroscarf collection. C. glabrata parental strain KCHR606, KUE100 (Ueno et al., 2007) and derived single deletion mutant KUE100_Δrpn4, KUE100_Δcgmrr1, KUE100_Δcgyap1 and KUE100_Δcgerg11, used in this study, were kindly provided by Hiroji Chibana, Chiba University, Chiba, Japan. C. glabrata strain L5U1 (cgura3Δ0, cgleu2Δ0) was kindly provided by John Bennett from the National Institute of Allergy and Infectious Diseases, NIH, Bethesda, USA. Also, the CBS138 C. glabrata strain, whose genome sequence was released in 2004, was used in this study for gene amplification purposes. The cells were batch-cultured at 30°C, with orbital agitation (250 rpm) in basal (minimal) medium broth (MMB), with the following composition (per liter): 1.7 g yeast nitrogen base without

+ amino acids or NH4 (Difco), 20 g glucose (Merck) and 2.65 g (NH4)2SO4 (Merck).

2.2. Total RNA extraction

Wild type and mutant strains were batch cultured at 30ºC, with orbital agitation (250 rpm) in MMB until mid-exponential phase and cultured in the absence of drug or incubated with 250 mg/L fluconazole during 1h for RNA-sequencing experiment and 1h30 for RT-PCR analysis. Total RNA extractions were performed using the RiboPureTM – Yeast Kit from Ambion, Thermo Fisher Scientific; according to manufacturer’s instructions. Library preparation and sequencing reactions were carried out as a paid service by the Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma, USA. RNA extraction for the RNA-seq experiments was previously conducted by Mónica Galocha and Catarina Costa, BSRG.

2.3. RNA-seq analysis

2.3.1. Library preparation

Prior to RNA-seq analysis quality control measures were implemented. Concentration of RNA was ascertained via fluorometric analysis on a Thermo Fisher Qubit fluorometer. Overall quality of RNA was verified using an Agilent Tapestation instrument. Following initial QC steps sequencing libraries were generated using the Illumina Truseq Stranded Total RNA library prep kit with ribosomal depletion via RiboZero Gold according to the manufacturer’s protocol. Briefly, ribosomal RNA was

depleted via pull down with bead-bound ribosomal-RNA complementary oligomers. The RNA molecules were then chemically fragmented and the first strand of cDNA was generated using random primers. Following RNase digestion, the second strand of cDNA was generated replacing dTTP in the reaction mix with dUTP. Double stranded cDNA then underwent adenylation of 3' ends following ligation of Illumina-specific adapter sequences. Subsequent PCR enrichment of ligated products further selected for those strands not incorporating dUTP, leading to strand-specific sequencing libraries. Final libraries for each sample were assayed on the Agilent Tapestation for appropriate size and quantity. These libraries were then pooled in equimolar amounts as ascertained via fluorometric analyses. Final pools were absolutely quantified using qPCR on a Roche LightCycler 480 instrument with Kapa Biosystems Illumina Library Quantification reagents. Strand specific RNA-seq library preparation and sequencing was carried out as a paid service by the NGS core from Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma, USA.

2.3.2. Computational analysis

Paired-end reads (Illumina HiSeq 3000 PE150, 2x150 bp, 2 GB clean data) were obtained from wild type (Candida glabrata KUE100) and correspondent Δcgrpn4 deletion mutant strain (ORF CAGL0K01727g). Two replicates of each sample were obtained from three independent RNA isolations, subsequently pooled together. Sample reads were trimmed using Skewer82 and aligned to the C. glabrata CBS138 reference genome, obtained from the Candida Genome Database (CGD) (http://www.candidagenome.org/), using TopHat83. HTSeq84 was used to count mapped reads per gene. Differentially expressed genes were identified using DESeq285 with an adjusted p-value threshold of 0.01 and a log2 fold change threshold of -1.0 and 1.0. Default parameters in DESeq2 were used. Significantly differentially expressed genes were clustered using hierarchical clustering in R86. Candida albicans and Saccharomyces cerevisiae homologs were obtained from the Candida Genome Database and Saccharomyces Genome Database (SGD) (https://www.yeastgenome.org/), respectively. To check the homology between the consensus sequences of the transcription factor Rpn4 among S. cerevisiae, C. albicans and C. glabrata, the binding sites of S. cerevisiae ScRpn4 and C. albicans CaRpn4 were found in Yeastract (http://www.yeastract.com/) and PathoYeastract (http://www.pathoyeastract.org/), respectively. Then, using these sequences was performed a search by DNA motif in the ORFs found to be upregulated by Rpn4 in C. glabrata.

2.4. Quantitative Real-Time (qRT-) PCR

The levels of CgRPN4 and CgERG11 transcripts were assessed by real-time PCR. Synthesis of cDNA for real time RT-PCR experiments, from total RNA samples, was performed using the MultiscribeTM reverse transcriptase kit (Applied Biosystems, Carlsbad, CA) and the 7500 RTPCR Thermal Cycler Block (Applied Biosystems), following the manufacturer’s instructions. The quantity of cDNA for the following reactions was kept around 10 ng. The subsequent RT-PCR step was carried 18

out using SYBR® Green reagents. Primers for the amplification of the CgRPN4, CgERG11 and CgACT1 cDNA were designed using Primer Express Software (Applied Biosystems) and are 5’- AACCAGACACCAAAACACCATTC -3’ and 5’- GCCATTGGCGCAGAGAGT -3’; 5’- AGGACCCGCTCTATCGAAAAA -3’ and 5’- GGATACACTCAGAGCAACGGAAA –3’; and 5’- GCCATGTGATGGTGTACACAAAT -3’ and 5’- TTGACCCATACCGACCATGA -3’, respectively. The RT-PCR reaction was carried out using a thermal cycler block (7500 Real-Time PCR System, Applied Biosystems). Default parameters established by the manufacturer were used and fluorescence detected by the instrument and registered in an amplification plot (7500 System SDS Software, Applied Biosystems). The CgACT1 mRNA level was used as an internal control. The relative values obtained for the wild-type strain in control conditions were set as 1, and the remaining values are presented relative to that control. To avoid false positive signals, the absence of nonspecific amplification with the chosen primers was confirmed by the generation of a dissociation curve for each pair of primers. Statistical analysis of the results was performed using analysis of variance, and differences were considered significant for p values 0.05. The experiment was repeated 3 times.

2.5. S. cerevisiae and C. glabrata transformation

For transformation purposes, cells were batch-cultured at 30°C, with orbital agitation (250 rpm) in liquid rich medium Yeast extract–Peptone-Dextrose (YPD), with the following composition (per liter): 20 g of glucose (Merck), 20 g of bacterial peptone (Dickson) and 10 g of yeast extract (HIMEDIA). All transformation reactions were performed using the Alkali-Cation Yeast Transformation Kit (MP Biomedicals), according to the manufacturer’s instructions. Mid-exponential S. cerevisiae BY4741 and C. glabrata L5U1 cells were batch-cultured at 30ºC with orbital shaking (250 rpm) in YPD liquid medium until a standard OD600nm 0.4 ± 0.04 was reached. The cells were harvested by centrifugation at 7 000 rpm for 5 min at 4ºC and the resulting pellets were resuspended in 2.7 mL of TE buffer, pH 7.5. After a second centrifugation step, the cells were harvested and rinsed with 1.5 mL of 0.15 M Lithium Acetate solution and shaken gently (100 rpm) at 30ºC for 25 minutes. Cells were harvested by centrifugation (7 000 rpm, 5 min, 4ºC) and resuspended in 300 μL TE buffer, pH 7.5. Cells were then transferred to 1.5 mL tubes, combining: 100 μL yeast cells, 5 μL Carrier DNA, 5 μL Histamine Solution and 100-200 ng plasmid DNA. Cells were gently mixed and incubated at room temperature for 15 min. A mixture of 0.8 mL PEG and 0.2 mL TE/Cation MIXX solution was added to each transformation reaction, followed by 10 min incubation at 30ºC and heat shock at 42ºC for 10 minutes. Cells were then pelleted in a microcentrifuge and resuspended in 100 μL YPD liquid medium before plating in appropriate medium agar plates.

2.7. Ergosterol quantification in yeast cell membranes

For quantification of ergosterol in yeast cell membranes, the wild-type and Δrpn4 strains were cultivated in 100 ML of YPD either in the presence or absence of fluconazole stress (250 mg/L), with an orbital agitation of 250 rpm until stationary phase was reached. Cells were harvested by centrifugation (8000 rpm, 7 minutes, 4 °C; Eppendorf 5804R), resuspended in 5 mL of methanol. Colesterol, used as an internal standard to allow quantification of the yield of ergosterol extraction, was added in order to have a final concentration of 1.25 mg/mL in each sample. Afterwards, the cells were lysed by vortexing using glass beads (30 seconds), following by incubation at 30 °C for 1 hour at 320 rpm. The samples were centrifugated at 8000 rpm for 7 minutes at 4 °C. Finally, 1,7 mL of supernatant was extracted to an eppendorf, following another centrifugation at 11000 rpm for 10 min at 4ºC (Sigma 2K15), from which 1 mL of the supernatant was then collected and stored until analysis. The extracts obtained were analyzed by High Pressure Liquid Chromatography with a 250 mm x 4 mm C18 column (LiChroCART Purospher STAR RP-18 end- capped 5 mm) at 30ºC. The samples were eluted in 100% methanol at a flow rate of 1 mL methanol per min. Colesterol was detected at 210 nm corresponding to a retention time of 13.77±0.67 min. Ergosterol was detected at 282 nm with a retention time of 11.33±0.18 min. Quantification was achieved through the internal standard peak area. Ergosterol concentration was normalized taking into account cholesterol content in the samples. The corresponding results are presented as the ratio between the average concentration of ergosterol of the KUE100 strain, according to each case, and the concentration of the other samples tested.

2.8. Plasma membrane permeability

Plasma membrane permeability was assessed by the passive uptake of propidium iodide (PI; 20 mM in DMSO, Invitrogen), from exponentially-growing cells of wild-type, Δrpn4 and Δmrr1 cells either in the presence of absence of 300 mg/L of fluconazole for 1 hour. PI was added to 1 mL of the cell suspensions to a final concentration of 15 µM and incubated in the dark with orbital agitation (15 minutes, 250 rpm). Cells exposed to PI were centrifuged (13000 rpm for 2 minutes), washed twice and resuspended in water. To evaluate the population heterogeneity for the cell permeability trait, the cell population strained with PI was observed using a Zeiss Axioplan microscope equipped with adequate epifluorescence interface filters (BP450-490 and LP520; Zeiss). Fluorescence images were obtained with a cooled charge-coupled device (CCD) camera (Cool SNAPFX; Roper Scientific Photometrics), and the images were analyzed with MetaMorph. Cell-to-cell fluorescence intensity was defined as the average of pixel by pixel intensity in the selected region of interest and a minimum of 50 cells/experiment were used. The fluorescence images were background corrected by using dark- current images.

2.9. [3H]-Fluconazole Accumulation Assays

In order to assess whether azole drug resistance was related to an efficient export of azole drugs, wild-type, Δrpn4 and Δmrr1 strains were evaluated regarding the intracellular accumulation of 3H-fluconazole. The internal accumulation of fluconazole was determined by calculating the ratio between the radiolabeled clotrimazole measured within the yeast cells and in the external medium (Intracellular/Extracellular). The parental strain KUE100 and the mutant strains KUE100_Δrpn4 and KUE100_ Δmrr1 were grown in MMB medium at 30oC, with an orbital agitation of 250 rpm. Achieving an O.D.600nm of 1±0,1 cells were harvested by filtration and resuspend Cells were washed and resuspended in MMG medium with vortex, obtaining an O.D.600nm of 0,7. Readily, 357 µM of [3H]- Fluconazole (Sigma; 1mCi/ml) and 250 mg/L of unlabeled fluconazole (Sigma) were added to the cellular suspensions, which were incubated at 30oC for a period of 30 min with orbital agitation of 180 rpm. The intracellular accumulation of labeled fluconazole was followed by filtering 200 µL of cell suspension, at adequate time intervals, through prewetted glass microfiber filters (Whatman GF/C) at each time-point. In the case of extracellular accumulation of 3H-fluconazole, 70 μL of the cellular suspension were collected at each time-point and centrifuged at 13200 rpm for 1 min. The supernatant was harvested and immersed in 7 mL of scintillation liquid (Beckman). After each time-point collection, the filters were washed with ice-cold TM buffer. The radioactivity for each sample of intracellular and extracellular accumulation, at each time-point, was measured in the Beckman LS 5000TD scintillation counter.

3. Results and Discussion

3.1. Transcriptional response to fluconazole induced stress in C. glabrata

Recent preliminary data from our group shows that CgRPN4 (ORF CAGL0K01727g) and CgMRR1 (ORF CAGL0B03421g) are determinants of azole resistance in C. glabrata (Pais, Galocha et al, unpublished results). CgRpn4 is a predicted transcription factor involved in proteasomal gene regulation, although no study on its function has been undertaken so far. Interestingly, it was found to be upregulated in azole-resistant strains, and in strains expressing Pdr1 GOF mutations in C. glabrata15. C. glabrata CgMRR1 gene, predicted to encode a transcription factor, has as closest homologues in C. albicans the MRR1 gene and the HAP1 of S. cerevisiae. It is known that the C. albicans Mrr1 transcription factor is upregulated in drug-resistant clinical isolates. On the other hand, S. cerevisiae HAP1, encodes a zinc finger transcription factor involved in the complex regulation of gene expression in response to levels of heme and oxygen87,88. RNA sequencing data was explored to find the key target genes and biological processes controlled by the transcription factors Rpn4 and Mrr1 that underlie their contribution to fluconazole resistance in Candida glabrata. Firstly, the analysis of RNA-sequencing data encompassed the organization of all genes, predicted to be regulated by RPN4 and MRR1, in different functional groups according to their definition and characterization in C. glabrata or in S. cerevisiae and C. albicans homologues. The effect of fluconazole in wild-type C. glabrata transcriptome was analyzed in order to understand the regulation of C. glabrata genes involved in the response to this specific stress (Figure A1). A pie chart was built, allowing the identification of the largest functional groups of genes upregulated (Figure 3.1A) or downregulated (Figure 3.1B) upon fluconazole exposure. From this dataset, 29 genes were found upregulated and 15 genes downregulated in fluconazole stress.

22 Figure 3.1 – Functional groups upregulated (A) and downregulated (B) in the presence of fluconazole drug in C. glabrata parental strain. Analyzing Figure 3.1A, it is possible to detect one major functional group, sterol metabolism (Table 3.1), that may be considered the core response to fluconazole stress in C. glabrata. This group is mainly composed by ERG genes involved in ergosterol biosynthesis (Figure 3.2). Not surprisingly, a single multidrug resistance gene was found to be upregulated in fluconazole stressed cells, CDR1, encoding a multidrug transporter of the ATP-binding cassette (ABC) superfamily, involved in resistance to azoles.

Table 3.1 – Genes upregulated in fluconazole stress in C. glabrata belong to functional group, sterol metabolism.

Group Log2 fold C. glabrata S. cerevisiae Function definition change ORF (Name) homolog

CAGL0L10714g 1.097 C-8 sterol isomerase ERG2 (ERG2) Delta 5,6 sterol desaturase; C-5 sterol desaturase; predicted CAGL0F01793g 1.073 transmembrane domain and endolasmic reticulum (ER) binding ERG3 (ERG3) motif Putative cytochrome P-450 lanosterol 14-alpha-demethylase; CAGL0E04334g 0.963 target enzyme of azole antifungal drugs; increased protein ERG11 (ERG11) abundance in azole resistant strain CAGL0A00429g 0.829 Putative C24 sterol reductase ERG4 (ERG4) CAGL0D05940g Squalene epoxidase with a role in ergosterol synthesis; 0.826 ERG1 (ERG1) involved in growth under conditions of low oxygen tension CAGL0M07656g 0.576 Putative C22 sterol desaturase ERG5 Sterol (ERG5) metabolism CAGL0H04653g C24 sterol methyltransferase; mutation confers resistance to 0.518 ERG6 (ERG6) amphotericin B and nystatin and increased sensitivity to azoles Ortholog(s) have oxysterol binding, sterol transporter activity 1.483 CAGL0J03916g and role in endocytosis, exocytosis, maintenance of cell HES1 polarity, piecemeal microautophagy of nucleus, sterol transport Ortholog(s) have delta14-sterol reductase activity and role in 0.532 CAGL0I02970g ERG24 cellular response to drug and ergosterol biosynthetic process Ortholog(s) have C-4 methylsterol oxidase activity, role in 1.024 CAGL0K04477g ergosterol biosynthetic process and endoplasmic reticulum ERG25 membrane, plasma membrane localization Ortholog(s) have role in cellular iron ion homeostasis, 0.836 CAGL0K03927g ERG29 ergosterol biosynthetic process and mitochondrion organization Ortholog(s) have electron carrier activity, role in ergosterol 0.730 CAGL0L03828g CYB5 biosynthetic process

Figure 3.2 – Ergosterol biosynthesis in C. glabrata. Genes highlighted in red are the ones found to be upregulated in fluconazole stress.

