Recombinant Escheichia Coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate

J. Ind. Eng. Chem., Vol. 12, No. 5, (2006) 757-761

Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate

Sun-Gu Lee† and Byung-Gee Kim* Department of Chemical and Biochemical Engineering, Pusan National University, Busan 609-735, Korea *School of Chemical Engineering, and Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-742, Korea

Received April 24, 2006; Accepted May 22, 2006

Abstract: A recombinant Escherichia coli overexpressing CMP-kinase was constructed and employed as a whole cell biocatalyst for the conversion of cytidine 5′-monophosphate to cytidine 5′-triphosphate. In the whole cell biocatalysis, recombinant CMP kinase catalyzed the conversion of CMP to CDP, and endogenous acetate kinase of the E. coli was utilized for the ATP regeneration as well as for the conversion of CDP to CTP. A conversion yield of ca. 88 % CTP was obtained when starting with 20 mM CMP, 1 mM ATP, and 80 mM acetyl phosphate based on the initial CMP concentration. Endogenous pyruvate kinase and polyphosphate kinase were inefficient in the process. The CTP production system was applied to the production of CMP-NeuAc by additionally introducing the CMP-NeuAc synthetase gene into the recombinant E. coli.

Keywords: CMP-kinase, whole cell biocatalysis, ATP regeneration, cytidine 5′-monophosphate

Introduction employing enzymes [4]. They applied various enzymatic 1) methods and chemical methods and concluded that the As glycosyltransferase-catalyzed synthetic techniques enzymatic method based on adenylate kinase/pyruvate are becoming recognized as powerful methods for the kinase provided the most convenient route to CTP. In the preparation of biologically important oligosaccharides, process, CTP was generated efficiently from an inexpen- the development of cost-efficient production methods for sive substrate, CMP. Adenylate kinase catalyzes the sugar-nucleotides (i.e., substrates of glycosyltransferases) conversion of CMP to CDP with catalytic amounts of and nucleoside 5′-triphosphates (NTPs; i.e., precursors ATP, and pyruvate kinase catalyzes both the conversion for sugar-nucleotides), has become important [1]. CTP is of CDP to CTP and ATP regeneration. However, the an especially important intermediate in the synthesis of system required large quantities of adenylate kinase to donor substrates of sialyltransferases, such as CMP- achieve useful rates because of the low specificity of the NeuAc, CMP-3-deoxy-β-glycero-galacto-2-nonulopyr- enzyme for CMP, and also required purified enzyme pre- anosonic acid (CMP-KDN), and CMP-3-deoxy-D- manno- parations. 2-octulosonate (CMP-KDO) [2]. In addition, cytidine Recently, the development of processes using whole diphosphate choline (CDP-choline), a drug for brain microbial cells as biocatalysts has been accelerated by injuries, can be obtained through the cholinephosphate advances in recombinant DNA technology, leading to the cytidyltransferase-catalyzed reaction using CTP as an efficient manufacturing of various amino acids, vitamins, intermediate [3], and uridine 5′-triphosphate (UTP) can and ribonucleotides [5]. The processes employ genet- be synthesized through the chemical deamination of CTP ically engineered microbial cells as bags of enzymes, and [4]. products are formed through one or a few reactions using For the production of CTP, Simon and coworkers the whole cells or their extracts. This kind of process (1990) developed a very convenient synthetic method permits the production of a desired compound through specific and simple bioconversion. † To whom all correspondence should be addressed. In this paper we describe the production of CTP (e-mail: [email protected]) through a simple conversion process using recombinant 758 Sun-Gu Lee and Byung-Gee Kim

T easy vector system was obtained from Promega Corpo- ration (WI, USA). The pET15b and E. coli BL21 (DE3) samples were obtained from Novagen (WI, USA). The pNSY05 sample was kindly donated by the National Research Council (Ontario, Canada). The pHSP210 and pET24 ma samples were kindly donated by Dr. Hiroshi Sakamoto (Pasteur Institute, Paris, France).

