DOCSLIB.ORG

Prospec Product Catalog 2019

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prospec Product Catalog 2019 ProSpec Product Catalog 2019 QUALITY PROTEINS for scientific discoveries WE'VE GOT CHEMISTRY BRIGHTEN YOUR RESEARCH part for life sciences 6,000 proteins at your fingertips List by Molecule Name List by Molecule Name 제품별 자세한 설명은 www.prospecbio.com을 방문하세요. 부가세 별도 Molecule 제품번호 제품명 Size A / 가격(원) Size B / 가격(원) Size C / 가격(원) Name 1F8 Chagas cch-002 Recombinant 1F8 Chagas 5µg / 90,500 20µg / 199,000 1mg / 5,110,500 4-1BBL cyt-649 Recombinant Human 4-1BB Ligand, His Tag 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 4-1BBL cyt-149 Recombinant Human 4-1BB Ligand 5µg / 90,500 20µg / 199,000 1mg / 3,771,400 4-1BBR cyt-916 Recombinant Mouse 4-1BB Receptor 1µg / 112,200 5µg / 220,800 50µg / 1,701,000 4-1BBR cyt-463 Recombinant Human 4-1BB Receptor 5µg / 90,500 20µg / 199,000 1mg / 3,771,400 4-1BBR cyt-137 Recombinant Human 4-1BB Receptor His Tag 5µg / 112,200 20µg / 220,800 1mg / 5,016,800 4-1BBR cyt-931 Recombinant Human 4-1BB Receptor sf9 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 A2LD1 pro-172 Recombinant Human AIG2-Like Domain 1 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 A2M pro-551 Human Alpha-2 Macroglobulin Protein 200µg / 90,500 1mg / 317,500 10mg / 2,389,800 Recombinant Human Alpha & Gamma-Adaptin Binding AAGAB pro-1479 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 Protein Recombinant Human Adipogenesis Associated, Mth938 AAMDC pro-2116 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 Domain Containing AARS enz-305 Recombinant Human Alanyl t-RNA Synthetase 5µg / 112,200 20µg / 220,800 1mg / 5,372,000 Recombinant Human Aminoadipate-Semialdehyde AASDHPPT enz-008 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 Dehydrogenase-Phosphopantetheinyl Transferase Recombinant Human Abhydrolase Domain Containing ABHD10 enz-612 2µg / 112,200 10µg / 220,800 100µg / 1,701,000 10 Recombinant Human Abhydrolase Domain Containing ABHD12B pro-1998 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 12B Recombinant Human Abhydrolase Domain Containing ABHD14B enz-240 1µg / 112,200 5µg / 220,800 50µg / 1,701,000 14B ABI3 pro-1227 Recombinant Human ABI Family, Member 3 2µg / 112,200 10µg / 220,800 100µg / 1,701,000 ABO enz-167 Recombinant Human ABO Blood Group 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 ABRACL pro-1466 Recombinant Human ABRA C-Terminal Like 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACAA1 ant-654 Mouse Anti Human Acetyl-COA Acyltransferase 5µg / 112,200 20µg / 220,800 100µg / 664,800 ACAA1 enz-251 Recombinant Human Acetyl-COA Acyltransferase 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACAA2 enz-697 Recombinant Human Acetyl-COA Acyltransferase 2 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 Recombinant Human Acyl-Coenzyme A Dehydrogenase ACAD8 enz-294 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 8 Recombinant Human Acyl-CoA Dehydrogenase, Long ACADL enz-190 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 Chain Recombinant Human Acyl-Coenzyme A ACADM enz-529 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 Dehydrogenase, C-4 to C-12 Mouse Anti Human Acyl-Coenzyme A Dehydrogenase, ACADS ant-689 5µg / 112,200 20µg / 220,800 100µg / 664,800 C-2 to C-3 Recombinant Human Acyl-Coenzyme A ACADS enz-467 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 