3.2. Role of the transcription factors Rpn4 and Mrr1 in the response to fluconazole exposure

3.2.1. Role of Rpn4 in the transcriptome-wide response to fluconazole in C. glabrata

Comparing the WT with the derived Δrpn4 deletion mutant strain in control and fluconazole stress (Figure 3.3 and 3.4), it was possible to investigate the influence of Rpn4 in both conditions in C. glabrata. This analysis allowed the identification of which genes are positively and negatively controlled by Rpn4, and the functional groups more affected by this transcription factor in fluconazole stressed cells. 24

In control conditions, Rpn4 is responsible for the activation of 120 genes and repression of 166, affecting a total of 286 (Figure 3.3). Considering the upregulated genes by Rpn4, proteasome genes are, as expected based on sequence homology, one of the most represented functional groups, followed by cell cycle and carbon source metabolism (Figure 3.3A). Indeed, the genes associated to the predicted physiological role of Rpn4, the proteasome genes, are most of them upregulated by this transcription factor (23%) compared with ones that are downregulated, just 1% (Figure 3.3B). Under fluconazole stress, Rpn4 is responsible for the activation of 81 genes (see Figure A2) and repression of 132, affecting a total of 213 genes (Figure 3.4). Likewise, functions related to cell cycle and proteasome are the most enriched groups activated by CgRpn4 (Figure 3.4A), followed by lipid and fatty acid metabolism. The later functional group includes ERG1, ERG2, ERG3 and ERG11, involved in ergosterol biosynthesis, and are all upregulated by Rpn4 in fluconazole stress. In addition, genes involved in nitrogen metabolism, ion homeostasis and cell wall organization are also activated by RPN4 (Figure 3.4B).

Figure 3.3 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Rpn4 in the control conditions in C. glabrata.

Figure 3.4 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata. Among all the proteasome genes activated by Rpn4 are the following, whose names are based on orthologs in S. cerevisiae and C. albicans: PRE4, PRE1, PRE2, PRE8, PRE7, RPT4, RPN1, RPN2, PUP3, PRE9, PRE5 and RPN10. This result emphasis Rpn4 as a proteasome gene regulator in C. glabrata, and suggests that proteasome function is required for azole drug response in this yeast. Phenotypes to which Rpn4 contributes, as previously identified in group, include fluconazole and caspofungin resistance and biofilm formation. Indeed, it was demonstrated that the deletion of CgRPN4 leads to a 4-fold and 2-fold decrease in fluconazole and caspofungin MIC levels, respectively. Additionally, Δrpn4 deletion mutant strain was associated to a lower production of biofilm when compared to wild-type (Galocha M, Pais P, Teixeira MC, unpublished results). As such, and although the objective of this work was the response to fluconazole stress in C. glabrata, genes regulated by Rpn4 associated with caspofungin stress and biofilm formation were also looked for. From this analysis, it was not found any gene related to cell wall organization, so possible target genes of Rpn4 in caspofungin stress were not found. The same search was made for possible genes involved in biofilm formation and it was found that AWP1, encoding an adhesin-like protein, is a target of Rpn4. While these phenotypes are associated with Rpn4 regulation, the conditions studied in this work were not appropriate to look for caspofungin stress or biofilm formation, meaning that to obtain more reliable results further experiments should be done with specific conditions for each case. In the case of fluconazole stress, a comparison between genes upregulated in wild-type cells upon fluconazole exposure and those activated by Rpn4 was performed (Figure 3.5). These genes correspond to 11% of the sum of the two datasets and are mainly involved in lipid and fatty acid metabolism. Among them are ERG1, ERG2, ERG3 and ERG11, suggesting that ergosterol biosynthesis could be the process controlled by Rpn4 which underlies its role as a fluconazole resistance determinant.

Figure 3.5 – Comparison between genes upregulated in wild-type (Wt Fluco) and genes upregulated by the transcription factor Rpn4 (Δrpn4 Fluco), both in fluconazole induced stress in C. glabrata.

Subsequently, the regulon of CgRpn4 was compared to those of CaRpn4 and ScRpn4. In this regard, the S. cerevisiae and C. albicans Rpn4-activated target genes, in both control and fluconazole conditions were searched from Yeastract (http://www.yeastract.com/) and PathoYeastract (http://www.pathoyeastract.org/) , respectively. The results were then organized to find the common features among the Rpn4 regulons in the three yeast species (Figure 3.6).

Figure 3.6 – Comparison of the regulon of Rpn4, in all environmental conditions, among the three species in study: C. glabrata (CG), C. albicans (CA) and S. cerevisiae (SC).

At first review, it was possible to notice a higher similarity between genes upregulated by Rpn4 of C. glabrata and S. cerevisiae, sharing 43 target genes. Additionally, C. albicans and S. cerevisiae share only 1 target gene, SAP1. Besides that, 110 target genes appear to be specific to C. glabrata Rpn4. Interestingly, within the targets of Rpn4 found in common in C. glabrata and S. cerevisiae, are 12 genes associated to the physiological role of Rpn4 as regulator of proteasome genes: PRE4, PRE1, PRE2, PRE8, PRE7, RPT4, RPN1, RPN2, PUP3, PRE9, PRE5 and RPN10. Although this observation could be justified based on the fact that C. glabrata is phylogenetically closer to S. cerevisiae than to C. albicans, this conclusion cannot be drawn because too little is known about the activity of Rpn4 in C. albicans, for which only 9 target genes are known.

Additionally, the transcription regulatory network involving Rpn4 was organized for C. glabrata (Figure 3.7). After that, the transcription factors regulated by CgRpn4 and their associations were compared with the Rpn4 transcription networks known for S. cerevisiae and C. albicans. These two regulatory networks were performed based on associations described in literature, whereas the network obtained for C. glabrata Rpn4 was complemented with information gathered in this study on the transcription factors regulated by Rpn4.

Figure 3.7 – Transcription regulatory pathway involving Rpn4 in C. glabrata. Black arrows represent

upregulation relations and red arrows, downregulation associations. The genes ahead of the C. glabrata

ORFs, regulated by Rpn4, are the corresponding S. cerevisiae orthologs genes.

Then, a comparative study of the three pathways developed was carry out in order to check common associations between the yeast species. The C. albicans transcription regulatory network involving Rpn4 was found to have just one association in common to C. glabrata, the downregulation of Tec1 by the Rpn4 transcription factor (results not shown). Contrarily, the S. cerevisiae Rpn4 network was found to have a lot in common with the C. glabrata Rpn4 network (Figure 3.8). In both species, Rpn4 is activated by Yap1 and Pdr1, and represses, possibly in an indirect fashion the expression of Tec1, Asg1, Sut1, Rim101 and Msn4. Again, this comparative analysis suggests functional conservation among the Rpn4 proteins in C. glabrata and S. cerevisiae, but not so much, as far as current knowledge goes, when compared to C. albicans.

downregulation associations.

3.2.2. Role of Mrr1 in the transcriptome-wide response to fluconazole in C. glabrata

To investigate the influence of the deletion of MRR1 in cells cultivated in control conditions or under fluconazole stress, the same analysis performed earlier for Rpn4 was executed for Mrr1, starting with the comparison between the transcriptomes of WT and Δmrr1 deletion mutant (Figure 3.9 and 3.10) in both conditions. In control conditions, Mrr1 is responsible for the activation of 222 genes and repression of 254, affecting a total of 476 (Figure 3.9). Considering the genes upregulated by Mrr1, nitrogen and carbon source metabolism is the most represented functional group, followed by lipid and fatty acid metabolism and nucleic acid binding (Figure 3.9A). Although the physiological role of Mrr1 is not known in C. glabrata, it appears to be controlling mostly genes required for nitrogen and carbon metabolism (Figure 3.9B). In fluconazole stress, Mrr1 is responsible for the activation of 134 genes (see Figure A3) and repression of 203, affecting a total of 337 genes (Figure 3.10). Again, functions related to carbon metabolism are the most enriched among those activated by CgMrr1 (Figure 3.10A), followed by nitrogen and lipid metabolism, proteasome and nucleic acid binding. The functional group denominated lipid metabolism includes RSB1, HBN1, YPC1, NTE1, OPI10, LAM1, LAM5 and LAM6, whose expression is important to maintain the integrity of the cell membrane since these genes are almost all related to sterol transfer proteins or phospholipid biosynthesis (Table 3.2). From these genes, LAM5 and LAM6 are upregulated by Mrr1 only under fluconazole stress, while the remaining genes are upregulated by Mrr1 in both conditions. This result emphasizes Mrr1 as a possible regulator 29

of plasma membrane lipid content, essential to maintain the membrane integrity, this function being eventually the one that underlies the role of Mrr1 as a determinant of azole drug resistance in C. glabrata.

Figure 3.9 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Mrr1 in the control conditions in C. glabrata.

A B

Figure 3.10 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Mrr1 in the presence30 of fluconazole drug in C. glabrata.

Table 3.2 – Functional groups upregulated (A) and downregulated (B) by the transcription factor Mrr1 in the presence of fluconazole drug in C. glabrata.

C. glabrata Fold Change S. cerevisiae Description of the function of the C. glabrata protein or of its protein (ORF) (upon fluconazole homolog S. cerevisiae homolog name stress)

Putative sphingolipid flippase; gene is upregulated in azole- resistant strain. S. cerevisiae homolog encodes a putative sphingoid long-chain base (LCB) efflux transporter; integral RSB1 RSB1 membrane transporter that localizes to the plasma membrane and -0,51 (CAGL0L10142g) may transport long chain bases (LCBs) from the cytoplasmic side toward the extracytoplasmic side of the membrane; role in glycerophospholipid translocation.

Oxidoreductase activity, acting on NAD(P)H, nitrogenous group as acceptor activity and role in cellular response to oxidative stress, negative regulation of fatty acid metabolic process. S. cerevisiae HBN1 FRM2 homolog encodes a type II nitroreductase, using NADH as -0,55 (CAGL0B00990g) reductant; mutants are defective in fatty acid mediated repression of genes involved in fatty acid biosynthesis indicative of a role in lipid signaling; involved in the oxidative stress response.

Uncharacterized. S. cerevisiae homolog encodes a serine esterase; homolog of human neuropathy target esterase (NTE); CAGL0L11154g NTE1 Nte1p-mediated phosphatidylcholine turnover influences -0,58 transcription factor Opi1p localization, affecting transcriptional regulation of phospholipid biosynthesis genes.

Uncharacterized. S. cerevisiae homolog encodes an alkaline ceramidase, enzyme of the sphingolipid biosynthesis pathway; CAGL0M06347g YPC1 catalyzes both breakdown and synthesis of phytoceramide; -0,8 overexpression confers fumonisin B1 resistance; YPC1 has a paralog, YDC1, that arose from the whole genome duplication.

Uncharacterized. S. cerevisiae homolog encodes a protein with a possible role in phospholipid biosynthesis; null mutant displays an CAGL0F01111g OPI10 inositol-excreting phenotype that is suppressed by exogenous -0,74 choline; protein abundance increases in response to DNA replication stress.

Uncharacterized; gene is upregulated in azole-resistant strain. S. cerevisiae homolog encodes a putative sterol transfer protein; probable role in retrograde transport of sterols from the plasma CAGL0I01980g LAM1 -0,65 membrane to the ER; one of six StART-like domain-containing proteins in yeast that may be involved in sterol transfer between intracellular membranes.

Uncharacterized. S. cerevisiae homolog encodes a sterol transporter that transfers sterols between membranes; may CAGL0L13134g LAM6 -0,65 regulate and coordinate formation of contact sites between organelles.

Uncharacterized. S. cerevisiae homolog encodes a putative sterol transfer protein; one of six StART-like domain-containing proteins CAGL0K12760g LAM5 -0,64 in yeast that may be involved in sterol transfer between intracellular membranes.

Subsequently, the regulon of CgMrr1 was compared with those of CaMrr1 and ScHap1. In this regard, the Mrr1-activated target genes, in both control and fluconazole conditions were searched from Yeastract (http://www.yeastract.com/) and PathoYeastract (http://www.pathoyeastract.org/) for the CgMrr1 homologues in S. cerevisiae and C. albicans, respectively. The results were then organized to find the common features among the Mrr1 regulons in the three yeast species (Figure 3.11).

Figure 3.11 – Comparison of the regulon of Mrr1, in all environmental conditions, among the three species in study: C. glabrata (CG), C. albicans (CA) and S. cerevisiae (SC).

Observing the Venn diagram, it is possible to notice that both S. cerevisiae and C. albicans share 13 Mrr1 target genes with C. glabrata. Most of these genes are associated to carbon and nitrogen metabolism demonstrating that Mrr1 may be essential to maintain the basic metabolism of the cell. Interestingly, within the targets of Mrr1 found in common in C. glabrata and S. cerevisiae, are 5 genes associated to the physiological role of ScHap1 as regulator of gene expression in response to levels of heme and oxygen: GRE3 (Aldose reductase; involved in carbon metabolism), GSY1 (Glycogen synthase; expression induced by glucose limitation, nitrogen starvation and environmental stress), HXK1 (Hexokinase isoenzyme 1; involved in carbon metabolism; expression is highest during growth on non-glucose carbon sources), HMX1 (heme oxygenase; involved in heme degradation

during iron starvation and in the oxidative stress response) and PET10 (role in lipid metabolism; expression pattern suggests a role in respiratory growth). Besides that, 3 of the 4 genes common to all three species are GPH1 (Glycogen phosphorylase required for the mobilization of glycogen), DLD1 (Major mitochondrial D-lactate dehydrogenase; oxidizes D-lactate to pyruvate, transcription is heme- dependent) and MLS1 (Malate synthase, enzyme of the glyoxylate cycle; involved in utilization of nonfermentable carbon sources). These observations might indicate that the role of Mrr1 in C. glabrata may be to some extent associated with S. cerevisiae Hap1, suggesting some conservation of function along these three species, however, no effect of CgMRR1 deletion in the response to oxygen levels could be found (Pais P, unpublished results). The CaMrr1 and the ScHap1 have very different functions, however, this transcription factor of C. glabrata, which we have called Mrr1, does not share an exact function with either CaMrr1 or ScHap1. Additionally, C. albicans and S. cerevisiae share 19 target genes, being ERG3, ERG5 and PDR16 the ones that stand out. All these three genes are associated to lipid metabolism, Erg3 and Erg5 are involved in ergosterol biosynthesis, and Pdr16 is described as capable of controlling levels of various lipids. Besides that, 195 Mrr1 upregulated genes were found to be specific to C. glabrata.

3.3. Regulation of CgERG11 and CgRPN4 transcript levels under fluconazole stress

In order to confirm whether or not the expression of CgRPN4 and CgERG11 is affected upon drug exposure, quantitative RT-PCR was used to study the effect of fluconazole stress exposure in the transcript levels of these genes (Figure 3.12A and 3.12B).

mRNA mRNA

mRNA

CgACT1

mRNA/

(foldchange)

(foldchange) mRNA/

ERG11 Cg CgRPN4

Figure 3.12 – CgRPN4 and CgERG11 transcriptional control. Comparison of the variation of the CgRPN4 (A) Ergosterol and CgERG11 (B) transcript levels in KUE100 C. glabrata strain and in the Δyap1 and Δrpn4 deletion mutants, respectively. In both biological samples, the transcriptome analysis was performed before (control) and after 1 Regardinghour of exposure the mode to fluconazole of action of (300 azole mg/L). drugs The which presented inhibit transcript the activity levels of were Erg11 obtained enzyme by andRT- PCR kkkdnjfkn and the values were normalized according to CgACT1, relative to the values registered in the wild-type in control conditions. The indicated values are averages of at least three independent experiments. Error bars represent

the corresponding standard deviations. *p < 0,05; **p ≤ 0,01; ****p ≤ 0,0001.

The transcript levels of CgERG11 and CgRPN4 were seen to have a small but statistically significant increase upon 1 hour of exposure to fluconazole. Furthermore, given the fact that the transcription factor CgYap1 had been previously linked to the control of CgRpn4 expression89, the effect of CgYAP1 deletion on the expression of CgRPN4 was further evaluated. CgYap1 was found to be required for the full expression of CgRPN4 in both control and fluconazole stress conditions (Figure 3.12A). Additionally, the effect of CgRpn4 on the expression of CgERG11 was also assessed, confirming that the upregulation of ERG11 under fluconazole stress is partially controlled by Rpn4 (Figure 3.12B).

3.4. Rpn4 contributes to maintain intracellular ergosterol levels in fluconazole stressed cells

RNA-seq data showed that Rpn4 controls the expression of several ERG genes. This observation urged us to assess the intracellular ergosterol content in C. glabrata cells cultivated in control conditions or during fluconazole exposure, in order to understand the influence of Rpn4 in ergosterol biosynthesis. Ergosterol was collected from wild-type and Δrpn4 cells in the absence of stress and at several time points during cultivation in the presence of fluconazole, and the ratio of ergosterol per mass of cells was measured through HPLC (Figure 3.13).