DNA Manipulation DNA manipulations were performed according to the procedures described by Sambrook and coworkers (1989) [9]; the pGMEⓇ-T easy vector system (Promega) was used for cloning of the PCR product. The PCR reaction was conducted in 50 µL of a mixture containing chromo- somal DNA or plasmid, 50 pmoles of each primer, 2.5 mM dNTP, 1.5 mM MgCl2, and 2.5 U of Taq polymerase (Takara, Japan). Conditions for PCR cycling included denaturation at 94 oC for 1 min, annealing at 50 oC for 1 o Figure 1. Schematic diagram of the whole-cell-catalyzed min, and extension at 72 C for 2 min. conversion of CMP to CTP (CMK: CMP kinase; ACK: acetate kinase). Plasmid Construction The plasmid pET24ma, a derivative of pET24a (No- whole cell extracts. The concept of a CTP production vagen), which contains the p15 A replication origin, ka- system using adenylate kinase/pyruvate kinase was namycin resistance gene, and T7 promoter, was used for introduced in our process, but the process was incor- the construction of pETCMK02, the plasmid expressing porated into a microbial cell. Figure 1 shows the sche- CMP kinase. The plasmid pETCMK02 was obtained by matic diagram of the CTP production process. Instead of digesting the plasmid pHSP210 [10] harboring the CMP adenylate kinase, CMP-kinase, an enzyme showing high kinase gene from E. coli with NdeI and EcoRI and specificity for CMP, was utilized for the conversion of cloning the NdeI-EcoRI fragment into the NdeI and CMP to CDP. For both the conversion of CDP to CTP EcoRI sites of pET24ma. The plasmid pET15b, con- and for ATP regeneration, acetate kinase was employed taining the replication origin and ampicillin resistance instead of pyruvate kinase because, for large-scale gene from pBR322, and T7 promoter was used for the processing, an ATP regeneration system using acetate construction of pETNEU08, the plasimid expressing CMP- kinase has economic advantages [6]. For this bioconver- NeuAc synthetase. The CMP-NeuAc synthetase gene was sion of CMP to CTP, we utilized the endogenous acetate amplified using the 5′ primer (32-mer: 5′- CCATGG- kinase in E. coli because it was reported that endogenous AAAAACAAAATATTGCGGTTATACTT-3′; the NcoI acetate kinase in E. coli can induce an efficient ATP site is in italics) and the 3′ primer (36-mer: 5′- regeneration [7,8]. CTCGAGTTAGCTTTCCTTGTGATTAAGAATGTTTT In this study, the parameters affecting CTP production C-3′; the XhoI site is in italics) and the pNSY05 [11] were investigated and the whole cell reaction was harboring the CMP-NeuAc synthetase gene from characterized. Furthermore, we found that the recom- Neisseria meningitidis as the template. The 0.7-kb PCR binant E. coli could be used for the production of CMP- product was digested with NcoI and XhoI, and cloned NeuAc by additionally introducing the CMP-NeuAc syn- into the NcoI and XhoI sites of pET15b to form thetic gene into the recombinant E. coli. pETNEU08.

Preparation of Cell Extracts Experimental E. coli BL21 (DE3) carrying the pETCMK02 was grown at 37 oC in 5 mL of LB medium containing kana- Materials mycin (50 µg/mL) until A600 reached 0.6, induced with 1 All chemicals used in this study were purchased from mM isopropyl β-D-thiogalactopyranoside (IPTG), and Sigma (MO, USA); the enzymes used for DNA manipu- harvested after further incubation for 5 h. Cell extracts lations were from Boehringer Mannheim GmbH were prepared by the method using polymixin B sulfate (Mannheim, Germany). Primers were synthesized from [12]; the protein concentration of the extracts was Bioneer Corporation (Chungwon, Korea). The pGMEⓇ- determined using the Bradford method. Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate 759