Dehydrogenase, C-2 to C-3 Recombinant Human Acyl-CoA Dehydrogenase, Short ACADSB enz-643 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 Chain Recombinant Human Acyl-CoA Dehydrogenase, Very ACADVL enz-250 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 Long Chain Mouse Anti Human Acetyl-Coenzyme A ACAT1 ant-101 5µg / 90,500 20µg / 199,000 100µg / 643,200 acetyltransferase 1 Recombinant Human Acetyl-Coenzyme A ACAT1 enz-665 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 acetyltransferase 1 Mouse Anti Human Acetyl-Coenzyme A ACAT2 ant-561 5µg / 112,200 20µg / 220,800 100µg / 664,800 acetyltransferase 2 Recombinant Human Acetyl-Coenzyme A ACAT2 enz-295 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 acetyltransferase 2 Recombinant Human Acyl-CoA Binding Domain ACBD6 pro-1734 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 Containing 6 ACKA pka-063 Recombinant E.coli Acetate Kinase 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACO1 enz-056 Recombinant Human Aconitase-1 1µg / 112,200 5µg / 220,800 50µg / 1,701,000 ACOT11 ant-424 Mouse Anti Human Acyl-Coenzyme A Thioesterase 11 5µg / 112,200 20µg / 220,800 100µg / 664,800 ACOT11 enz-756 Recombinant Human Acyl-CoA Thioesterase 11 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACOT13 enz-004 Recombinant Human Acyl-CoA Thioesterase 13 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 ACOT7 ant-462 Mouse Anti Human Acyl-Coenzyme A Thioesterase 7 5µg / 112,200 20µg / 220,800 100µg / 664,800 ACOT7 enz-214 Recombinant Human Acyl-CoA Thioesterase 7 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACOT8 enz-712 Recombinant Human Acyl-CoA Thioesterase 8 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACP1 ant-610 Mouse Anti Human Acid Phosphatase-1 5µg / 112,200 20µg / 220,800 100µg / 664,800 ACP1 enz-408 Recombinant Human Acid Phosphatase-1 5µg / 112,200 20µg / 220,800 1mg / 5,016,800 ACP2 enz-849 Recombinant Human Acid Phosphatase-2 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACP5 enz-913 Recombinant Human Acid Phosphatase-5 His Tag 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 ACP5 enz-1025 Recombinant Human Acid Phosphatase-5 2µg / 112,200 10µg / 220,800 100µg / 1,701,000 ACP6 enz-865 Recombinant Human Acid Phosphatase-6 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACPP enz-968 Recombinant Human Acid Phosphatase Prostate, sf9 2µg / 112,200 10µg / 220,800 100µg / 1,701,000 ACPP enz-847 Recombinant Human Acid Phosphatase Prostate 5µg / 112,200 20µg / 220,800 1mg / 5,016,800 Acrp30 ant-232 Mouse Anti Human Adiponectin 5µg / 112,200 20µg / 220,800 100µg / 664,800 Acrp30 cyt-1002 Recombinant Human Adiponectin, Sf9 1µg / 112,200 5µg / 220,800 50µg / 1,701,000 Acrp30 cyt-432 Recombinant Mouse Adiponectin Globular 10µg / 112,200 50µg / 220,800 1mg / 2,530,000 (주)메스디아 / Tel.02-313-4541 / Fax.02-313-4539 3 견적·주문 [email protected] / 학술 [email protected] List by Molecule Name 제품별 자세한 설명은 www.prospecbio.com을 방문하세요. 