Ergosterol quantification confirms the lower content of this sterol in cells under fluconazole stress when compared to control conditions (Figure 3.13). This is likely a consequence of ergosterol synthesis inhibition by azoles, due to the direct inhibition of 14-α-sterol demethylase encoded by Erg11, which leads to an inability of convert lanosterol into ergosterol. In addition, as the time of exposure to fluconazole increases, the intracellular content of ergosterol decreases, this effect being stronger for Δrpn4 deletion mutant cells, when compared to the wild-type. It is possible to observe that only 1 hour of exposure to fluconazole is not enough to detect differences between the wild-type and Δrpn4. However, after 3 hours of exposure to fluconazole, a statistically significant difference between the intracellular content of ergosterol in the deletion mutant and the wild-type begins to occur. These results prove the importance of Rpn4 to maintain ergosterol content in plasma membrane under fluconazole stress. Although Rpn4 has been described as a putative transcription factor for proteasome genes, it was also found to be upregulated in azole-resistant strain. Thus, the activation of ergosterol biosynthesis by Rpn4 may be a possible regulation pathway used to resist to fluconazole stress.

3.5. CgRpn4 and CgMrr1 contribute to control plasma membrane permeability

3.5.1. CgRpn4 and CgMrr1 contribute to restrain plasma membrane permeabilization caused by fluconazole

As depletion of lipids damages the cell membranes having an impact on its physiological function as a selective barrier, we assessed the effect of fluconazole exposure in plasma membrane permeability in the wild-type strain and in the absence RPN4 or MRR1, to further understand the impact of Rpn4 and Mrr1 in plasma membrane properties. The plasma membrane permeability was inferred by the passive uptake of a fluorescent intercalating agent with a high affinity for nucleic acids, named propidium iodide (PI). This dye only penetrates cells with compromised plasma membranes. Thus, the PI fluorescence intensity can be correlated with the permeability of each cell, and therefore, the stability of the fungal membrane. Analysis of fluorescence levels of individual cells allow the comparison of fluorescence distributions in different cell populations (Figure 3.14). In control conditions, there is no significant difference in permeability between wild-type and Δrpn4 and Δmrr1 cells. In contrast, under fluconazole exposure an increase of the membrane permeability in all biological samples (WT, Δrpn4 and Δmrr1) can be observed, when compared to the respective control. However, in Δrpn4 mutant cells, membrane permeability attained values much higher than those registered for wild-type cells in the presence of fluconazole stress, reaching extremely high fluorescence intensity values (Figure 3.14).

The deletion of CgMRR1 results also in increased cell permeability upon fluconazole treatment, however, not as extreme as that registered for Δrpn4 cells (Figure 3.15). The mutant cells Δrpn4 and Δmrr1 under fluconazole stress exhibits a higher average PI fluorescence intensity (3,2- and 2,3-fold higher than the fluconazole-adapted wild-type cells for Rpn4 and Mrr1, respectively) and more heterogeneous cell-to-cell permeability levels (higher standard deviation) than the other three biological samples (Table 3.3). So, both deletion of RPN4 and MRR1 genes lead to a higher fluorescence distribution in the cell population with a higher average value of membrane permeability under fluconazole stress, being the difference presented by Δrpn4 much more significant.

A B C

Graphical representations of these data are shown above.

Control Fluconazole

WT Δrpn4 Δmrr1 WT Δrpn4 Δmrr1

Mean 13,59 52,99 18,20 521,18 1463,67 1184,36

Standard deviation 12,22 15,46 9,77 874,42 1657,89 729,89

3.5.2. CgRpn4 and CgMrr1 contribute to decrease the intracellular accumulation of radiolabeled fluconazole in C. glabrata

Although Rpn4 and Mrr1 do not activate any type of transporter, they affect the synthesis of ergosterol or the metabolism of other lipids which in turn can affect membrane permeability and hence decrease diffusion across the plasma membrane. So, based on this hypothesis, the intracellular accumulation of radiolabeled fluconazole was examined, to evaluate the possibility that CgRpn4 and CgMrr1 may contribute to the reduction of fluconazole accumulation in stressed yeast cells. [3H]- fluconazole accumulation assays were carried out in the wild-type and in the deletion mutants Δrpn4 and Δmrr1. In each case, the deletion of one of these genes results in increased fluconazole accumulation, suggesting further that Rpn4 and Mrr1 may affect the composition and stability of the plasma membrane. The Δrpn4 and Δmrr1 deletion mutants were found to accumulate 5,6-fold and 2,6-fold more radiolabeled fluconazole than the corresponding parental KUE100 strain, respectively (Figure 3.16A and 3.16B). These results strongly suggest that CgRpn4 and CgMrr1 activities reduce the accumulation of fluconazole within yeast, thus affecting C. glabrata resistance to this azole drug.

4. Conclusion and Perspectives

In this thesis, C. glabrata CgRpn4 transcription factor was demonstrated for the first time as a key regulator of proteasome genes, both in control and fluconazole stress conditions. In addition to proteasome genes, ERG1, ERG2, ERG3 and ERG11, involved in ergosterol biosynthetic pathway, are all upregulated by Rpn4 in fluconazole stressed cells, a pathway that may underlie the role of Rpn4 as a fluconazole resistance determinant. Interestingly, Rpn4 had been found to be a positive regulator of Erg1190 and Erg2491, in S. cerevisiae, by microarray analysis. Besides that, ChIP-on-chip analysis showed that S. cerevisiae Rpn4 binds to the promoter region of other ergosterol biosynthetic genes, namely ERG4, ERG6, ERG26 and ERG2892. A complementary approach was developed by RT-PCR to confirm the RNA-sequencing results. The results obtained in the presence of fluconazole confirmed the regulation of CgERG11 by CgRpn4. For that reason, and to understand the influence of this transcription factor in ergosterol biosynthesis, the intracellular ergosterol content was assessed. Consistently, the ergosterol concentration in Δrpn4 deletion mutant cells was found to be significantly lower upon prolonged exposure to fluconazole, when compared to that of the wild-type strain. In conclusion, Rpn4 is proposed to be important for the maintenance of adequate membrane properties under fluconazole stress, being essential to preserve the physiological function of the cell membrane as a selective barrier, notably to control the accumulation of fluconazole. Comparatively, CgMrr1 controls the expression of genes involved in lipid metabolism, which may represent the role of CgMrr1 in fluconazole resistance. These include genes associated to sterol transfer (LAM1, LAM5 and LAM6) and phospholipid/sphingolipid biosynthesis (RSB1, YPC1, NTE1 and OPI10), whose action is hypothesized to contribute to fluconazole resistance. CgMrr1 was found not to display a clear conservation of function, when compared to its closest homologs in S. cerevisiae, Hap1, or in C. albicans, Mrr1. Nonetheless, both ScHap1 and CaMrr1 control the expression of some lipid related genes. Indeed, Hap1 had been found to be a positive regulator of Erg2, Erg5, Erg8, Erg13 and Erg29, in S. cerevisiae, by microarray analysis93. Besides, ChIP-on-chip analysis showed that S. cerevisiae Hap1 binds directly to many mevalonate and ergosterol biosynthesis genes: ERG1, ERG10, ERG11, ERG25, ERG26, ERG28, ERG3, ERG6 and ERG992. Also, ChIP analysis showed that C. albicans Mrr1 binds to the promoter region of two ergosterol biosynthetic genes, namely ERG3 and ERG5, and RTA2 (S. cerevisiae ortholog RSB1) and YDC1 (S. cerevisiae ortholog YPC1) which are involved in sphingolipid metabolism79. As described, CgMrr1 regulates genes involved in sphingolipid biosynthesis. Curiously, since the biological functions of fungal sphingolipids have been studied almost exclusively in nonpathogenic fungi such as S. cerevisiae, the role of sphingolipids in fungal infections are not well characterized94. Besides that, it was observed that iron deficiency enhanced membrane fluidity through the alteration of membrane lipids and sphingolipid homeostasis, and increased also the passive diffusion of drugs, having an impact on C. albicans infections95. The inhibition of these two pathways leads to an alteration of lipid rafts distribution and cell morphology that could affect intracellular signaling and 40

efflux machinery, allowing the entrance of drugs28,96. It will be interesting to assess the effect of Mrr1 in sphingolipid content and whether that may affect fluconazole resistance. The composition of phospholipids, sphingolipids, and sterols in the plasma membrane have a massive impact on its properties, such as permeability and fluidity. Accordingly, the plasma membrane permeability and the accumulation of fluconazole radiolabeled inside the cells were assessed in wild- type and in the absence of Rpn4 and Mrr1. Both Δrpn4 and Δmrr1 deletion mutants contribute to a higher permeability to the fluorescence compound propidium iodide, and to an increase fluconazole accumulation, meaning that plasma membrane, without these two genes, becomes more permeable. These results demonstrate the impact of Rpn4 and Mrr1 in plasma membrane properties in the presence of fluconazole, suggesting that these two transcription factors are able to control the lipid composition of plasma membrane. In conclusion, the results obtained suggest that CgRpn4 and CgMrr1 are determinants for the stability and composition of plasma membrane, preventing fluconazole intracellular accumulation, and emphasize the importance of the cell membrane in modulating the response to azole drugs. Regarding the transcription factor Rpn4, besides its role in the control of ergosterol biosynthetic genes, it is possible to speculate on a possible effect of C. glabrata Rpn4 in the control of fluconazole resistance through its physiological role: the control of proteasomal activity. In fact, in S. cerevisiae RPN4 is regulated by Pdr1p and Pdr3p, and by Yap1p, that play an important role in multidrug resistance. Indirectly, thus, the ubiquitin–proteasome system is controlled by transcriptional regulators of multidrug resistance (Pdr1p, Pdr3p and Yap1p) via RPN4 expression69. In our study, CgYap1 was also found to control the expression of CgRPN4 in fluconazole stressed cells. Furthermore, fluconazole seems to have an impact on the fungal wall integrity and causes changes in the proteome of the wall of C. albicans, possibly due to transcript instability or translation inefficiency97. This finding can justify the need for protein degradation and, consequently, the recruitment of proteasome genes regulated by Rpn4. So, the ubiquitin–proteasome system is also likely to play a possible role in the defense against cellular damage caused by fluconazole. In this work we demonstrate the importance of the transcription factor Rpn4 as a determinant of resistance to fluconazole, through ergosterol biosynthesis. RPN4 expression was found to be essential to maintain ergosterol content in plasma membrane and its physical properties, since it is important to respond fluconazole-induced decrease of ergosterol content and increase in membrane permeability and accumulation of fluconazole within cells in the absence of RPN4. Beyond that, in the case of transcription factor Mrr1, we provide evidence to suggest that phospholipid/sphingolipid metabolism and/or sterol transfer are required for fluconazole response as demonstrated by RNA-seq data and in the increase of membrane permeability and fluconazole accumulation inside the cells in the MRR1 deletion mutant. However, and as discussed above, Mrr1 appears to have a function somewhere between ScHap1 and CaMrr1. On the one hand it was not clarified by our results that CgMrr1 maintained the physiological role of ScHap1, not being directly involved in the response to oxygen deprivation or respiration. On the other hand, CgMrr1 also does not appear to play the role of CaMrr1 in azole resistance because it does not directly regulate the expression of multidrug

transporters. Nevertheless, the results obtained suggest that CgMrr1 confers resistance to azoles through the control of plasma membrane composition and function. Ultimately, with this project, new drug targets and drug resistance mechanisms were identified, providing the guidelines for more efficient therapeutic choices.

Figure 3.17 – Model of CgRPN4 and CgMRR1 regulation and action in C. glabrata under fluconazole

exposure. Azole drug exposure activates the pleiotropic drug resistance regulator CgPDR1, which besides

regulates its own expression induces the expression of drug transporters such as ABC transporters. Recently,

it was demonstrated that CgYAP1 also induce the expression of multidrug transporters. These two drug responsive genes activate the expression of the transcription factor CgRPN4 which activates proteasomal genes, such as in S. cerevisiae. In turn, the assembled proteasome degrades CgRpn4, in order to maintain a negative feedback loop (dark blue dashed line) to control proteome homeostasis and expression of Rpn4 target genes. Besides proteasome genes, CgRpn4 regulates the expression of genes involved in ergosterol biosynthesis, as possible determinant in azole resistance. CgPDR1 also activate the expression of CgMrr1 transcription factor, which regulates the expression of genes involved in sphingolipid biosynthesis. Possible transcriptional mechanisms through which CgRpn4 and CgMrr1 expression influences C. glabrata resistance

toward azole antifungals are highlighted in a dashed blue box.

Figure 3.14 – Propidium iodide fluorescence in wild-type and deletion mutants Δrpn4 and Δmrr1 in control

and fluconazole stress conditions. Distribution of propidium iodide fluorescence intensity cell by cell of the wild-type (⚫ dark gray) and deletion mutants Δrpn4 (⚫ gray) and Δmrr1 (⚫ light gray) in absence () or presence (⚫) of fluconazole (250 mg/L). Error bars represent the corresponding standard deviations. 42 Statistical analysis was made based on one-way ANOVA with multiple comparisons. *p < 0,05; ****p ≤ 0,0001.

In terms of future perspectives, this study provides interesting working hypothesis, especially considering the action of the transcription factors in the ergosterol biosynthetic and sphingolipid/phospholipid biosynthesis pathways, respectively. In order to further analyze which genes are regulated by CgRPN4 through direct transcription factor binding, a ChIP-seq approach should be applied, using a CgRPN4-myc expression plasmid, whose construction was prepared under this thesis. This technology combines chromatin immunoprecipitation with Next Generation Sequencing (NGS) tools. This method will allow the identification of specific Rpn4 targets, being, at the moment, ERG genes the most promising. Besides that, another experience that must be done is the study of the role of CgRpn4 in in vivo resistance to fluconazole, eventually using the Galleria mellonella infection model. Regarding CgMrr1, in order to see the influence of some genes described as upregulated by Mrr1 under fluconazole stress, the subcellular localization of dihydroshingosine (DHS), an intermediate of sphingolipid biosynthesis, in wild-type and in the absence of the encoding genes LAM1, LAM5, LAM6, RSB1, YPC1, NTE1 and OPI10 should be evaluated. Also, since Mrr1 seems to be involved in sphingolipid metabolism it may be important complete the experiences done with a combination of fluconazole and myriocin, in order to verify whether this pathway is effectively the one by which Mrr1 confers resistance to fluconazole. To ascertain this, the susceptibility of the wild-type and Δmrr1 deletion mutant can be verified using a sphingolipid pathway inhibitor compound (myriocin or fumonisin B1), and a combination of it with fluconazole to see if they have any synergistic effect. Further studies need to be performed in the context of azole drug resistance, especially as it becomes clear that drug resistance is not based on one or two pathways, but on a multifactorial and complex process in which each step must be considered in the design of better suitable ways to fight fungal infections.

5. References

1. Mayers, D. L. Epidemiology and antifungal resistance in invasive candidiasis. Eur. J. Med. Res. 16, 299 (2009).

2. Low, C.-Y. & Rotstein C. Emerging fungal infections in immunocompromised patients. F1000 Med. Rep. 3, 1–8 (2011).

3. Diezmann, S. et al. Phylogeny and Evolution of Medical Species of Candida and Related Taxa: a Multigenic Analysis. Microbiology 42, 5624–5635 (2004).

4. Pfaller, M. A. et al. In vitro antifungal susceptibilities of isolates of Candida spp. and Aspergillus spp. from China to nine systemically active antifungal agents: Data from the SENTRY antifungal surveillance program, 2010 through 2012. Mycoses 58, 209–214 (2015).

5. Pais, P. et al. Transcriptional Control of Drug Resistance, Virulence and Immune System Evasion in Pathogenic Fungi: A Cross-Species Comparison. Front. Cell. Infect. Microbiol. 6, (2016).

6. Wisplinghoff, H. et al. Inflammatory response and clinical course of adult patients with nosocomial bloodstream infections caused by Candida spp. Clin. Microbiol. Infect. 12, 170–7 (2006).

7. Sanglard, D. et al. Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters. Antimicrob. Agents Chemother. 39, 2378–2386 (1995).

8. Morschhäuser, J. The genetic basis of fluconazole resistance development in Candida albicans. Biochim. Biophys. Acta 1587, 240–8 (2002).

9. Tscherner, M. et al. Pathogenesis and Antifungal Drug Resistance of the Human Fungal Pathogen Candida glabrata. Pharmaceuticals 4, 169–186 (2011).

10. Anderson H. W. Yeast-Like Fungi of the Human Intestinal Tract. The Journal of Infectious Diseases, Vol . 21 , No. 4 (Oct ., 1917), pp . 341-386 Published by: Oxford University Press Stable URL : https://www.jstor.org/stab. Oxford J. 21, 341–386 (1917).

11. Bolotin-Fukuhara, M. & Fairhead, C. Candida glabrata: a deadly companion? Yeast 31, 279– 288 (2014).

12. Kurtzman, C. P. & Robnett, C. J. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie Van Leeuwenhoek 73, 331–371 (1998).

13. Fitzpatrick, D. A. et al. A fungal phylogeny based on 42 complete genomes derived from supertree and combined gene analysis. BMC Evol. Biol. 6, 99 (2006).