Measurements of Enzyme Activities Table 1. Effect of Acetyl Phosphate Concentration on the Acetate kinase activity was determined using the previ- Conversion of CMP to CTP ously described hydroxylamine method [13], which de- [Acetyl P]0/[CMP]0 CTP (mM) CDP (mM) CMP (mM) cytidine tects the formation of acetyl phosphate. One unit of 0 0 0.9 18.9 0.18 enzyme activity was defined as the amount catalyzing the 2 12.8 5.13 2.56 0.12 formation of 1 µmol of acetylphosphate per min. CMP 3 16.4 2.93 0.57 0.09 kinase activity was assayed at 37 oC using 5 mM CMP and 5 mM ATP in 100 mM Tris buffer (pH 7.5). The 4 17.4 2.25 0.28 0.08 CDP formation was monitored by HPLC; one unit of Reaction conditions: 20 mM CMP, 1 mM ATP, AcetylP (0, 40, 60, enzyme activity was defined as the amount catalyzing the 80 mM), 25 mg (wet weight)/mL of BL1 (DE3)/pETCMK02, 20 formation of 1 µmol of CDP per min. CMP-NeuAc mM MgCl2, 200 mM Tris․Cl (pH 7.5). synthetase activity was assayed at 37 oC using 5 mM CTP and 5 mM NeuAc in 100 mM Tris buffer (pH 8.0). conversion of CMP to CTP, the cmk gene from E. coli The CMP-NeuAc formation was monitored by HPLC; was cloned into the expression vector containing p15 A one unit of enzyme activity was defined as the amount replication origin to form pETCMK02. The pETCMK02 catalyzing the formation of 1 µmol of CMP- NeuAc per was transformed into E. coli BL21 (DE3), to form BL21 min. (DE3)/pETCMK02, and induced with 1 mM IPTG. The activities of CMP-kinase and endogenous acetate kinase HPLC Analysis in the extracts were measured (11.5 and 2.5 U/mg, re- Various nucleotides (cytidine, CMP, CDP, CTP, AMP, spectively). ADP, and ATP) and CMP-NeuAc were monitored using a Waters 660 liquid chromatograph following a separa- Effect of the Acetyl Phosphate Concentration on the tion method described by Ryll and Wagner (1991) [14] Conversion Yield of CTP with some modifications. A reverse-phase column (3.9× When acetyl phosphate is used as the phosphate donor 150 mm SymmetryⓇC18, Waters) was eluted at a flow for the conversion of CMP to CTP with ATP regener- rate of 1 mL/min using the following gradient program: ation, theoretically, approximately two equivalent a- mounts of acetyl phosphate against CMP are required for 100 % Eluent A (100 mM KH2PO4/K2HPO4 and 8 mM tetrabutylammonium hydrogen sulfate at pH 7.0) for 10 the complete conversion displayed in Figure 1. However, min; 0 to 30 % Eluent B (methanol) over 10 min; 30 % because the half-life of acetyl phosphate in aqueous Eluent B for 10 min. Eluted nucleotides and CMP- solution is about 8 h, acetyl phosphate should be added NeuAc were monitored by their absorbance at 270 nm. excessively at the beginning of the reaction or contin- The retention times were as follows: cytidine (1.7 min), uously during the reaction to obtain a high conversion CMP (2.4 min), CMP-NeuAc (3.8 min), CDP (5.5 min), yield [6]. The effect that the ratio of acetyl phosphate to AMP (8.4 min), CTP (12.4 min), ADP (22 min), and CMP had on the conversion yield of CTP was inves- ATP (24.7 min). tigated; in Table 1, we observe that a ca. 88 % conversion yield was obtained through the use of four equiv- Reactions alent amounts of acetyl phosphate to CMP. For CTP production, 100 µL of a reaction mixture (200 Availability of Endogeous Pyruvate Kinase or Poly- mM Tris buffer, pH 7.5) containing CMP, acetyl phos- phosphate Kinase phate, ATP, MgCl2, and the whole cell extracts of BL21 o In addition to acetate kinase, pyruvate kinase and pol- (DE3)/pETCMK02 was incubated at 37 C; the reaction yphosphate kinase are also enzymes that have been em- was monitored by HPLC. Detailed reaction conditions ployed for ATP regeneration. Pyruvate kinase and pol- are described in the Figure legends. For CMP- NeuAc yphosphate kinase convert NDP to NTP by using phos- production, 100 µL of a reaction mixture (200 mM Tris phoenolpyruvate (PEP) and polyphosphate (polyP) as buffer, pH 8.0) containing CMP, NeuAc, acetyl phos- phosphate donors, respectively. To determine that the phate, ATP, MgCl2, and the whole cell extracts of endogenous pyruvate kinase or polyphosphate kinase BL21(DE3)/pETCMK02/pETNEU08 was incubated at o also can be utilized for the conversion of CMP to CTP in 37 C. the process using BL21 (DE3)/pETCMK02, we performed the reaction by adding PEP or polyP in place of Results and Discussion acetyl phosphate. As shown in Figure 2, the addition of polyP did not induce CTP formation and ATP regen- Construction of the Recombinant E. coli for the Con- eration, presumably because of the low activity of endo- version of CMP to CTP neous polyphosphate kinase. The enzyme activity in the For the construction of the E. coli for whole-cell soluble extract of E. coli is ca. 0.005 unit/mg [15] and 760 Sun-Gu Lee and Byung-Gee Kim