부가세 별도 Molecule 제품번호 제품명 Size A / 가격(원) Size B / 가격(원) Size C / 가격(원) Name Acrp30 cyt-433 Recombinant Human Adiponectin, His tag 10µg / 90,500 50µg / 199,000 1mg / 2,784,500 Acrp30 cyt-073 Recombinant Human Adiponectin (108-244 a.a.) 5µg / 112,200 25µg / 220,800 1mg / 3,911,500 Acrp30 cyt-615 Recombinant Human Adiponectin Globular 5µg / 90,500 25µg / 199,000 1mg / 3,889,800 Acrp30 cyt-537 Recombinant Mouse Adiponectin, His tag 5µg / 112,200 25µg / 220,800 1mg / 4,602,300 Acrp30 cyt-277 Recombinant Human Adiponectin Globular, His tag 2µg / 90,500 10µg / 199,000 1mg / 5,547,800 ACRP30 cyt-831 Recombinant Rat Adiponectin 2µg / 90,500 10µg / 199,000 1mg / 7,205,700 Acrp30 cyt-434 Recombinant Human Adiponectin glycosilated, HEK 2µg / 90,500 10µg / 199,000 1mg / 7,718,800 Recombinant Human Adiponectin glycosilated, HMW Acrp30 cyt-764 2µg / 90,500 10µg / 199,000 1mg / 7,718,800 Rich Acrp30 cyt-435 Recombinant Mouse Adiponectin glycosilated, HEK 2µg / 90,500 10µg / 199,000 1mg / 7,718,800 Acrp30 cyt-696 Recombinant Porcine Adiponectin glycosilated, HEK 2µg / 90,500 10µg / 199,000 1mg / 7,718,800 Acrp30 cyt-233 Recombinant Human Adiponectin Trimeric Form 2µg / 90,500 10µg / 199,000 1mg / 8,903,000 Acrp30 cyt-247 Recombinant Mouse Adiponectin Trimeric Form 2µg / 90,500 10µg / 199,000 1mg / 8,903,000 Acrp30 cyt-024 Human Adiponectin 2µg / 90,500 10µg / 199,000 100µg / 1,403,000 Acrp30 cyt-280 Recombinant Human Adiponectin 5µg / 112,200 25µg / 220,800 1mg / 3,911,500 Mouse Anti Human Acyl-CoA Synthetase Family ACSF2 ant-694 5µg / 112,200 20µg / 220,800 100µg / 664,800 Member 2 Recombinant Human Acyl-CoA Synthetase Family ACSF2 enz-919 5µg / 112,200 20µg / 220,800 1mg / 5,016,800 Member 2 Recombinant Human Actin, Alpha 2, Smooth Muscle, ACTA2 pro-1220 2µg / 112,200 10µg / 220,800 1mg / 7,227,300 Aorta ACTB ant-687 Mouse Anti Human Actin Beta 5µg / 112,200 20µg / 220,800 100µg / 664,800 ACTH hor-279 Adrenocorticotropic Hormone 2mg / 90,500 10mg / 199,000 50mg / 698,400 Actin pro-517 Actin 10µg / 90,500 50µg / 199,000 1mg / 2,508,300 Actin pro-519 Bovine Cardiac Actin 2µg / 90,500 10µg / 199,000 1mg / 6,653,000 Activin-A ant-029 Polyclonal Rabbit Anti Human Activin-A 5µg / 90,500 20µg / 199,000 100µg / 643,200 Activin-A cyt-078 Recombinant Human Activin-A Active, HEK 2µg / 90,500 10µg / 199,000 100µg / 1,403,000 Activin-A cyt-414 Recombinant Human Activin-A Active, Plant 1µg / 90,500 5µg / 199,000 100µg / 2,093,800 Activin-A cyt-569 Recombinant Human Activin-A 2µg / 112,200 10µg / 220,800 1mg / 3,793,200 Activin-A cyt-146 Recombinant Mouse Activin-A 2µg / 90,500 10µg / 199,000 1mg / 5,942,500 Activin-A cyt-147 Recombinant Rat Activin-A 2µg / 90,500 10µg / 199,000 1mg / 5,942,500 Activin-A cyt-145 Recombinant Human Activin-A, Active, E.coli 2µg / 90,500 10µg / 199,000 1mg / 5,942,500 Activin-A cyt-052 Recombinant Human Activin-A, Plant 2µg / 90,500 10µg / 199,000 1mg / 7,126,700 Activin-B cyt-057 Recombinant Human Activin-B, Active, Plant 2µg / 90,500 10µg / 199,000 1mg / 7,916,200 Activin-B cyt-058 Recombinant Human Activin-B 2µg / 90,500 10µg / 199,000 1mg / 7,126,700 ACTN1 ant-597 Mouse Anti Human Actinin Alpha 1 5µg / 112,200 20µg / 220,800 100µg / 664,800 ACTN1 pro-518 Actinin Alpha 1 10µg / 90,500 50µg / 199,000 1mg / 3,475,400 ACTN1 pro-2227 Recombinant Human Actinin Alpha 1 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACTR3 pro-2096 Recombinant Human ARP3 Actin-Related Protein 3 5µg / 112,200 20µg / 220,800 1mg / 3,793,200 ACVR2A cyt-976 Recombinant Human Activin A Receptor Type 2A 2µg / 112,200 10µg /
Load more

Recommended publications
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd
    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
    [Show full text]
  • Glycerol Dehydrogenase from Gluconobacter Industrius