14. Butler, G. et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459, 657–62 (2009).

15. Vermitsky, J.-P. et al. Pdr1 regulates multidrug resistance in Candida glabrata: gene disruption and genome-wide expression studies. Mol. Microbiol. 61, 704–722 (2006).

16. Weig, M. et al. Systematic identification in silico of covalently bound cell wall proteins and analysis of protein-polysaccharide linkages of the human pathogen Candida glabrata. 44

Microbiology 150, 3129–3144 (2004).

17. Roy, S. & Thompson, D. Evolution of regulatory networks in Candida glabrata: learning to live with the human host. FEMS Yeast Res. 15, fov087 (2015).

18. Vazquez, J. A. et al. Nosocomial Candida glabrata colonization: An epidemiologic study. J. Clin. Microbiol. 36, 421–426 (1998).

19. Pfaller, M. A. et al. Regional data analysis of Candida non-albicans strains collected in United States medical sites over a 6-year period, 2006-2011. Mycoses 57, 602–611 (2014).

20. Oxman, D. A. et al. Candidaemia associated with decreased in vitro fluconazole susceptibility: is Candida speciation predictive of the susceptibility pattern? doi:10.1093/jac/dkq136

21. Vandeputte, P. et al. T. Antifungal resistance and new strategies to control fungal infections. Int. J. Microbiol. 2012, (2012).

22. Goldman, M. et al. Does long-term itraconazole prophylaxis result in in vitro azole resistance in mucosal Candida albicans isolates from persons with advanced human immunodeficiency virus infection? Antimicrob. Agents Chemother. 44, 1585–1587 (2000).

23. Oliver, B. G. et al. cis-Acting Elements within the Candida albicans ERG11 promoter mediate the azole response through transcription factor Upc2p. Eukaryot. Cell 6, 2231–2239 (2007).

24. lè ne Ferrari, S. et al. Gain of Function Mutations in CgPDR1 of Candida glabrata not only mediate antifungal resistance but also enhance virulence. Lazzaro Spallanzani’’ (Strategic Res. Progr. (2006). doi:10.1371/journal.ppat.1000268

25. Vermitsky, J.-P. & Edlind, T. D. Azole Resistance in Candida glabrata: Coordinate upregulation of multidrug transporters and evidence for a Pdr1-Like transcription factor. Antimicrob. Agents Chemother. 48, 3773–3781 (2004).

26. Bard, M. et al. Sterol uptake in Candida glabrata: Rescue of sterol auxotrophic strains. Diagn. Microbiol. Infect. Dis. 52, 285–293 (2005).

27. Kaur, R. et al. Functional genomic analysis of fluconazole susceptibility in the pathogenic yeast Candida glabrata: roles of calcium signaling and mitochondria. Antimicrob. Agents Chemother. 48, 1600–13 (2004).

28. Hull, C. M. et al. Facultative sterol uptake in an ergosterol-deficient clinical isolate of Candida glabrata harboring a missense mutation in ERG11 and exhibiting cross-resistance to azoles and amphotericin B. Antimicrob. Agents Chemother. 56, 4223–32 (2012).

29. Brun, S. et al. Mechanisms of azole resistance in petite mutants of Candida glabrata. Antimicrob. Agents Chemother. 48, 1788–96 (2004).

30. Lewis, R. E. Current concepts in antifungal pharmacology. Mayo Clin. Proc. 86, 805–817 (2011).

31. Mast, N. et al. Antifungal Azoles: Structural insights into undesired tight binding to cholesterol- metabolizing CYP46A1. Mol. Pharmacol. 84, 86–94 (2013).

32. Humphrey, M. J. et al. Pharmacokinetic Evaluation of UK-49, 858, a metabolically stable triazole antifungal drug, in animals and humans. Antimicrob. Agents Chemother. 28, 648–653 (1985).

33. Hector, R. F. An overview of antifungal drugs and their use for treatment of deep and superficial mycoses in animals. Clin. Tech. Small Anim. Pract. 20, 240–249 (2005).

34. Brun, S. et al. Relationships between respiration and susceptibility to azole antifungals in Candida glabrata. Antimicrob. Agents Chemother. 47, 847–53 (2003).

35. Marichal, P. et al. Contribution of mutations in the cytochrome P450 14α-demethylase (Erg11p, Cyp51p) to azole resistance in Candida albicans. Microbiology 145, 2701–2713 (1999).

36. Bennett, J. E. et al. Mechanism of increased fluconazole resistance in Candida glabrata during prophylaxis. Antimicrob. Agents Chemother. 48, 1773–1777 (2004).

37. Izumikawa, K. et al. Function of Candida glabrata ABC transporter gene, PDH1. Yeast 20, 249–261 (2003).

38. Torelli, R. et al. The ATP-binding cassette transporter-encoding gene CgSNQ2 is contributing to the CgPDR1-dependent azole resistance of Candida glabrata. Mol. Microbiol. 68, 186–201 (2008).

39. Costa, C. et al. Candida glabrata Drug:H+ Antiporter CgQdr2 confers imidazole drug resistance, being activated by transcription factor CgPdr1. doi:10.1128/AAC.00811-12

40. Costa, C. et al. Candida glabrata Drug:H+ Antiporter CgTpo3 (ORF CAGL0I10384g): role in azole drug resistance and polyamine homeostasis. doi:10.1093/jac/dku044

41. Teixeira, M. C. et al. Clotrimazole drug resistance in Candida glabrata clinical isolates correlates with increased expression of the drug:H+ antiporters CgAqr1, CgTpo1_1, CgTpo3, and CgQdr2. (2016). doi:10.3389/fmicb.2016.00526

42. Pais, P. et al. Membrane proteome-wide response to the antifungal drug clotrimazole in Candida glabrata: role of the transcription factor CgPdr1 and the drug:H+ antiporters CgTpo1_1 and CgTpo1_2. doi:10.1074/mcp.M114.045344

43. Pais, P. et al. Membrane proteomics analysis of the Candida glabrata response to 5- flucytosine: unveiling the role and regulation of the drug efflux transporters CgFlr1 and CgFlr2. Front. Microbiol. 7, 2045 (2016).

44. Redding, S. W. et al. Multiple patterns of resistance to fluconazole in Candida glabrata isolates from a patient with oropharyngeal candidiasis receiving head and neck radiation. J. Clin. Microbiol. 41, 619–22 (2003).

45. Liu, T. T. et al. Genome-wide expression and location analyses of the Candida albicans Tac1p regulon. Eukaryot. Cell 6, 2122–2138 (2007).

46. Morschhäuser, J. Regulation of multidrug resistance in pathogenic fungi. Fungal Genet. Biol. 47, 94–106 (2010).

47. Cheng, S. et al. A Candida albicans petite mutant strain with uncoupled oxidative phosphorylation overexpresses MDR1 and has diminished susceptibility to fluconazole and voriconazole. Antimicrob. Agents Chemother. 51, 1855–8 (2007).

48. Bossche, H. V. et al. Characterization of an azole-resistant Candida glabrata isolate. Antimicrob. Agents Chemother. 36, 2602–2610 (1992).

49. Lopez-Ribot, J. L. et al. Distinct patterns of gene expression associated with development of fluconazole resistance in serial Candida albicans isolates from human immunodeficiency virus- infected patients with oropharyngeal candidiasis. Antimicrob. Agents Chemother. 42, 2932–7 (1998).

50. Ribeiro, M. A. & Paula, C. R. Up-regulation of ERG11 gene among fluconazole-resistant Candida albicans generated in vitro: is there any clinical implication? Diagn. Microbiol. Infect. 46

Dis. 57, 71–75 (2007).

51. MacPherson, S. et al. Candida albicans zinc cluster protein Upc2p confers resistance to antifungal drugs and is an activator of ergosterol biosynthetic genes. Antimicrob. Agents Chemother. 49, 1745–1752 (2005).

52. Zavrel, M. et al. Comparison of sterol import under aerobic and anaerobic conditions in three fungal species, Candida albicans, Candida glabrata, and Saccharomyces cerevisiae. Eukaryot. Cell 12, 725–738 (2013).

53. Marichal, P. et al. Molecular biological characterization of an azole-resistant Candida glabrata isolate. 41, 2229–2237 (1997).

54. Morio, F. et al. Screening for amino acid substitutions in the Candida albicans Erg11 protein of azole-susceptible and azole-resistant clinical isolates: new substitutions and a review of the literature. Diagn. Microbiol. Infect. Dis. 66, 373–384 (2010).

55. Katarzyna Strzelczyk et al. Nucleotide substitutions in the Candida albicans ERG11 gene of azole-susceptible and azole-resistant clinical isolates. (2013).

56. Sanglard, D. et al. Amino acid substitutions in the cytochrome P-450 lanosterol 14α- demethylase (CYP51A1) from azole-resistant Candida albicans clinical isolates contribute to resistance to azole antifungal agents. Antimicrob. Agents Chemother. 42, 241–253 (1998).

57. Chau, A. S. et al. Application of real-time quantitative PCR to molecular analysis of Candida albicans strains exhibiting reduced susceptibility to azoles. Antimicrob. Agents Chemother. 48, 2124–31 (2004).

58. Martel, C. M. et al. Identification and characterization of four azole-resistant erg3 mutants of Candida albicans. Antimicrob. Agents Chemother. 54, 4527–4533 (2010).

59. Kelly, S. L. et al. Resistance to fluconazole and cross-resistance to amphotericin B in Candida albicans from AIDS patients caused by defective sterol Δ5,6-desaturation. FEBS Lett. 400, 80– 82 (1997).

60. Geber, A. et al. Deletion of the Candida glabrata ERG3 and ERG11 genes: effect on cell viability, cell growth, sterol composition, and antifungal susceptibility. Antimicrob. Agents Chemother. 39, 2708–17 (1995).

61. Yoo, J. Il et al. Gene expression and identification related to fluconazole resistance of Candida glabrata strains. Osong public Heal. Res. Perspect. 1, 36–41 (2010).

62. Hitchcock, C. A. et al. Fluconazole resistance in Candida glabrata. Antimicrob. Agents Chemother. 37, 1962–1965 (1993).

63. Nakayama, H. et al. The Candida glabrata putative sterol transporter gene CgAUS1 protects cells against azoles in the presence of serum. J. Antimicrob. Chemother. 60, 1264–1272 (2007).

64. Ferrari, S. et al. Loss of mitochondrial functions associated with azole resistance in Candida glabrata results in enhanced virulence in mice. Antimicrob. Agents Chemother. 55, 1852–1860 (2011).

65. Franz, R. et al. Multiple molecular mechanisms contribute to a stepwise development of fluconazole resistance in clinical Candida albicans strains. Antimicrob. Agents Chemother. 42, 3065–3072 (1998).

66. Caudle, K. E. et al. Genomewide expression profile analysis of the Candida glabrata Pdr1 47

Regulon. Eukaryot. Cell 10, 373–383 (2011).

67. Paul, S et al. Regulation of the CgPdr1 transcription factor from the pathogen Candida glabrata. 10, 187–197 (2011).

68. Tsai, H.-F. et al. Candida glabrata PDR1, a transcriptional regulator of a pleiotropic drug resistance network, mediates azole resistance in clinical isolates and petite mutants. Antimicrob. Agents Chemother. 50, 1384–1392 (2006).

69. Owsianik, G. et al. Control of 26S proteasome expression by transcription factors regulating multidrug resistance in Saccharomyces cerevisiae. Mol. Microbiol. 43, 1295–1308 (2002).

70. Coste, A. T. et al. Functional analysis of cis-and trans-acting elements of the Candida albicans CDR2 promoter with a novel promoter reporter system. Eukaryot. Cell 8, 1250–1267 (2009).

71. Morschhä User, J. et al. The transcription factor Mrr1p controls expression of the MDR1 efflux pump and mediates multidrug resistance in Candida albicans. doi:10.1371/journal.ppat.0030164

72. Schillig, R. & Morschhäuser, J. Analysis of a fungus-specific transcription factor family, the Candida albicans zinc cluster proteins, by artificial activation. Mol. Microbiol. 89, 1003–1017 (2013).

73. Monteiro, P. T. et al. The PathoYeastract database: an information system for the analysis of gene and genomic transcription regulation in pathogenic yeasts. (2016). Available at: http://www.pathoyeastract.org/cite.php. (Accessed: 17th January 2018)

74. Chen, K.-H. et al. The bZip transcription factor CgAp1p is involved in multidrug resistance and required for activation of multidrug transporter gene CgFLR1 in Candida glabrata. Gene 386, 63–72 (2007).

75. Heilmann, C. J. et al. An A643T Mutation in the Transcription Factor Upc2p Causes Constitutive ERG11 Upregulation and Increased Fluconazole Resistance in Candida albicans. Antimicrob. Agents Chemother. 54, 353–359 (2010).

76. Nagi, M. et al. Transcription factors CgUPC2A and CgUPC2B regulate ergosterol biosynthetic genes in Candida glabrata. Genes to Cells 16, 80–89 (2011).

77. Monteiro, P. T. et al. YEASTRACT-DISCOVERER: new tools to improve the analysis of transcriptional regulatory associations in Saccharomyces cerevisiae. (2008). Available at: http://www.yeastract.com/discoverer/cite.php. (Accessed: 17th January 2018)

78. Salin, H. et al. Structure and properties of transcriptional networks driving selenite stress response in yeasts. BMC Genomics 9, 333 (2008).

79. Schubert, S. et al. Regulation of efflux pump expression and drug resistance by the transcription factors Mrr1, Upc2, and Cap1 in Candida albicans. Antimicrob. Agents Chemother. 55, 2212–23 (2011).

80. Tamura, K.-I. et al. A hap1 mutation in a laboratory strain of Saccharomyces cerevisiae results in decreased expression of ergosterol-related genes and cellular ergosterol content compared to sake yeast. J. Biosci. Bioeng. 98, 159–166 (2004).

81. Davies, B. S. J. & Rine, J. A role for sterol levels in oxygen sensing in Saccharomyces cerevisiae. Genetics 174, 191–201 (2006).

82. Jiang, H. et al. Skewer: a fast and accurate adapter trimmer for next-generation sequencing paired-end reads. BMC Bioinformatics 15, (2014). 48

83. Trapnell, C. et al. TopHat: discovering splice junctions with RNA-Seq. Bioinforma. Orig. Pap. 25, 1105–1111 (2009).

84. Anders, S. & Huber, W. Differential expression analysis for sequence count data. doi:10.1186/gb-2010-11-10-r106

85. Love, M. I. et al. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).

86. Gentleman, R. C. et al. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5, R80 (2004).

87. Keng, T. HAP1 and ROX1 form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 2616–23 (1992).

88. Kwast, K. E. et al. Oxygen sensing and the transcriptional regulation of oxygen-responsive genes in yeast. J. Exp. Biol. 201, 1177–95 (1998).

89. Merhej, J. et al. A network of paralogous stress response transcription factors in the human pathogen Candida glabrata. Front. Microbiol. 7, 645 (2016).

90. Kruegel, U. et al. Elevated proteasome capacity extends replicative lifespan in Saccharomyces cerevisiae. PLoS Genet. 7, e1002253 (2011).

91. Haugen, A. C. et al. Integrating phenotypic and expression profiles to map arsenic-response networks. Genome Biol. 5, R95 (2004).

92. Harbison, C. T. et al. Transcriptional regulatory code of a eukaryotic genome. Nature 431, 99– 104 (2004).

93. Jaehnig, E. J. et al. Checkpoint kinases regulate a global network of transcription factors in response to DNA damage. Cell Rep. 4, 174–188 (2013).

94. Mukhopadhyay, K. et al. Membrane sphingolipid-ergosterol interactions are important determinants of multidrug resistance in Candida albicans. Antimicrob. Agents Chemother. 48, 1778–87 (2004).

95. Hameed, S. et al. Calcineurin signaling and membrane lipid homeostasis regulates iron mediated multidrug resistance mechanisms in Candida albicans. PLoS One 6, e18684 (2011).

96. Rollin-Pinheiro, R. et al. Sphingolipids as targets for treatment of fungal infections. Future Med. Chem. 8, 1469–84 (2016).

97. Sorgo, A. G. et al. Effects of fluconazole on the secretome, the wall proteome, and wall integrity of the clinical fungus Candida albicans †. Eukaryot. Cell 10, 1071–1081 (2011).