Figure 2. Effect of the addition of various phosphate donors Figure 3. Schematic diagram of the whole-cell-catalyzed (●: AcetylP; ○: PEP; ▼: polyP) on the conversion of CMP to conversion of CMP to CMP-NeuAc (NEU: CMP-NeuAc CTP. Reaction conditions: 20 mM CMP, 1 mM ATP, phos- synthetase). phate donors (AcetylP: 40 mM; PEP: 40 mM; polyP: 40 mM as phosphate; chain length: 45), 20 mM MgCl2, 25 mg (wet weight)/mL of BL21(DE3)/pETCMK02, 200 mM Tris buffer (pH 7.5). that in the membrane fraction is ca. 0.02 unit/mg [16]. The addition of PEP induced the formation of CTP, but the reaction rate was too low. This low conversion rate obtained when using the endogenous pyruvate kinase activity is presumed to be due to the inefficiency of the pyruvate kinase/PEP system itself. Generally, the pyruvate kinase/PEP system requires a 10-fold larger number of units of this enzyme than that predicted on the basis of noninhibited assay because of the pronounced product inhibition of the enzyme [6]. The results in Figure 2 suggest that the efficient formation of CTP can be achieved only by employing the endogenous acetate kinase activity of E. coli BL21 (DE3)/pEEETCMK02. Figure 4. Conversion of CMP to CMP-NeuAc using BL21 Whole-Cell-Catalyzed Conversion of CMP to CMP- (DE3)/pETCMK02/pETNEU08 as a biocatalyst. (○) CMP- NeuAc NeuAc; (●) CMP; (▼) CDP; (▽) CTP; (■) cytidine. (Inset) The above whole-cell conversion system for CTP was Time course of ATP. Reaction conditions: 20 mM CMP, 30 further expanded to the production of CMP-NeuAc by mM NeuAc, 1 mM ATP, 60 mM AcetylP, 20 mM MgCl2, 10 additionally introducing the CMP-NeuAc synthetic gene mg(wet weight)/mL of cell, 200 mM Tris․Cl (pH 8.0). into BL21 (DE3)/pETCMK02. CMP-NeuAc synthetase is an enzyme catalyzing the formation of CMP-NeuAc activity of the extracts of BL21 (DE3)/pETCMK02/ from CTP and NeuAc. The plasmid expressing CMP- pETNEU08 was ca. 0.2 U/mg. The activities of CMP- NeuAc synthetase from N. nemingitidis, pETNEU08, kinase and endogenous acetate kinase were almost iden- was transformed into BL21 (DE3)/pETCMK02 to form tical to those results presented in Table 1. In a whole-cell BL21 (DE3)/pETCMK02/pETNEU08. Because pETCMK02 conversion of CMP to CMP-NeuAc (Figure 3), CMP is and pETNEU08 have different replication origins, the converted to CDP catalyzed by CMP kinase in the two plasmids can coexist in E. coli. After being induced presence of acetyl phosphate and then CDP is further with 1 mM IPTG, BL21 (DE3)/pETCMK02/pETNEU08 converted to CTP with acetyl phosphate by endogenous was employed as a whole cell catalyst for the conversion acetate kinase. CTP then reacted with NeuAc catalyzed by of CMP to CMP-NeuAc. The CMP-NeuAc synthetase CMP-NeuAc synthetase. Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate 761