    Agric. Biol Chem., 49 (4), 1001 -1010, 1985 1001 Solubilization, Purification and Properties of Membrane-bound Glycerol Dehydrogenase from Gluconobacter industrius Minoru Ameyama,Emiko Shinagawa, Kazunobu Matsushita and Osao Adachi Laboratory of Applied Microbiology, Department of Agricultural Chemistry, Faculty of Agriculture, Yamaguchi University, Yamaguchi 753, Japan Received July 30, 1984 Membrane-bound glycerol dehydrogenase was solubilized and purified about 100-fold from the membraneof Gluconobacter industrius IFO 3260 grown on a glycerol-glutamate medium. Solubilization of the enzyme was successfully achieved by use of 0.5% dimethyldodecylamineoxide in 0.05 m Tris-HCl, pH 8.0. Alcohol dehydrogenase and D-glucose dehydrogenase, which were abundantly formed in the same bacterial membrane, were eliminated on solubilization. Glycerol dehydrogenase was further purified through fractionation with polyethylene glycol 6000. The enzymeshowed a broad substrate specificity and various kinds of polyhydroxyl alcohols, in addition to glycerol, were rapidly oxidized in the presence of 2,6-dichlorophenolindophenoi and phenazine methosulfate as the electron acceptor but NADand NADPwere inert. The enzyme was proved to be a quinoprotein in which pyrroloquinoline quinone functioned as the prosthetic group. The first report on microbial oxidation of localization of the oxidase system in cells of G. glycerol to dihydroxyacetone was by Bertrand liquefaciens and found that the oxidation of with a strain capable of L-sorbose fermen- glycerol and raeso-erythritol
    [Show full text]
  • Recombinant Escheichia Coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate
    J. Ind. Eng. Chem., Vol. 12, No. 5, (2006) 757-761 Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate Sun-Gu Lee† and Byung-Gee Kim* Department of Chemical and Biochemical Engineering, Pusan National University, Busan 609-735, Korea *School of Chemical Engineering, and Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-742, Korea Received April 24, 2006; Accepted May 22, 2006 Abstract: A recombinant Escherichia coli overexpressing CMP-kinase was constructed and employed as a whole cell biocatalyst for the conversion of cytidine 5′-monophosphate to cytidine 5′-triphosphate. In the whole cell biocatalysis, recombinant CMP kinase catalyzed the conversion of CMP to CDP, and endogenous acetate kinase of the E. coli was utilized for the ATP regeneration as well as for the conversion of CDP to CTP. A conversion yield of ca. 88 % CTP was obtained when starting with 20 mM CMP, 1 mM ATP, and 80 mM acetyl phosphate based on the initial CMP concentration. Endogenous pyruvate kinase and poly- phosphate kinase were inefficient in the process. The CTP production system was applied to the production of CMP-NeuAc by additionally introducing the CMP-NeuAc synthetase gene into the recombinant E. coli. Keywords: CMP-kinase, whole cell biocatalysis, ATP regeneration, cytidine 5′-monophosphate Introduction employing enzymes [4]. They applied various enzymatic 1) methods and chemical methods and concluded that the As glycosyltransferase-catalyzed synthetic techniques enzymatic method based on adenylate kinase/pyruvate are becoming recognized as powerful methods for the kinase provided the most convenient route to CTP. In the preparation of biologically important oligosaccharides, process, CTP was generated efficiently from an inexpen- the development of cost-efficient production methods for sive substrate, CMP.