6. Annexe

Figure A1 – Genes upregulated and downregulated under fluconazole stress in C. glabrata. Multidrug transporter of ATP-binding cassette (ABC) superfamily, involved in Multidrug CDR1 resistance to azoles; expression regulated by Pdr1p; increased abundance in azole 0,8065023 Resistance (CAGL0M01760g) resistant strains; expression increased by loss of the mitochondrial genome C-8 sterol isomerase; catalyzes isomerization of delta-8 double bond to delta-7 ERG2 position at an intermediate step in ergosterol biosynthesis; transcriptionally down- ERG2 1,0972549 (CAGL0L10714g) regulated when ergosterol is in excess; mutation is functionally complemented by human EBP C-5 sterol desaturase; glycoprotein that catalyzes the introduction of a C-5(6) double bond into episterol, a precursor in ergosterol biosynthesis; transcriptionally down- ERG3 ERG3 regulated when ergosterol is in excess; mutants are viable, but cannot grow on non- 1,0733875 (CAGL0F01793g) fermentable carbon sources; substrate of HRD ubiquitin ligase; mutation is functionally complemented by human SC5D Lanosterol 14-alpha-demethylase; catalyzes C-14 demethylation of lanosterol to

form 4,4''-dimethyl cholesta-8,14,24-triene-3-beta-ol in ergosterol biosynthesis ERG11 pathway; transcriptionally down-regulated when ergosterol is in excess; member of ERG11 0,9626237 (CAGL0E04334g) cytochrome P450 family; associated and coordinately regulated with the P450 reductase Ncp1p; human CYP51A1 functionally complements the lethality of the erg11 null mutation ERG4 C-24(28) sterol reductase; catalyzes the final step in ergosterol biosynthesis; ERG4 0,8290095 (CAGL0A00429g) mutants are viable, but lack ergosterol Sterolmetabolism Squalene epoxidase; catalyzes the epoxidation of squalene to 2,3-oxidosqualene; ERG1 plays an essential role in the ergosterol-biosynthesis pathway and is the specific ERG1 0,8260892 (CAGL0D05940g) target of the antifungal drug terbinafine; human SQLE functionally complements the lethality of the erg1 null mutation C-22 sterol desaturase; a cytochrome P450 enzyme that catalyzes the formation of ERG5 ERG5 the C-22(23) double bond in the sterol side chain in ergosterol biosynthesis; may be 0,5759418 (CAGL0M07656g) a target of azole antifungal drugs Delta(24)-sterol C-methyltransferase; converts zymosterol to fecosterol in the ERG6 ergosterol biosynthetic pathway by methylating position C-24; localized to lipid ERG6 0,5180168 (CAGL0H04653g) particles, the plasma membrane-associated endoplasmic reticulum, and the mitochondrial outer membrane

Figure A1 – Genes upregulated and downregulated under fluconazole stress in C. glabrata (continued).

Log2 Fold change Functional C. glabrata protein S. cerevisiae Description of the function of the C. glabrata protein or of its S. cerevisiae (upon fluconazole Group (ORF) name homolog homolog stress) Protein implicated in the regulation of ergosterol biosynthesis; one of a seven member gene family with a common essential function and non-essential unique CAGL0J03916g HES1 functions; similar to human oxysterol binding protein (OSBP); SWAT-GFP and 1,4830175 mCherry fusion proteins localize to the bud neck and vacuolar membrane; HES1 has a paralog, KES1, that arose from the whole genome duplication C-14 sterol reductase; acts in ergosterol biosynthesis; mutants accumulate the

CAGL0I02970g ERG24 abnormal sterol ignosterol (ergosta-8,14 dienol), and are viable under anaerobic 0,5324419

growth conditions but inviable on rich medium under aerobic conditions C-4 methyl sterol oxidase; catalyzes the first of three steps required to remove two C-4 methyl groups from an intermediate in ergosterol biosynthesis; mutants CAGL0K04477g ERG25 accumulate the sterol intermediate 4,4-dimethylzymosterol; human MSMO1 1,0240006 functionally complements the growth defect caused by repression of ERG25 expression

Sterolmetabolism Protein of unknown function involved in ergosterol biosynthesis; conditional mutants produce less ergosterol, display impaired oxygen consumption, respiratory growth, mitochondrial iron utilization, and are more sensitive to oxidative stress; mutant bm- CAGL0K03927g ERG29 0,8361261 8 has a growth defect on iron-limited medium that is complemented by overexpression of Yfh1p; protein localizes to the cytoplasm, ER and nuclear envelope; highly conserved in ascomycetes Cytochrome b5; involved in the sterol and lipid biosynthesis pathways; acts as an CAGL0L03828g CYB5 0,7296088 electron donor to support sterol C5-6 desaturation Ortholog(s) have role in fatty acid beta-oxidation, long-chain fatty acid catabolic CAGL0A03740g -0,5347719 process and peroxisome localization Type II nitroreductase, using NADH as reductant; mutants are defective in fatty acid mediated repression of genes involved in fatty acid biosynthesis indicative of a role HBN1 FRM2 in lipid signaling; involved in the oxidative stress response; transcription induction by -0,5122601 (CAGL0B00990g) cadmium and selenite indicates a possible role in the metal stress response; expression induced in cells treated with the mycotoxin patulin Phosphatidylinositol transfer protein; has a potential role in regulating lipid and fatty

Lipid Lipid metabolism acid metabolism under heme-depleted conditions; interacts specifically with CAGL0H05005g CSR1 0,5902783 thioredoxin peroxidase; may have a role in oxidative stress resistance; protein abundance increases in response to DNA replication stress Proline oxidase; nuclear-encoded mitochondrial protein involved in utilization of Nitrogen CAGL0M04499g PUT1 proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the 0,5672759 metabolism presence of proline and the absence of a preferred nitrogen source

Figure A1 – Genes upregulated and downregulated under fluconazole stress in C. glabrata (continued).

Log2 Fold change Functional C. glabrata protein S. cerevisiae Description of the function of the C. glabrata protein or of its S. cerevisiae (upon fluconazole Group (ORF) name homolog homolog stress) Ammonium permease involved in regulation of pseudohyphal growth; belongs to a Nitrogen MEP2 MEP2 ubiquitous family of cytoplasmic membrane proteins that transport only ammonium -0,5018768 metabolism (CAGL0J06028g) (NH4+); expression is under the nitrogen catabolite repression regulation Putative protein of unknown function; gene expression induced in response to CAGL0A01089g PBI1 2,1144200

ketoconazole; YPL272C is not an essential gene ATF2 Alcohol acetyltransferase; may play a role in steroid detoxification; forms volatile ATF2 0,7048963 (CAGL0D05918g) esters during fermentation, which is important for brewing and winemaking Malate synthase, enzyme of the glyoxylate cycle; involved in utilization of non- Carbon Carbon fermentable carbon sources; expression is subject to carbon catabolite repression; metabolism CAGL0L03982g MLS1 -0,5303309 localizes in peroxisomes during growth on oleic acid, otherwise cytosolic; can accept butyryl-CoA as acyl-CoA donor in addition to traditional substrate acetyl-CoA Has domain(s) with predicted ion channel activity, role in ion transport and CAGL0K07337g -0,6339653 membrane localization

ER localized heme oxygenase; involved in heme degradation during iron starvation HMX1 HMX1 and in the oxidative stress response; expression is regulated by AFT1 and oxidative -0,6210610 (CAGL0A03905g) stress; relocates to the perinuclear region in the presence of oxidants Protoporphyrinogen oxidase; a mitochondrial enzyme that catalyzes the seventh CAGL0H09504g HEM14 step in the heme biosynthetic pathway, converting protoporphyrinogen IX to 0,5051515 protoporphyrin IX; inhibited by diphenyl ether-type herbicides

Coproporphyrinogen III oxidase; oxygen-requiring enzyme that catalyzes sixth step Ion homeostasis Ion in heme biosynthetic pathway; transcription is repressed by oxygen and heme (via CAGL0K12100g HEM13 0,8130766 Rox1p and Hap1p); human homolog CPOX can complement yeast mutant and allow growth of haploid null after sporulation of a heterozygous diploid Stabilizes or regulates formation of respiratory chain supercomplexes composed of Mitochondria/ CAGL0B01875g COX26 Complex III (ubiquinol-cytochrome c reductase) and Complex IV (cytochrome c -0,6365495 Respiration oxidase)

Protein involved in 7-aminocholesterol resistance; has seven potential membrane- RTA1 spanning regions; expression is induced under both low-heme and low-oxygen RTA1 0,8006097 (CAGL0K00715g) conditions; member of the fungal lipid-translocating exporter (LTE) family of protein; RTA1 has a paralog, YLR046C, that arose from the whole genome duplication Heat shock protein that is highly induced upon stress; plays a role in SRP- SSA3 dependent cotranslational protein-membrane targeting and translocation; member of SSA4 -0,5466926 (CAGL0G03289g) the HSP70 family; cytoplasmic protein that concentrates in nuclei upon starvation; StressResponse SSA4 has a paralog, SSA3, that arose from the whole genome duplication

Figure A1 – Genes upregulated and downregulated under fluconazole stress in C. glabrata (continued).

Log2 Fold change Functional C. glabrata protein S. cerevisiae Description of the function of the C. glabrata protein or of its S. cerevisiae (upon fluconazole Group (ORF) name homolog homolog stress) Protein that recognizes and binds damaged DNA during NER; subunit of Nucleotide CAGL0L10692g RAD14 Excision Repair Factor 1 (NEF1); contains zinc finger motif; homolog of human XPA 0,5198845 protein; NER stands for nucleotide excision repair Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes CAGL0F08965g MSC7 to the endoplasmic reticulum; msc7 mutants are defective in directing meiotic 0,8805479 recombination events to homologous chromatids Integral membrane protein localized to mitochondria; required for sporulation and CAGL0G05566g FMP45 maintaining sphingolipid content; similar to SUR7; FMP45 has a paralog, YNL194C, -0,6941870 that arose from the whole genome duplication Transcriptional repressor; binds promoter sequences of cyclin genes, CYS3, and SMF2; not expressed during log phase of growth, but induced by stress or starvation

during mitosis, and late in meiosis; represses 15% of all yeast genes as cells CAGL0G02739g XBP1 -0,6508527 transition to quiescence; important for maintaining G1 arrest and for longevity of quiescent cells; member of Swi4p/Mbp1p family; phosphorylated by Cdc28p; relative distribution to nucleus increases upon DNA replication stress Cell cycle Cell Protein of unknown function; contains transmembrane domains; involved in secretion of proteins that lack classical secretory signal sequences; component of CAGL0L08448g NCE102 -0,5471809 the detergent-insoluble glycolipid-enriched complexes (DIGs); NCE102 has a paralog, FHN1, that arose from the whole genome duplication Effector of Rab GTPase Sec4p; forms a complex with Sec4p and t-SNARE Sec9p; involved in exocytosis and docking and fusion of post-Golgi vesicles with plasma SRO7 SRO7 membrane; regulates cell proliferation and colony development via the Rho1-Tor1 0,5138041 (CAGL0K05291g) pathway; homolog of Drosophila lgl tumor suppressor; SRO7 has a paralog, SRO77, that arose from the whole genome duplication Has domain(s) with predicted sequence-specific DNA binding, transcription factor CAGL0L06776g activity, sequence-specific DNA binding, zinc ion binding activity and role in 0,8508254 regulation of transcription, DNA-templated

Figure A1 – Genes upregulated and downregulated under fluconazole stress in C. glabrata (continued).

Log2 Fold change Functional C. glabrata protein S. cerevisiae Description of the function of the C. glabrata protein or of its S. cerevisiae (upon fluconazole Group (ORF) name homolog homolog stress) Protein of unknown function, contains a SET domain; SET4 has a paralog, SET3, CAGL0G04499g SET4 1,1350276 that arose from the whole genome duplication CAGL0L08547g Protein of unknown function 0,7602750 CAGL0A02277g Protein of unknown function -0,7200877 MUP1 Protein of unknown function -0,7802553 (CAGL0B02838g) Protein of unknown function that localizes to lipid particles; localization suggests a role in lipid metabolism; expression pattern suggests a role in respiratory growth; CAGL0M05995g PET10 -0,5087981 computational analysis of large-scale protein-protein interaction data suggests a role in ATP/ADP exchange Putative protein of unknown function; YDL218W transcription is regulated by Azf1p CAGL0G05632g YDL218W and induced by starvation and aerobic conditions; expression also induced in cells -0,5238937 Unknownfunction treated with the mycotoxin patulin CAGL0G00594g 0,6143595 Putative protein of unknown function; possible role in iron metabolism and/or amino CAGL0J00297g YHR045W acid and carbohydrate metabolism; green fluorescent protein (GFP)-fusion protein 0,6306120 localizes to the endoplasmic reticulum CAGL0M11660g Has domain(s) with predicted hydrolase activity 0,6706714

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata.

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Integral inner mitochondrial membrane protein; role in maintaining mitochondrial CAGL0M13761g YME2 nucleoid structure and number; mutants exhibit an increased rate of -0,519879001 mitochondrial DNA escape; shows some sequence similarity to exonucleases Protein that recognizes and binds damaged DNA during NER; subunit of

Cell cycle Cell CAGL0L10692g RAD14 Nucleotide Excision Repair Factor 1 (NEF1); contains zinc finger motif; homolog -0,534357546 of human XPA protein; NER stands for nucleotide excision repair

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Ortholog(s) have role in CENP-A containing chromatin organization and cytosol, CAGL0K09526g -0,539278517 nuclear chromatin, nuclear periphery localization Sorting nexin family member; required for the cytoplasm-to-vacuole targeting (Cvt) CAGL0H10428g ATG20 pathway and for endosomal sorting; has a Phox homology domain that binds -0,555657736 phosphatidylinositol-3-phosphate; interacts with Snx4p; potential Cdc28p substrate Subunit of the Ada histone acetyltransferase complex; required for structural integrity of the complex; Ahc2p and Ahc1p are unique to the ADA complex and not CAGL0E04488g AHC1 -0,559354566 shared with the related SAGA and SLIK complexes; Ahc2p may tether Ahc1p to the complex Protein of unknown function; green fluorescent protein (GFP)-fusion protein CAGL0F08965g MSC7 localizes to the endoplasmic reticulum; msc7 mutants are defective in directing -0,561596954 meiotic recombination events to homologous chromatids Protein with ubiquitin-like N terminus; subunit of Nuclear Excision Repair Factor 2 (NEF2) with Rad4p that binds damaged DNA; enhances protein deglycosylation

CAGL0L01309g RAD23 activity of Png1p; also involved, with Rad4p, in ubiquitylated protein turnover; -0,574521345 Rad4p-Rad23p heterodimer binds to promoters of DNA damage response genes to repress their transcription in the absence of DNA damage Probable DNA helicase; involved in sister-chromatid cohesion and genome cycle Cell integrity and interstrand cross-link repair; interacts with ECO1 and CTF18; mutants CAGL0L08844g CHL1 are defective in silencing, rDNA recombination, aging and the heat shock -0,606482840 response; FANCJ-like helicase family member; mutations in the human homolog, DDX11/ChLR1, cause Warsaw breakage syndrome Subunit of the CSN and 26S proteasome lid complexes; similar to mammalian p55 CAGL0I03674g RPN5 subunit and to another S. cerevisiae regulatory subunit, Rpn7p; Rpn5p is an -0,610327763 essential protein; the COP9 signalosome is also known as the CSN Regulatory subunit for Glc7p type-1 protein phosphatase (PP1); tethers Glc7p to

Gsy2p glycogen synthase, binds Hsf1p heat shock transcription factor, required for CAGL0H04037g GAC1 -0,650729332 induction of some HSF-regulated genes under heat shock; GAC1 has a paralog, PIG1, that arose from the whole genome duplication Zinc finger transcription factor; involved in the complex regulation of gene expression in response to levels of heme and oxygen; localizes to the CAGL0B03421g HAP1 -0,659298835 mitochondrion as well as to the nucleus; the S288C sequence differs from other strain backgrounds due to a Ty1 insertion in the carboxy terminus

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Essential non-ATPase regulatory subunit of the 26S proteasome; similar to CAGL0G01672g RPN7 another S. cerevisiae regulatory subunit, Rpn5p, as well as to mammalian -0,672305249 proteasome subunits Essential protein that promotes the first step of splicing; required for the final stages of spliceosome maturation and activation; interacts with Prp2p, which may CAGL0K09504g SPP2 -0,682628840 release Spp2p from the spliceosome following the first cleavage reaction; stimulates Prp2p ATPase activity Strand exchange protein; forms a helical filament with DNA that searches for homology; involved in the recombinational repair of double-strand breaks in DNA CAGL0I05544g RAD51 -0,703298595 during vegetative growth and meiosis; homolog of Dmc1p and bacterial RecA protein AAA ATPase; subunit of polyUb-selective segregase complex involved in ERAD, INM-associated degradation (INMAD), mitotic spindle disassembly, macroautophagy, PMN, ribosome-associated degradation, ribophagy, homotypic CDC48

CDC48 ER membrane fusion, SCF complex disassembly, cell wall integrity during heat -0,736833341 (CAGL0J09350g) stress, and telomerase regulation; mobilizes membrane-anchored transcription factors by regulated Ub/proteasome-dependent processing (RUP); human ortholog VCP complements a cdc48 mutant Cell cycle Cell CAGL0J05852g Ortholog(s) have role in secondary metabolite biosynthetic process -0,805206169 ATPase of the 19S regulatory particle of the 26S proteasome; one of six ATPases of the regulatory particle; involved in the degradation of ubiquitinated substrates; CAGL0E06490g RPT1 -0,839223638 required for optimal CDC20 transcription; interacts with Rpn12p and Ubr1p; mutant has aneuploidy tolerance Ubiquitin-conjugating enzyme (E2); involved in postreplication repair as a heterodimer with Rad18p, regulation of K63 polyubiquitination in response to oxidative stress, DSBR and checkpoint control as a heterodimer with Bre1p, CAGL0I00352g RAD6 -0,934668435 ubiquitin-mediated N-end rule protein degradation as a heterodimer with Ubr1p, ERAD with Ubr1p in the absence of canonical ER membrane ligases, and Rpn4p turnover as part of proteasome homeostasis, in complex with Ubr2p and Mub1p 3-methyl-adenine DNA glycosylase; involved in protecting DNA against alkylating agents; initiates base excision repair by removing damaged bases to create abasic CAGL0I06809g MAG1 -0,985732773 sites that are subsequently repaired; protein abundance increases in response to DNA replication stress