Starting from CMP, ATP, acetyl phosphate, and NeuAc, tier R&D Program in Microbial Genomics & Appli- the reaction was performed at pH 8.0, which is inter- cations (grant MG05-0309- 6-0) and by the Brain Korea mediate between the optimal pH of the CMP-NeuAc 21 project. synthetase (pH 8.5) and the optimal pH of the other enzymes (pH 7.5). Figure 4 shows the time course of the reaction. A conversion yield of ca. 70 % for CMP- References NeuAc was obtained after 4 h of reaction, indicating that CMP-NeuAc can also be produced from inexpensive 1. T. Bulter and L. Elling, Glycoconjugate J., 16, 147 substrates through recombinant whole-cell conversion. (1999). The instability of acetyl phosphate may cause the com- 2.E. S. Simon, M. D. Bednarski, and G. M. plete depletion of ATP after 4 h of reaction, which would Whitesides, J. Am. Chem. Soc., 110, 7159 (1988). limit the conversion yield of CMP-NeuAc along with the 3. T. Fujio and A. Maruyama, Biosci. Biotech. slight dephosphorylation of CMP. Biochem., 61, 956 (1997). 4. E. S. Simon, S. Grabowski, and G. M. Whitesides, J. Org. Chem., 55, 1834 (1990). Conclusion 5. S. Hashimoto, and A. Ozaki, Curr. Opin. Bio- technol., 10, 604 (1999). In practice, adenylate kinase is generally used for the 6. B. L. Hirschbein, F. P. Mazenod, and G. M. conversion of NMP to NDP in a process for NTP Whitesides, J. Org. Chem., 47, 3765 (1982). because this enzyme can be obtained cheaply. However, 7. L. A. Ryabova, L. M., Vinokurov, E. A. Shekhovtsova, the use of adenylate kinase cannot permit the large-scale Y. B. Alakhov, and A. S. Spirin, Anal. Biochem., process for all NTP because of the limitation of substrate 226, 184 (1995). specificity [4]. In the present paper, we have shown that 8. D. M. Kim and J. R. Swartz, Biotechnol. Bioeng., CTP can be produced through a recombinant whole-cell 66, 180 (1999). reaction. Recombinant CMP-kinase and endogenous 9. J. Sambrook, E. F. Fritsch, and T. Maniatis. acetate kinase were employed in the whole cell conver- Molecular Cloning, 2nd Edn. Cold Spring Harbor sion process. This kind of process can be applied to Laboratory Press (1989). produce other NTPs efficiently by introducing the spe- 10. N. Bucurenci, H. H. Sakamoto, P. Briozzo, N. cific NMP kinase. We have also demonstrated that the Palibroa, L. Serina, R. S. Sarfati, G. Labesse, G. whole cell process for the production of CMP-NeuAc Briand, A. Danchin, O. Barzu, and A. M. Gilles J. was possible by additionally introducing CMP-NeuAc Biol. Chem., 271, 2856 (1996). synthetic gene into the recombinant E. coli BL21 11. M. Gilbert, D. C. Watson, and W. W. Wakarchuk, (DE3)/pETCMK02. Although only the example of the Biotechnol. Lett., 19, 417 (1997). system for CMP-NeuAc is presented in this article, other 12. J. M. Schupp, S. E. Travis, L. B. Price, R. F. Shand, processes using CTP as a precursor can be easily estab- and P. Keim, Biotechniques, 19, 18 (1995). lished by introducing other synthetic genes. For example, 13. M. T. Skarstedt and E. Silverstein, J. Biol. Chem., the introduction of CMP-KDO synthetase would make it 251, 6775 (1976). possible to carry out the whole-cell process for CMP- 14. T. Ryll and R. Wagner, J. Chromatogr., 570, 77 KDO. (1991). 15. R. C. Hoffman, P. L. Wyman, and O. A. Moe, Acknowledgment Biotechnol. Appl. Biochem., 10, 107 (1988). 16. K. Ahn and A. Kornberg, J. Biol. Chem., 265, 11734 This study was supported by the Korean Ministry of (1990). Science and Technology through the 21st Century Fron-