    [Show full text]
  • Découverte D'une Nouvelle Famille De Protéine Kinases Bactériennes
    Découverte d’une nouvelle famille de protéine kinases bactériennes : mécanismes de fonctionnement et rôle cellulaire de YdiB, un archétype chez Baccillus subtilis Hien-Anh Nguyen To cite this version: Hien-Anh Nguyen. Découverte d’une nouvelle famille de protéine kinases bactériennes : mécanismes de fonctionnement et rôle cellulaire de YdiB, un archétype chez Baccillus subtilis. Sciences agricoles. Université de Grenoble, 2012. Français. NNT : 2012GRENV017. tel-00721757 HAL Id: tel-00721757 https://tel.archives-ouvertes.fr/tel-00721757 Submitted on 30 Jul 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITÉ DE GRENOBLE Spécialité : Chimie-Biologie Arrêté ministériel : 7 août 2006 Présentée par Hien-Anh NGUYEN Thèse dirigée par le Dr. Jean-Michel JAULT préparée au sein de l’Institut de Biologie Structurale J.-P. Ebel, et du CEA de Grenoble dans l'École Doctorale Chimie et Sciences du Vivant Découverte d’une nouvelle famille de protéines kinases bactériennes : Mécanisme de fonctionnement et rôle cellulaire de YdiB, un représentant chez B. subtilis Thèse soutenue publiquement le 23 mai 2012 devant le jury composé de : Mme. Patricia DOUBLET Rapporteur Prof.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Two-Dimensional Isobutyl Acetate Production Pathways to Improve Carbon Yield
    ARTICLE Received 23 Apr 2015 | Accepted 13 May 2015 | Published 25 Jun 2015 DOI: 10.1038/ncomms8488 OPEN Two-dimensional isobutyl acetate production pathways to improve carbon yield Yohei Tashiro1, Shuchi H. Desai1,2 & Shota Atsumi1,2 For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. 1 Department of Chemistry, University of California, Davis, One Shields Avenue, Davis, California 95616, USA. 2 Microbiology Graduate Group, University of California, Davis, One Shields Avenue, Davis, California 95616, USA. Correspondence and requests for materials should be addressed to S.A. (email: [email protected]). NATURE COMMUNICATIONS | 6:7488 | DOI: 10.1038/ncomms8488 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8488 iochemical production from biomass, a renewable resource OH synthesized from CO2 and sunlight, may contribute to a 1 Bcarbon-neutral society .