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Type I membrane protein with a J domain; required to preserve the folding CAGL0C02123g ERJ5 capacity of the endoplasmic reticulum; loss of the non-essential ERJ5 gene leads -0,564735915 to a constitutively induced unfolded protein response Putative phosphatidylinositol transfer protein; gene is upregulated in azole- CAGL0D00946g -0,665811068 resistant strain Scaffold protein; assists in association of the proteasome core particle with the regulatory particle; inhibits proteasomal ATPase activity; degraded by the mature CAGL0E03828g ECM29 -0,689687234 proteasome after assembly; contains HEAT-like repeats; protein increases in

cycle Cell abundance and relocalizes from nucleus to cytoplasm upon DNA replication stress v-SNARE binding protein; facilitates specific protein retrieval from a late endosome

to the Golgi; modulates arginine uptake, possible role in mediating pH homeostasis CAGL0I10010g BTN2 -0,940694621 between the vacuole and plasma membrane H(+)-ATPase; contributes to prion curing; preferentially expressed after severe ethanol stress CAGL0C04939g YJR107W Putative lipase -0,551087438

Squalene epoxidase; catalyzes the epoxidation of squalene to 2,3-oxidosqualene; ERG1 plays an essential role in the ergosterol-biosynthesis pathway and is the specific ERG1 -0,607762237 (CAGL0D05940g) target of the antifungal drug terbinafine; human SQLE functionally complements

the lethality of the erg1 null mutation

C-5 sterol desaturase; glycoprotein that catalyzes the introduction of a C-5(6) double bond into episterol, a precursor in ergosterol biosynthesis; transcriptionally ERG3 ERG3 down-regulated when ergosterol is in excess; mutants are viable, but cannot grow -0,632736981 (CAGL0F01793g)

on non-fermentable carbon sources; substrate of HRD ubiquitin ligase; mutation is Metabolism functionally complemented by human SC5D Phospholipase; contains lipase specific GXSXG motif; maintains lipid droplet (LD) Lipid CAGL0L10318g LPL1 morphology; induced by transcription factor Rpn4p; protein abundance increases -0,691748283 in response to DNA replication stress C-8 sterol isomerase; catalyzes isomerization of delta-8 double bond to delta-7

ERG2 position at an intermediate step in ergosterol biosynthesis; transcriptionally down- ERG2 -0,707593953 (CAGL0L10714g) regulated when ergosterol is in excess; mutation is functionally complemented by human EBP

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Peroxisomal cystathionine beta-lyase; converts cystathionine into homocysteine; STR3 STR3 may be redox regulated by Gto1p; involved in the release of the aromatic thiol 3- -0,896882233 (CAGL0L06094g) mercaptohexanol during wine fermentation Phosphatidylinositol transfer protein; has a potential role in regulating lipid and fatty acid metabolism under heme-depleted conditions; interacts specifically with CAGL0H05005g CSR1 -0,900793326

thioredoxin peroxidase; may have a role in oxidative stress resistance; protein abundance increases in response to DNA replication stress Lanosterol 14-alpha-demethylase; catalyzes C-14 demethylation of lanosterol to form 4,4''-dimethyl cholesta-8,14,24-triene-3-beta-ol in ergosterol biosynthesis ERG11 pathway; transcriptionally down-regulated when ergosterol is in excess; member of ERG11 -0,651350627 (CAGL0E04334g) cytochrome P450 family; associated and coordinately regulated with the P450 reductase Ncp1p; human CYP51A1 functionally complements the lethality of the Lipid Lipid metabolism erg11 null mutation Protein implicated in the regulation of ergosterol biosynthesis; one of a seven member gene family with a common essential function and non-essential unique CAGL0J03916g HES1 functions; similar to human oxysterol binding protein (OSBP); SWAT-GFP and -0,964261714 mCherry fusion proteins localize to the bud neck and vacuolar membrane; HES1 has a paralog, KES1, that arose from the whole genome duplication

Cytoplasmic peptidyl-prolyl cis-trans isomerase (cyclophilin); catalyzes the cis- CPR1 trans isomerization of peptide bonds N-terminal to proline residues; binds the drug CPR1 -0,530557103 (CAGL0E01177g) cyclosporin A; N-terminally propionylated in vivo; protein abundance increases in

Biofilm Biofilm response to DNA replication stress

Formation CAGL0L00227g Putative adhesin with glycine and serine rich repeats; belongs to adhesin cluster V -0,588124640

Cytosolic aldehyde dehydrogenase; activated by Mg2+ and utilizes NADP+ as the preferred coenzyme; required for conversion of acetaldehyde to acetate; CAGL0H05137g ALD6 -0,546399858 constitutively expressed; locates to the mitochondrial outer surface upon oxidative stress Tail-anchored ER membrane protein of unknown function; interacts with homolog Frt1p; promotes growth in conditions of high Na+, alkaline pH, or cell wall stress, CAGL0G06314g FRT2 -0,558477425 possibly via a role in posttranslational translocation; potential Cdc28p substrate; FRT2 has a paralog, FRT1, that arose from the whole genome duplication Coproporphyrinogen III oxidase; oxygen-requiring enzyme that catalyzes sixth step in heme biosynthetic pathway; transcription is repressed by oxygen and heme (via CAGL0K12100g HEM13 -0,670576605 Rox1p and Hap1p); human homolog CPOX can complement yeast mutant and CellularResponse to Stress allow growth of haploid null after sporulation of a heterozygous diploid

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Protoporphyrinogen oxidase; a mitochondrial enzyme that catalyzes the seventh CAGL0H09504g HEM14 step in the heme biosynthetic pathway, converting protoporphyrinogen IX to -0,695404642

protoporphyrin IX; inhibited by diphenyl ether-type herbicides AN1-type zinc finger protein, effector of proteotoxic stress response; stress- inducible transcriptional target of Rpn4p; induced by nitrogen limitation, weak acid, misfolded proteins; short-lived protein, degraded by proteasome; may protect cells to Stress to CAGL0L10186g TMC1 -0,843308407 from trivalent metalloid induced proteotoxicity; contains PACE promoter element;

ortholog of human AIRAP, which stimulates proteasome activity in response to CellularResponse arsenic; protein abundance increases under DNA replication stress Non-essential protein of unknown function; required for transcriptional induction of the early meiotic-specific transcription factor IME1; required for sporulation; GLK1

EMI2 expression regulated by glucose-repression transcription factors Mig1/2p; EMI2 -0,660422820 (CAGL0F00605g) has a paralog, GLK1, that arose from the whole genome duplication; protein abundance increases in response to DNA replication stress NADH diphosphatase (pyrophosphatase); hydrolyzes the pyrophosphate linkage in

CAGL0M05687g NPY1 NADH and related nucleotides; localizes to peroxisomes; nudix hydrolase family -0,968787555 Metabolism

Carbon Carbon Source member Putative protein of unknown function; gene expression induced in response to CAGL0A01089g PBI1 -1,927026524 ketoconazole; YPL272C is not an essential gene Imidazoleglycerol-phosphate dehydratase; catalyzes the sixth step in histidine Nitrogen HIS3 HIS3 biosynthesis; mutations cause histidine auxotrophy and sensitivity to Cu, Co, and -1,070820328 Metabolism (CAGL0L02937g) Ni salts; transcription is regulated by general amino acid control via Gcn4p Alpha 3 subunit of the 20S proteasome; the only nonessential 20S subunit; may be CAGL0I10406g PRE9 replaced by the alpha 4 subunit (Pre6p) under stress conditions to create a more -0,511891674 active proteasomal isoform Alpha 6 subunit of the 20S proteasome; protein abundance increases in response CAGL0M14003g PRE5 -0,522935761 to DNA replication stress ATPase of the 19S regulatory particle of the 26S proteasome; one of six ATPases

Proteasome of the regulatory particle; involved in degradation of ubiquitinated substrates; CAGL0K08910g RPT4 -0,524410713 contributes preferentially to ERAD; required for spindle pole body duplication; mainly nuclear localization

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Protein with a role in the ubiquitin-proteasome pathway; interacts with ubiquitinated protein, Cdc48p and the proteasomal regulatory particle; may protect cells from

trivalent metalloid induced proteotoxicity; contains a PACE promoter element and CAGL0J05962g CUZ1 -0,524757885 is co-regulated with proteasome subunit genes; AN1-type zinc finger protein, with DHHC and ubiquitin-like domains (UBL); ortholog of ZFAND1, a human gene linked to cancer; protein abundance increases under DNA replication stress Non-ATPase base subunit of the 19S RP of the 26S proteasome; N-terminus plays RPN10 RPN10 a role in maintaining the structural integrity of the regulatory particle (RP); binds -0,533086687 (CAGL0L08580g) selectively to polyubiquitin chains; homolog of the mammalian S5a protein Proteasome-binding protein; interacts physically with multiple subunits of the 20S proteasome and genetically with genes encoding 20S core particle and 19S regulatory particle subunits; exhibits boundary activity which blocks the CAGL0M07007g FUB1 -0,558805502 propagation of heterochromatic silencing; contains a PI31 proteasome regulator

domain and sequence similarity with human PSMF1, a proteasome inhibitor; not an essential gene Lysine-specific metalloprotease of the pitrilysin family; metalloprotease of the CAGL0F03157g CYM1 intermembrane space; degrades proteins and presequence peptides cleaved from -0,568415498 imported proteins; required for normal mitochondrial morphology Proteasome DNA damage-inducible v-SNARE binding protein; role in suppression of protein CAGL0I06787g DDI1 secretion; may play a role in S-phase checkpoint control; has ubiquitin-associated -0,575819472 (UBA), ubiquitin-like (UBL), and retroviral-like proteinase (RVP) domains Non-ATPase regulatory subunit of the 26S proteasome; similar to putative proteasomal subunits in other species; null mutant is temperature sensitive and CAGL0F03135g RPN9 exhibits cell cycle and proteasome assembly defects; protein abundance increases -0,582248831 in response to DNA replication stress; relocalizes to the cytosol in response to hypoxia

Ubiquitin-specific protease; situated in the base subcomplex of the 26S proteasome, releases free ubiquitin from branched polyubiquitin chains en bloc, rather than from the distal tip of the chain; negatively regulates degradation of CAGL0K10494g UBP6 -0,604702665 ubiquitinated proteins by the proteasome; works in opposition to Hul5p polyubiquitin elongation activity; mutant has aneuploidy tolerance; human homolog UBP14 complements yeast null mutant

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Chaperone required for correct maturation of the 20S proteasome; short-lived CAGL0M06171g UMP1 chaperone; may inhibit premature dimerization of proteasome half-mers; degraded -0,610247166 by proteasome upon completion of its assembly Ortholog(s) have thiol-dependent ubiquitin-specific protease activity and role in CAGL0L09152g proteasome-mediated ubiquitin-dependent protein catabolic process, protein -0,638911636 deubiquitination Non-ATPase base subunit of the 19S RP of the 26S proteasome; may participate in the recognition of several ligands of the proteasome; contains a leucine-rich CAGL0J00605g RPN1 -0,646960090 repeat (LRR) domain, a site for protein-protein interactions; RP is the acronym for regulatory particle CAGL0F04477g PRE7 Beta 6 subunit of the 20S proteasome -0,661553504 Subunit of the 26S proteasome; substrate of the N-acetyltransferase Nat1p; CAGL0M12859g RPN2 -0,662898566 protein abundance increases in response to DNA replication stress Essential non-ATPase regulatory subunit of the 26S proteasome; has similarity to

CAGL0K08866g RPN8 the human p40 proteasomal subunit and to another S. cerevisiae regulatory -0,667567581 subunit, Rpn11p Beta 3 subunit of the 20S proteasome; involved in ubiquitin-dependent catabolism; CAGL0I04906g PUP3 -0,685541042 human homolog is subunit C10

Evolutionarily conserved 19S regulatory particle assembly-chaperone; involved in Proteasome the assembly of the base subcomplex of the 19S proteasomal regulatory particle CAGL0I09460g HSM3 (RP); involved in DNA mismatch repair during slow growth; weak similarity to -0,747904596 Msh1p; structural study suggests Hsm3p is a scaffold protein for Rpt1p-Rpt2p complex formation; ortholog of human 19S subunit S5b Essential non-ATPase regulatory subunit of the 26S proteasome lid; similar to the CAGL0I08239g RPN3 p58 subunit of the human 26S proteasome; temperature-sensitive alleles cause -0,754158707 metaphase arrest, suggesting a role for the proteasome in cell cycle control MYND domain-containing protein; component of the Mub1p-Ubr2p-Rad6p ubiquitin ligase complex, required for ubiquitination and degradation of Rpn4p; interacts with Ubr2p (E3) and indirectly with Rad6p (E2); short-lived protein degraded in a CAGL0K03333g MUB1 -0,758285123 Ubr2p/Rad6p dependent manner; proposed to function as both a partner and substrate of the Ubr2p/Rad6p ubiquitin ligase; similar to the A. nidulans samB gene Beta 4 subunit of the 20S proteasome; localizes to the nucleus throughout the cell CAGL0H09548g PRE1 -0,789093118 cycle

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presenceDescription of fluconazole of drug the in function C. glabrata of (continued).S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4) Proteasome activator; binds the core proteasome (CP) and stimulates

proteasome-mediated protein degradation by inducing gate opening; required for sequestering CP into proteasome storage granule (PSG) during quiescent phase CAGL0F02101g BLM10 -0,794317780 and for nuclear import of CP in proliferating cells; required for resistance to bleomycin, may be involved in protecting against oxidative damage; similar to mammalian PA200 Subunit of the 19S regulatory particle of the 26S proteasome lid; synthetically lethal with RPT1, which is an ATPase component of the 19S regulatory particle; CAGL0A04807g RPN12 -0,846088295 physically interacts with Nob1p and Rpn3p; protein abundance increases in

response to DNA replication stress Proteasome CAGL0A04719g PRE4 Beta 7 subunit of the 20S proteasome -0,856415139 Deubiquitylation enzyme that binds to the chaperone-ATPase Cdc48p; may contribute to regulation of protein degradation by deubiquitylating substrates that CAGL0K12782g OTU1 -1,177545405 have been ubiquitylated by Ufd2p; member of the Ovarian Tumor (OTU) family; protein abundance increases in response to DNA replication stress Protein of unknown function; has a CUE domain that binds ubiquitin, which may CAGL0J06490g CUE4 facilitate intramolecular monoubiquitination; CUE4 has a paralog, CUE1, that arose -0,503204727 from the whole genome duplication Mitochondrial intermembrane space protein of unknown function; imported via the CAGL0M09339g MIX23 -0,515241222 MIA import machinery; contains an unusual twin cysteine motif (CX13C CX14C)

CAGL0K02629g Ortholog(s) have intracellular localization -0,520896011

Putative protein of unknown function; the authentic, non-tagged protein is detected CAGL0I03520g YDL157C -0,527243052 in highly purified mitochondria in high-throughput studies CAGL0K07678g Protein of unknown function -0,527982274 Putative protein of unknown function; phosphorylated by Dbf2p-Mob1p in vitro; some strains contain microsatellite polymophisms at this locus; not an essential CAGL0B01078g YLR177W -0,574916138 gene; YLR177W has a paralog, PSP1, that arose from the whole genome

UnknownFunction duplication CAGL0A00132g Protein of unknown function -0,578620816 Putative protein of unknown function; null mutant is sensitive to expression of the CAGL0H00572g TDA4 -0,582917918 top1-T722A allele CAGL0L01111g Ortholog(s) have cytosol, nucleus localization -0,619532718 CAGL0D03058g Ortholog(s) have cytosol, nucleus localization -0,692095528

Figure A2 – Genes upregulated by the transcription factor Rpn4 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δrpn4)

CAGL0I02046g Protein of unknown function -0,733060607

Protein of unknown function; green fluorescent protein (GFP)-fusion protein CAGL0B03201g YKR011C localizes to the nucleus; protein abundance increases in response to DNA -0,787480315

replication stress

Function Unknown CAGL0F00116g Protein of unknown function -1,094315498

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata.

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Type II nitroreductase, using NADH as reductant; mutants are defective in fatty acid mediated repression of genes involved in fatty acid biosynthesis indicative of a role HBN1 FRM2 in lipid signaling; involved in the oxidative stress response; transcription induction by -0,551644147 (CAGL0B00990g) cadmium and selenite indicates a possible role in the metal stress response; expression induced in cells treated with the mycotoxin patulin Putative sphingoid long-chain base (LCB) efflux transporter; integral membrane transporter that localizes to the plasma membrane and may transport long chain RSB1

RSB1 bases (LCBs) from the cytoplasmic side toward the extracytoplasmic side of the -0,509114531 (CAGL0L10142g) membrane; role in glycerophospholipid translocation; suppressor of the sphingoid LCB sensitivity of an LCB-lyase mutation Putative sterol transfer protein; one of six StART-like domain-containing proteins in yeast that may be involved in sterol transfer between intracellular membranes; CAGL0K12760g YFL042C conserved across eukaryotes; has both GRAM and StART-like (VASt) domains; -0,642278479 localizes to membrane contact sites throughout the cell, including nucleus-vacuole Lipid Lipid metabolism junctions and ER-mitochondrial contact sites Serine esterase; homolog of human neuropathy target esterase (NTE); Nte1p- CAGL0L11154g NTE1 mediated phosphatidylcholine turnover influences transcription factor Opi1p -0,579070054 localization, affecting transcriptional regulation of phospholipid biosynthesis genes Alkaline ceramidase; also has reverse (CoA-independent) ceramide synthase activity; catalyzes both breakdown and synthesis of phytoceramide; overexpression CAGL0M06347g YPC1 -0,779261434 confers fumonisin B1 resistance; YPC1 has a paralog, YDC1, that arose from the whole genome duplication

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Protein with a possible role in phospholipid biosynthesis; null mutant displays an CAGL0F01111g OPI10 inositol-excreting phenotype that is suppressed by exogenous choline; protein -0,744577765 abundance increases in response to DNA replication stress Putative sterol transfer protein; localizes to puncta in the cortical ER; probable role in retrograde transport of sterols from the plasma membrane to the ER; one CAGL0I01980g YSP1 of six StART-like domain-containing proteins in yeast that may be involved in -0,6562798 sterol transfer between intracellular membranes; conserved across eukaryotes; contains GRAM, StART-like (VASt) and two PH-like domains Sterol transporter that transfers sterols between membranes; may regulate and coordinate formation of contact sites between organelles; localizes to ER- mitochondrial contact sites in a Tom70p- and Tom71p-dependent manner;

Lipid Lipid metabolism CAGL0L13134g YLR072W mitochondrial localization requires GRAM domain; also localizes to ER-vacuole -0,647399123 contact sites, in a Vac8p-dependent manner; has GRAM and StART-like (VASt) domains; one of six StART-like domain-containing proteins in yeast; conserved across eukaryotes Carnitine acetyltransferase; has similarity to Yat1p, which is a carnitine CAGL0I08305g YAT2 -0,544832634 acetyltransferase associated with the mitochondrial outer membrane NAD(+)-dependent glutamate dehydrogenase; degrades glutamate to ammonia and alpha-ketoglutarate; expression sensitive to nitrogen catabolite repression CAGL0H02585g GAD1 -0,619484015 and intracellular ammonia levels; genetically interacts with GDH3 by suppressing stress-induced apoptosis

Histidinol-phosphate aminotransferase; catalyzes the seventh step in histidine CAGL0C05555g GUD1 biosynthesis; responsive to general control of amino acid biosynthesis; -0,545668826 mutations cause histidine auxotrophy and sensitivity to Cu, Co, and Ni salts Peroxisomal cystathionine beta-lyase; converts cystathionine into homocysteine; CAGL0M02981g PRM15 may be redox regulated by Gto1p; involved in the release of the aromatic thiol 3- -0,596550386 mercaptohexanol during wine fermentation NAD(+)-dependent glutamate dehydrogenase; degrades glutamate to ammonia GDH2 and alpha-ketoglutarate; expression sensitive to nitrogen catabolite repression

Nitrogen metabolism GDH2 -0,645823423 (CAGL0G05698g) and intracellular ammonia levels; genetically interacts with GDH3 by suppressing stress-induced apoptosis Histidinol-phosphate aminotransferase; catalyzes the seventh step in histidine CAGL0C01243g HIS5 biosynthesis; responsive to general control of amino acid biosynthesis; -0,559911984 mutations cause histidine auxotrophy and sensitivity to Cu, Co, and Ni salts

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Peroxisomal cystathionine beta-lyase; converts cystathionine into homocysteine; STR3 STR3 may be redox regulated by Gto1p; involved in the release of the aromatic thiol 3- -1,034934848 (CAGL0L06094g) mercaptohexanol during wine fermentation Gamma-aminobutyrate (GABA) transaminase; also known as 4-aminobutyrate aminotransferase; involved in the 4-aminobutyrate and glutamate degradation CAGL0D04026g UGA1 -0,602600877 pathways; required for normal oxidative stress tolerance and nitrogen utilization; protein abundance increases in response to DNA replication stress Putative metallo-dependent hydrolase superfamily protein; similar to AMP deaminases but lacks key catalytic residues and does not rescue purine nucleotide metabolic defect of quadruple aah1 ade8 amd1 his1 mutant; may CAGL0H02893g YJL070C regulate purine nucleotide homeostasis as overexpression in an AMD1 strain -0,737447368

grown in adenine results in greatly reduced GDP and GTP intracellular levels;

not an essential gene; YJL070C has a paralog, YBR284W, that arose from the whole genome duplication 5-oxoprolinase; enzyme is ATP-dependent and functions as a dimer; similar to mouse Oplah gene; green fluorescent protein (GFP)-fusion protein localizes to CAGL0K00231g OXP1 -0,758517993 the cytoplasm; protein abundance increases in response to DNA replication stress Widely-conserved NADHX dehydratase; converts (S)-NADHX to NADH in ATP-

Nitrogen metabolism dependent manner; YKL151C promoter contains STREs (stress response elements) and expression is induced by heat shock or methyl methanesulfonate; CAGL0E06380g YKL151C downstream intergenic region drives antisense expression and mediates -0,783777908 coordinated regulation of YKL151C and GPM1 phosphoglycerate mutase; protein abundance increases in response to DNA replication stress; homolog of Carkd in mammals and C-terminus of YjeF in E.coli Lysophosphatidic acid (LPA) phosphatase, nucleotidase; principle and physiological nucleotidase working on GMP, UMP and CMP; involved in LPA hydrolysis in response to phosphate starvation and ribose salvage pathway; PHM8 PHM8 phosphatase activity is soluble and Mg2+ dependent; expression is induced by -0,710378704 (CAGL0C02321g) low phosphate levels and by inactivation of Pho85p; repressed by Gcn4p under normal conditions; PHM8 has a paralog, SDT1, that arose from the whole genome duplication Glycogen phosphorylase required for the mobilization of glycogen; non- essential; regulated by cyclic AMP-mediated phosphorylation; phosphorylation Carbon CAGL0F04895g GPH1 by Cdc28p may coordinately regulate carbohydrate metabolism and the cell -0,780617193 metabolism cycle; expression is regulated by stress-response elements and by the HOG MAP kinase pathway

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Regulatory subunit of trehalose-6-phosphate synthase/phosphatase; involved in synthesis of storage carbohydrate trehalose; expression is induced by stress CAGL0H02387g TPS3 -0,805729359 conditions and repressed by the Ras-cAMP pathway; TPS3 has a paralog, TSL1, that arose from the whole genome duplication Aldose reductase; involved in methylglyoxal, d-xylose, arabinose, and galactose GRE3 metabolism; stress induced (osmotic, ionic, oxidative, heat shock, starvation and GRE3 -0,65518789 (CAGL0I01122g) heavy metals); regulated by the HOG pathway; protein abundance increases in response to DNA replication stress Neutral trehalase, degrades trehalose; required for thermotolerance and may mediate resistance to other cellular stresses; phosphorylated and activated by CAGL0M10439g NTH1 Cdc28p at the G1/S phase transition to coordinately regulate carbohydrate -0,525849388 metabolism and the cell cycle; inhibited by Dcs1p; NTH1 has a paralog, NTH2, that arose from the whole genome duplication 6-phosphofructo-2-kinase; inhibited by phosphoenolpyruvate and sn-glycerol 3- CAGL0C01397g PFK26 phosphate; has negligible fructose-2,6-bisphosphatase activity; transcriptional -0,55375277 regulation involves protein kinase A Glycogen branching enzyme, involved in glycogen accumulation; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm in a punctate pattern; relocalizes from nucleus to cytoplasmic foci upon DNA replication CAGL0M03377g GLC3 -0,607586904 stress; glycogen accumulation defect of the null mutant is functionally

Carbon Carbon metabolism complemented by human GBE1, which is associated with glycogen storage disease Glycogenin glucosyltransferase; self-glucosylating initiator of glycogen synthesis, also glucosylates n-dodecyl-beta-D-maltoside; SWAT-GFP and mCherry fusion CAGL0H02695g GLG1 proteins localize to the cell periphery and vacuole respectively; similar to -0,609680517 mammalian glycogenin; GLG1 has a paralog, GLG2, that arose from the whole genome duplication Putative type-1 protein phosphatase targeting subunit; tethers Glc7p type-1 CAGL0L00803g PIG2 protein phosphatase to Gsy2p glycogen synthase; PIG2 has a paralog, GIP2, -0,615716931 that arose from the whole genome duplication Glycogen synthase; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary phase; GSY1 has a CAGL0K10626g GSY1 -0,565182922 paralog, GSY2, that arose from the whole genome duplication; relocalizes from nucleus to cytoplasmic foci upon DNA replication stress

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Glycogen synthase; expression induced by glucose limitation, nitrogen starvation, heat shock, and stationary phase; activity regulated by cAMP- dependent, Snf1p and Pho85p kinases as well as by the Gac1p-Glc7p CAGL0F04719g GSY2 -0,83010123 phosphatase; GSY2 has a paralog, GSY1, that arose from the whole genome duplication; relocalizes from cytoplasm to plasma membrane upon DNA replication stress Outer mitochondrial carnitine acetyltransferase; minor ethanol-inducible enzyme CAGL0C05027g YAT1 involved in transport of activated acyl groups from the cytoplasm into the -0,583124298 mitochondrial matrix; phosphorylated Protein required for ethanol metabolism; induced by heat shock and localized to the inner mitochondrial membrane; homologous to mammalian peroxisomal CAGL0B03465g SYM1 membrane protein Mpv17; human homolog MPV17 is implicated in -0,594908656 hepatocerebral mtDNA depletion syndromes (MDDS), and complements yeast null mutant Vacuolar alpha mannosidase; involved in free oligosaccharide (fOS) CAGL0E05148g AMS1 degradation; delivered to the vacuole in a novel pathway separate from the -0,600055415 secretory pathway Subunit of GID Complex that binds directly to central component Vid30p; GID complex is involved in proteasome-dependent catabolite inactivation of fructose- CAGL0B00748g GID7 -0,509951582 1,6-bisphosphatase; Gid7p contains six WD40 repeats; computational analysis

Carbon Carbon metabolism suggests that Gid7p and Moh1p have similar functions Phosphoglucomutase; catalyzes the conversion from glucose-1-phosphate to glucose-6-phosphate, which is a key step in hexose metabolism; functions as CAGL0K03421g PGM2 the acceptor for a Glc-phosphotransferase; protein abundance increases in -0,742664953 response to DNA replication stress; PGM2 has a paralog, PGM1, that arose from the whole genome duplication Glycerol dehydrogenase; involved in an alternative pathway for glycerol catabolism used under microaerobic conditions; also has mRNA binding activity; GCY1 member of the aldo-keto reductase (AKR) family; human homolog AKR1B1 can GCY1 -0,632255713 (CAGL0I01100g) complement yeast null mutant; protein abundance increases in response to DNA replication stress; GCY1 has a paralog, YPR1, that arose from the whole genome duplication Putative stress-induced alcohol dehydrogenase; gene is upregulated in azole- CAGL0K12958g -0,620106373 resistant strain

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) UDP-glucose pyrophosphorylase (UGPase); catalyses the reversible formation of UDP-Glc from glucose 1-phosphate and UTP, involved in a wide variety of UGP1 metabolic pathways, expression modulated by Pho85p through Pho4p; involved UGP1 -0,540024587 (CAGL0L01925g) in PKA-mediated oxidative stress resistance and long-term survival in stationary phase; UGP1 has a paralog, YHL012W, that arose from the whole genome

duplication Major mitochondrial D-lactate dehydrogenase; oxidizes D-lactate to pyruvate, DLD1 DLD1 transcription is heme-dependent, repressed by glucose, and derepressed in -0,512282718 (CAGL0I05148g) ethanol or lactate; located in the mitochondrial inner membrane NADPH-dependent medium chain alcohol dehydrogenase; has broad substrate specificity; member of the cinnamyl family of alcohol dehydrogenases; may be CAGL0M14047g ADH6 -0,975963132 involved in fusel alcohol synthesis or in aldehyde tolerance; protein abundance increases in response to DNA replication stress Carbon Carbon metabolism Soluble fumarate reductase; required with isoenzyme Osm1p for anaerobic growth; may interact with ribosomes, based on co-purification experiments; FRDS1 authentic, non-tagged protein is detected in purified mitochondria in high- FRD1 -0,566625446 (CAGL0L01177g) throughput studies; similar to Arxula adeninovorans fumarate reductase; protein abundance increases in response to DNA replication stress; FRD1 has a paralog, OSM1, that arose from the whole genome duplication Ion Has domain(s) with predicted ion channel activity, role in ion transport and CAGL0K07337g -0,573862979 homeostasis membrane localization Sulfur MET28 bZIP transcriptional activator in the Cbf1p-Met4p-Met28p complex; participates MET28 -0,590650937 metabolism (CAGL0K08668g) in the regulation of sulfur metabolism Stabilizes or regulates formation of respiratory chain supercomplexes composed

CAGL0B01875g COX26 of Complex III (ubiquinol-cytochrome c reductase) and Complex IV (cytochrome -0,76040165 c oxidase) SUE1 Protein required for degradation of unstable forms of cytochrome c; located in SUE1 -0,676559547 (CAGL0L08426g) the mitochondria Protein involved in regulation of the mitochondrial F1F0-ATP synthase; Stf1p

Respiration and Stf2p act as stabilizing factors that enhance inhibitory action of the Inh1p Mitochondria/ CAGL0J09262g STF1 -0,833261812 protein; protein abundance increases in response to DNA replication stress; STF1 has a paralog, INH1, that arose from the whole genome duplication Cell wall CAGL0H10120g YBR056W Putative glycoside hydrolase of the mitochondrial intermembrane space -0,52704901

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Oligomeric mitochondrial matrix chaperone; cooperates with Ssc1p in HSP78 HSP78 mitochondrial thermotolerance after heat shock; able to prevent the aggregation -0,808536956 (CAGL0M08822g) of misfolded proteins as well as resolubilize protein aggregates Putative protein of unknown function; transcription induced by the unfolded CAGL0M04763g YOR289W protein response; green fluorescent protein (GFP)-fusion protein localizes to -0,680181004 both the cytoplasm and the nucleus

Heat shock protein that is highly induced upon stress; plays a role in SRP- dependent cotranslational protein-membrane targeting and translocation; SSA3 SSA4 member of the HSP70 family; cytoplasmic protein that concentrates in nuclei -1,267056084 (CAGL0G03289g) upon starvation; SSA4 has a paralog, SSA3, that arose from the whole genome duplication Protein of unknown function involved in RNA metabolism; has structural

similarity to SBDS, the human protein mutated in Shwachman-Diamond Stressresponse CAGL0H02101g RTC3 Syndrome (the yeast SBDS ortholog = SDO1); null mutation suppresses cdc13-1 -1,06047031 temperature sensitivity; protein abundance increases in response to DNA replication stress Regulatory subunit for Glc7p type-1 protein phosphatase (PP1); tethers Glc7p to Gsy2p glycogen synthase, binds Hsf1p heat shock transcription factor, required CAGL0H04037g GAC1 -0,655001986 for induction of some HSF-regulated genes under heat shock; GAC1 has a paralog, PIG1, that arose from the whole genome duplication PWP6 Adhesin-like protein with similarity to S. cerevisiae flocculins, cell wall proteins -0,793433705 (CAGL0M14069g) that mediate adhesion; predicted GPI anchor; belongs to adhesin cluster II CAGL0I11011g Putative adhesin; belongs to adhesin cluster V -1,105852854 EPA11 Putative adhesin; belongs to adhesin cluster I -1,604065699 (CAGL0L13299g) Sub-telomerically encoded lectin-like adhesin with a role in cell adhesion; EPA13 contains multiple tandem repeats; predicted GPI-anchor; belongs to adhesin -1,732473236 (CAGL0L13332g) cluster I

Biofilm formation Biofilm Proposed gamma subunit of the heterotrimeric G protein; interacts with the CAGL0F07117g GPG1 receptor Gpr1p; involved in regulation of pseudohyphal growth; requires Gpb1p -0,563628658 or Gpb2p to interact with Gpa2p; overproduction causes prion curing Cyclin; interacts with and phosphorylated by Pho85p cyclin-dependent kinase Cell cycle CAGL0J10846g PCL5 (Cdk), induced by Gcn4p at level of transcription, specifically required for Gcn4p -0,508109716 degradation, may be sensor of cellular protein biosynthetic capacity