    [Show full text]
  • Acetate Activation in Methanosaeta Thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-Coa Synthetase
    Hindawi Publishing Corporation Archaea Volume 2012, Article ID 315153, 10 pages doi:10.1155/2012/315153 Research Article Acetate Activation in Methanosaeta thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-CoA Synthetase Stefanie Berger, Cornelia Welte, and Uwe Deppenmeier Institute for Microbiology and Biotechnology, University of Bonn, Meckenheimer Allee 168, 53115 Bonn, Germany Correspondence should be addressed to Uwe Deppenmeier, [email protected] Received 16 May 2012; Accepted 30 June 2012 Academic Editor: Francesca Paradisi Copyright © 2012 Stefanie Berger et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The thermophilic methanogen Methanosaeta thermophila uses acetate as sole substrate for methanogenesis. It was proposed that the acetate activation reaction that is needed to feed acetate into the methanogenic pathway requires the hydrolysis of two ATP, whereas the acetate activation reaction in Methanosarcina sp. is known to require only one ATP. As these organisms live at the thermodynamic limit that sustains life, the acetate activation reaction in Mt. thermophila seems too costly and was thus reevaluated. It was found that of the putative acetate activation enzymes one gene encoding an AMP-forming acetyl-CoA synthetase was highly expressed. The corresponding enzyme was purified and characterized in detail. It catalyzed the ATP-dependent formation of acetyl- CoA, AMP, and pyrophosphate (PPi) and was only moderately inhibited by PPi. The breakdown of PPi was performed by a soluble pyrophosphatase. This enzyme was also purified and characterized. The pyrophosphatase hydrolyzed the major part of PPi (KM = 0.27 ± 0.05 mM) that was produced in the acetate activation reaction.
    [Show full text]
  • Pancancer Progression Human Vjune2017
    Gene Symbol Accession Alias/Prev Symbol Official Full Name AAMP NM_001087.3 - angio-associated, migratory cell protein ABI3BP NM_015429.3 NESHBP|TARSH ABI family, member 3 (NESH) binding protein ACHE NM_000665.3 ACEE|ARACHE|N-ACHE|YT acetylcholinesterase ACTG2 NM_001615.3 ACT|ACTA3|ACTE|ACTL3|ACTSG actin, gamma 2, smooth muscle, enteric ACVR1 NM_001105.2 ACTRI|ACVR1A|ACVRLK2|ALK2|FOP|SKR1|TSRI activin A receptor, type I ACVR1C NM_145259.2 ACVRLK7|ALK7 activin A receptor, type IC ACVRL1 NM_000020.1 ACVRLK1|ALK-1|ALK1|HHT|HHT2|ORW2|SKR3|TSR-I activin A receptor type II-like 1 ADAM15 NM_207195.1 MDC15 ADAM metallopeptidase domain 15 ADAM17 NM_003183.4 ADAM18|CD156B|CSVP|NISBD|TACE ADAM metallopeptidase domain 17 ADAM28 NM_014265.4 ADAM 28|ADAM23|MDC-L|MDC-Lm|MDC-Ls|MDCL|eMDC II|eMDCII ADAM metallopeptidase domain 28 ADAM8 NM_001109.4 CD156|MS2 ADAM metallopeptidase domain 8 ADAM9 NM_001005845.1 CORD9|MCMP|MDC9|Mltng ADAM metallopeptidase domain 9 ADAMTS1 NM_006988.3 C3-C5|METH1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 ADAMTS12 NM_030955.2 PRO4389 ADAM metallopeptidase with thrombospondin type 1 motif, 12 ADAMTS8 NM_007037.4 ADAM-TS8|METH2 ADAM metallopeptidase with thrombospondin type 1 motif, 8 ADAP1 NM_006869.2 CENTA1|GCS1L|p42IP4 ArfGAP with dual PH domains 1 ADD1 NM_001119.4 ADDA adducin 1 (alpha) ADM2 NM_001253845.1 AM2|dJ579N16.4 adrenomedullin 2 ADRA2B NM_000682.4 ADRA2L1|ADRA2RL1|ADRARL1|ALPHA2BAR|alpha-2BAR adrenoceptor alpha 2B AEBP1 NM_001129.3 ACLP AE binding protein 1 AGGF1 NM_018046.3 GPATC7|GPATCH7|HSU84971|HUS84971|VG5Q