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) One of two type I myosins; localizes to actin cortical patches; deletion of MYO3 MYO3 has little effect on growth, but myo3 myo5 double deletion causes severe defects MYO3 -0,565414896 (CAGL0K07590g) in growth and actin cytoskeleton organization; MYO3 has a paralog, MYO5, that arose from the whole genome duplication Microtubule-associated protein involved in microtubule organization; involved in assembly and stabilization of microtubules; overproduction results in cell cycle CAGL0J00803g MHP1 -0,524229933 arrest at G2 phase; similar to Drosophila protein MAP and to mammalian MAP4 proteins Protein required for spore wall formation; subunit of the leading edge protein (LEP) complex (Ssp1-Ady3-Don1-Irc10) that forms a ring-like structure at the leading edge of the prospore membrane during meiosis II; mediates assembly of CAGL0C05577g ADY3 the LEP complex, formation of the ring-like structure via interaction with spindle -0,66170482

Cell cycle Cell pole body components and prospore membrane maturation; potentially phosphorylated by Cdc28p; ADY3 has a paralog, CNM67, that arose from the whole Protein involved in meiotic recombination; required for normal levels of crossing CAGL0F02167g MSH4 over, colocalizes with Zip2p to discrete foci on meiotic chromosomes, has -0,672112601 homology to bacterial MutS protein Minor isoform of tropomyosin; binds to and stabilizes actin cables and filaments, which direct polarized cell growth and the distribution of several organelles; CAGL0L08338g TPM2 -0,686455482 appears to have distinct and also overlapping functions with Tpm1p; TPM2 has a paralog, TPM1, that arose from the whole genome duplication Putative precursor of the subtilisin-like protease III; SWAT-GFP and mCherry CAGL0E02651g YSP3 fusion proteins localize to the endoplasmic reticulum; YSP3 has a paralog, -0,629535351

PRB1, that arose from the whole genome duplication Protein that interacts with Ulp1p; a Ubl (ubiquitin-like protein)-specific protease CAGL0G02849g UIP4 for Smt3p protein conjugates; detected in a phosphorylated state in the -0,759126343 mitochondrial outer membrane; also detected in ER and nuclear envelope Ubiquitin-specific protease that cleaves ubiquitin-protein fusions; UBP9 has a

Proteasome CAGL0I05522g UBP9 -0,546505267 paralog, UBP13, that arose from the whole genome duplication HSP31 Putative cysteine protease; protein differentially expressed in azole resistant -0,736055712 (CAGL0C00275g) strain; gene is upregulated in azole-resistant strain

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Ubiquitin-specific protease involved in protein deubiquitination; forms a complex with AAA peroxins Pex1p and Pex6p; deubiquitinates mono- and polyubiquitinated forms of Pex5p; deubiquitinates Clb5p, counteracting APC CAGL0M13783g UBP15 activity, and facilitating both Clb5p accumulation and S phase entry; physically -0,587103988 interacts with anaphase-promoting complex/cyclosome (APC/C) activator, Cdh1p; catalytic activity regulated by an N-terminal TRAF-like domain and and C-terminal sequences Putative aspartic protease; predicted GPI-anchor; member of a YPS gene YPS8 cluster that is required for virulence in mice; induced in response to low pH and -0,548516807 (CAGL0E01815g) high temperature Type II HSP40 co-chaperone that interacts with the HSP70 protein Ssa1p; shuttles between cytosol and nucleus; mediates delivery of misfolded proteins into the nucleus for degradation; involved in proteasomal degradation of CAGL0H03707g SIS1 misfolded cytosolic proteins; protein abundance increases in response to DNA -0,505762078 replication stress; polyQ aggregates sequester Sis1p and interfere with clearance of misfolded proteins; similar to bacterial DnaJ proteins and

Proteasome mammalian DnaJB1 Subunit of the DSC ubiquitin ligase complex; protein of unknown function that CAGL0J04092g DSC3 localizes to the ER and vacuole lumen; overexpression affects endocytic protein -0,546868876 trafficking; ortholog of fission yeast dsc3 Nuclear ubiquitin protein ligase binding protein; may regulate utilization of nonfermentable carbon sources and endocytosis of plasma membrane proteins; CAGL0K05247g CSR2 overproduction suppresses chs5 spa2 lethality at high temp; ubiquitinated by -0,938216897 Rsp5p, deubiquitinated by Ubp2p; CSR2 has a paralog, ECM21, that arose from the whole genome duplication cAMP-dependent protein kinase catalytic subunit; promotes vegetative growth in response to nutrients via the Ras-cAMP signaling pathway; partially redundant CAGL0G09020g TPK2 -0,57186453 with Tpk1p and Tpk3p; localizes to P-bodies during stationary phase; relocalizes to the cytosol in response to hypoxia Protein homologous to Chediak-Higashi syndrome and Beige proteins; both of which are implicated in disease syndromes in human and mouse, respectively,

CAGL0L08140g BPH1 -0,56853595 due to defective lysosomal trafficking; mutant phenotype and genetic interactions suggest a role in protein sorting

traffic Integral membrane component of ER-derived COPII-coated vesicles; functions

Intracellular CAGL0L13244g EMP46 in ER to Golgi transport; EMP46 has a paralog, EMP47, that arose from the -1,071604178 whole genome duplication

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Protein with positive role in the multivesicular body sorting pathway; functions

CAGL0J08118g IST1 and forms a complex with Did2p; recruitment to endosomes is mediated by the -0,510664279 Vps2p-Vps24p subcomplex of ESCRT-III; also interacts with Vps4p Receptor protein for the cytoplasm-to-vacuole targeting (Cvt) pathway; delivers cargo proteins aminopeptidase I (Ape1p) and alpha-mannosidase (Ams1p) to CAGL0I07887g ATG19 -0,625984649 the phagophore assembly site for packaging into Cvt vesicles; interaction with Atg19p during the Cvt pathway requires phosphorylation by Hrr25p Serine/threonine protein kinase involved in regulation of exocytosis; localizes to Intracellulartraffic CAGL0B01925g KIN1 the cytoplasmic face of the plasma membrane; KIN1 has a paralog, KIN2, that -0,548398964 arose from the whole genome duplication Serine/threonine protein kinase; inhibits pheromone induced signalling

downstream of MAPK, possibly at the level of the Ste12p transcription factor; CAGL0G05720g PRR2 -0,512906926 mutant has increased aneuploidy tolerance; PRR2 has a paralog, NPR1, that arose from the whole genome duplication Receptor for a factor pheromone; couples to MAP kinase cascade to mediate

response STE3 pheromone response; transcribed in alpha cells and required for mating by alpha Pheromone STE3 -0,580104006 (CAGL0M08184g) cells, ligand bound receptors endocytosed and recycled to the plasma membrane; GPCR Component of autophagosomes and Cvt vesicles; regulator of Atg1p, targets it to autophagosomes; binds the Atg1p-Atg13p complex, triggering its vacuolar degradation; unique ubiquitin-like protein whose conjugation target is lipid CAGL0A04675g ATG8 phosphatidylethanolamine (PE); Atg8p-PE is anchored to membranes, is -0,560609717 involved in phagophore expansion, and may mediate membrane fusion during

autophagosome formation; deconjugation of Atg8p-PE is required for efficient autophagosome biogenesis Component of the EGO and GSE complexes; essential for integrity and function of EGO; EGO is involved in the regulation of microautophagy and GSE is CAGL0M01848g SLM4 -0,810022764

required for proper sorting of amino acid permease Gap1p; gene exhibits Autophagy synthetic genetic interaction with MSS4 Protein serine/threonine kinase; required for vesicle formation in autophagy and the cytoplasm-to-vacuole targeting (Cvt) pathway; structurally required for CAGL0L06006g ATG1 phagophore assembly site formation; during autophagy forms a complex with -0,650868972 Atg13p and Atg17p; essential for cell cycle progression from G2/M to G1 under nitrogen starvation

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Regulatory subunit of the Atg1p signaling complex; stimulates Atg1p kinase activity; required for vesicle formation during autophagy and the cytoplasm-to- Autophagy CAGL0G09999g ATG13 vacuole targeting (Cvt) pathway; contains a HORMA domain required for -0,517976527 autophagy and for recruitment of the phosphatidylinositol 3-kinase complex subunit Atg14p to the pre-autophagosomal structure DNA ligase required for nonhomologous end-joining (NHEJ); forms stable LIG4 heterodimer with required cofactor Lif1p, interacts with Nej1p; involved in DNL4 -0,558808467 (CAGL0E02695g) meiosis, not essential for vegetative growth; mutations in human ortholog lead to ligase IV syndrome and Dubowitz syndrome Non-essential hydrolase involved in mRNA decapping; activates Xrn1p; may function in a feedback mechanism to regulate deadenylation, contains pyrophosphatase activity and a HIT (histidine triad) motif; acts as inhibitor of CAGL0C03113g DCS1 -0,511860281 neutral trehalase Nth1p; required for growth on glycerol medium; protein abundance increases in response to DNA replication stress; DCS1 has a paralog, DCS2, that arose from the whole genome duplication Vacuolar RNase of the T(2) family; relocalizes to the cytosol where it cleaves tRNAs upon oxidative or stationary phase stress; required for tRNA-specific CAGL0J06820g RNY1 -0,604829364 translational pausing suring oxidative stress; promotes apoptosis under stress conditions and this function is independent of Rny1p catalytic activity CAGL0H00759g -0,660827723 Putative ATP-dependent RNA helicase of the DEAD-box protein family; mutants show reduced stability of the 40S ribosomal subunit scanning through 5' CAGL0J06908g DBP1 untranslated regions of mRNAs; protein abundance increases in response to -0,685976721

Nucleic acid binding DNA replication stress; DBP1 has a paralog, DED1, that arose from the whole genome duplication Component of the Rpd3L histone deacetylase complex; involved in histone CAGL0D00594g RXT3 deacetylation; protein abundance increases in response to DNA replication -0,562603183 stress Protein involved in regulation of nonhomologous end joining; interacts with DNA CAGL0K06083g NEJ1 ligase IV components Dnl4p and Lif1p; repressed by MAT heterozygosity; -0,674564036 regulates cellular distribution of Lif1p Subunit of the APT subcomplex of cleavage and polyadenylation factor; may have a role in 3' end formation of both polyadenylated and non-polyadenylated CAGL0G09779g SYC1 -0,540233192 RNAs; SYC1 has a paralog, YSH1, that arose from the whole genome duplication

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Protein that binds to cruciform DNA structures; CRP1 has a paralog, MDG1, that CAGL0G05830g CRP1 -0,70278305

arose from the whole genome duplication

m(7)GpppX pyrophosphatase regulator; non-essential, stress induced regulatory protein; modulates m7G-oligoribonucleotide metabolism; inhibits Dcs1p;

binding CAGL0L04598g DCS2 regulated by Msn2p, Msn4p, and the Ras-cAMP-cAPK signaling pathway; -0,61577311

Nucleic acid mutant has increased aneuploidy tolerance; DCS2 has a paralog, DCS1, that arose from the whole genome duplication Protein of unknown function; may interact with ribosomes, based on co- CAGL0K03575g YMR114C purification experiments; green fluorescent protein (GFP)-fusion protein localizes -0,571466391 to the nucleus and cytoplasm; YMR114C is not an essential gene CAGL0K04708g Protein of unknown function -0,504552668 CAGL0K10879g Protein of unknown function -0,513144232 CAGL0I10224g Protein of unknown function -0,5269351 CAGL0L00205g Protein of unknown function -0,57044624 CAGL0G10197g Protein of unknown function -0,585731062

CAGL0H00418g Protein of unknown function -0,610138734

CAGL0L00957g Protein of unknown function -0,672484265 CAGL0D01474g Protein of unknown function -0,722787175 CAGL0G04829g Protein of unknown function -0,745397925 CAGL0B01595g Protein of unknown function -0,881005519 CAGL0K07678g Protein of unknown function -1,019163443 Unknownfunction CAGL0L13288g Protein of unknown function -1,592400674 Protein of unknown function; overexpression suppresses Ca2+ sensitivity of mutants lacking inositol phosphorylceramide mannosyltransferases Csg1p and CAGL0H02563g HOR7 Csh1p; transcription is induced under hyperosmotic stress and repressed by -0,78063698 alpha factor; HOR7 has a paralog, DDR2, that arose from the whole genome duplication CAGL0L00473g YMR187C Putative protein of unknown function; YMR187C is not an essential gene -0,603713331 Putative protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies; deletion CAGL0M12969g YIL077C -0,518492013 confers sensitivity to 4-(N-(S-glutathionylacetyl)amino) phenylarsenoxide (GSAO)

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Non-essential protein of unknown function; induced by treatment with 8- CAGL0F04521g ECM13 methoxypsoralen and UVA irradiation; ECM13 has a paralog, YJR115W, that -0,522925093 arose from the whole genome duplication Protein of unknown function; predicted by computational methods to be involved CAGL0J06270g YDL176W in fructose-1,6-bisphosphatase (Fbp1p) degradation; interacts with components -0,547873536 of the GID complex; YDL176W is not an essential gene Protein of unknown function; green fluorescent protein (GFP)-fusion protein CAGL0K09218g YCR061W localizes to the cytoplasm in a punctate pattern; induced by treatment with 8- -0,551931259 methoxypsoralen and UVA irradiation Putative protein of unknown function; green fluorescent protein (GFP)-fusion CAGL0F07975g YGR237C -0,553271112 protein localizes to the cytoplasm CAGL0D00990g YDL057W Putative protein of unknown function; YDL057W is not an essential gene -0,561536018 Protein of unknown function; overexpression causes a cell cycle delay or arrest; null mutation results in a decrease in plasma membrane electron transport; CAGL0K10824g YLR149C -0,57653733 YLR149C is not an essential gene; protein abundance increases in response to DNA replication stress Putative protein of unknown function; green fluorescent protein (GFP)-fusion CAGL0L10582g YMR196W -0,711864071 protein localizes to the cytoplasm; YMR196W is not an essential gene Protein of unknown function; protein abundance increases in response to DNA CAGL0F04697g YLR257W -0,734805344 replication stress Unknownfunction Putative protein of unknown function; predicted prenylation/proteolysis target of Afc1p and Rce1p; green fluorescent protein (GFP)-fusion protein localizes to the CAGL0H03289g YGL082W -0,764605757 cytoplasm and nucleus; not an essential gene; YGL082W has a paralog, YPL191C, that arose from the whole genome duplication Putative protein of unknown function; the authentic, non-tagged protein is CAGL0C04587g YJR098C -0,815582306 detected in highly purified mitochondria in high-throughput studies Putative protein of unknown function; predicted to have thiol-disulfide CAGL0A02002g YOL024W oxidoreductase active site; YOL024W has a paralog, IGD1, that arose from the -0,918390144 whole genome duplication Protein of unknown function; expression is regulated by Msn2p/Msn4p; CAGL0M11000g YNR034W-A YNR034W-A has a paralog, YCR075W-A, that arose from the whole genome -1,155883105 duplication Protein of unknown function involved in vacuolar protein sorting; SWAT-GFP CAGL0M00616g VPS70 -0,595729664 and mCherry fusion proteins localize to the endoplasmic reticulum

Figure A3 – Genes upregulated by the transcription factor Mrr 1 in the presence of fluconazole drug in C. glabrata (continued).

Functional C. glabrata protein S. cerevisiae Log2 Fold change Description of the function of S. cerevisiae homolog Group (ORF) name homolog (WT vs. Δmrr1) Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the vacuole; not an essential gene; induced by treatment with 8- CAGL0I00550g YLR297W methoxypsoralen and UVA irradiation; relocalizes from nucleus to vacuole upon -0,635976672 DNA replication stress; YLR297W has a paralog, YOR186W, that arose from the whole genome duplication ATP-binding protein of unknown function; crystal structure resembles that of CAGL0K00891g TDA10 E.coli pantothenate kinase and other small kinases; null mutant is sensitive to -0,65943078 expression of the top1-T722A allele Putative protein of unknown function; phosphorylated by Dbf2p-Mob1p in vitro; some strains contain microsatellite polymophisms at this locus; not an essential CAGL0B01078g YLR177W -0,688770314

gene; YLR177W has a paralog, PSP1, that arose from the whole genome duplication CAGL0G05357g Ortholog(s) have cytosol, nucleus localization -0,719744132 CAGL0K05687g Ortholog(s) have cytosol, nucleus localization -0,587208418 CAGL0M14025g Ortholog(s) have nucleus localization -1,193867761 CAGL0L06864g Putative protein related to ECM3; gene is downregulated in azole-resistant strain -0,673291708 Unknownfunction Protein of unknown function; may interact with ribosomes, based on co- CAGL0K04719g YNL208W purification experiments; authentic, non-tagged protein is detected in purified -0,774999475 mitochondria in high-throughput studies; potential orthologs found in other fungi Protein of unknown function; undergoes sumoylation; transcription induced under cell wall stress; protein levels are reduced under anaerobic conditions; CAGL0E06512g MRP8 -0,507760457 protein abundance increases in response to DNA replication stress; originally thought to be a mitochondrial ribosomal protein based on sequence analysis Protein of unknown function; localizes to the cytoplasm and nucleus; CAGL0I01276g YHR112C -0,50860629 overexpression affects protein trafficking through the endocytic pathway Has domain(s) with predicted transferase activity, transferring acyl groups CAGL0K01771g -0,505336936 activity