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Molecular Mechanisms Regulating Copper Balance in Human Cells
    MOLECULAR MECHANISMS REGULATING COPPER BALANCE IN HUMAN CELLS by Nesrin M. Hasan A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland August 2014 ©2014 Nesrin M. Hasan All Rights Reserved Intended to be blank ii ABSTRACT Precise copper balance is essential for normal growth, differentiation, and function of human cells. Loss of copper homeostasis is associated with heart hypertrophy, liver failure, neuronal de-myelination and other pathologies. The copper-transporting ATPases ATP7A and ATP7B maintain cellular copper homeostasis. In response to copper elevation, they traffic from the trans-Golgi network (TGN) to vesicles where they sequester excess copper for further export. The mechanisms regulating activity and trafficking of ATP7A/7B are not well understood. Our studies focused on determining the role of kinase-mediated phosphorylation in copper induced trafficking of ATP7B, and identifying and characterizing novel regulators of ATP7A. We have shown that Ser- 340/341 region of ATP7B plays an important role in interactions between the N-terminus and the nucleotide-binding domain and that mutations in these residues result in vesicular localization of the protein independent of the intracellular copper levels. We have determined that structural changes that alter the inter-domain interactions initiate exit of ATP7B from the TGN and that the role of copper-induced kinase-mediated hyperphosphorylation might be to maintain an open interface between the domains of ATP7B. In a separate study, seven proteins were identified, which upon knockdown result in increased intracellular copper levels. We performed an initial characterization of the knock-downs and obtained intriguing results indicating that these proteins regulate ATP7A protein levels, post-translational modifications, and copper-dependent trafficking.
    [Show full text]
  • Antibody List
    產品編號 產品名稱 PA569955 1110059E24Rik Polyclonal Antibody PA569956 1110059E24Rik Polyclonal Antibody PA570131 1190002N15Rik Polyclonal Antibody 01-1234-42 123count eBeads Counting Beads MA512242 14.3.3 Pan Monoclonal Antibody (CG15) LFMA0074 14-3-3 beta Monoclonal Antibody (60C10) LFPA0077 14-3-3 beta Polyclonal Antibody PA137002 14-3-3 beta Polyclonal Antibody PA14647 14-3-3 beta Polyclonal Antibody PA515477 14-3-3 beta Polyclonal Antibody PA517425 14-3-3 beta Polyclonal Antibody PA522264 14-3-3 beta Polyclonal Antibody PA529689 14-3-3 beta Polyclonal Antibody MA134561 14-3-3 beta/epsilon/zeta Monoclonal Antibody (3C8) MA125492 14-3-3 beta/zeta Monoclonal Antibody (22-IID8B) MA125665 14-3-3 beta/zeta Monoclonal Antibody (4E2) 702477 14-3-3 delta/zeta Antibody (1H9L19), ABfinity Rabbit Monoclonal 711507 14-3-3 delta/zeta Antibody (1HCLC), ABfinity Rabbit Oligoclonal 702241 14-3-3 epsilon Antibody (5H10L5), ABfinity Rabbit Monoclonal 711273 14-3-3 epsilon Antibody (5HCLC), ABfinity Rabbit Oligoclonal PA517104 14-3-3 epsilon Polyclonal Antibody PA528937 14-3-3 epsilon Polyclonal Antibody PA529773 14-3-3 epsilon Polyclonal Antibody PA575298 14-3-3 eta (Lys81) Polyclonal Antibody MA524792 14-3-3 eta Monoclonal Antibody PA528113 14-3-3 eta Polyclonal Antibody PA529774 14-3-3 eta Polyclonal Antibody PA546811 14-3-3 eta Polyclonal Antibody MA116588 14-3-3 gamma Monoclonal Antibody (HS23) MA116587 14-3-3 gamma Monoclonal Antibody (KC21) PA529690 14-3-3 gamma Polyclonal Antibody PA578233 14-3-3 gamma Polyclonal Antibody 510700 14-3-3 Pan Polyclonal
    [Show full text]