J. Ind. Eng. Chem., Vol. 12, No. 5, (2006) 757-761 Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate Sun-Gu Lee† and Byung-Gee Kim* Department of Chemical and Biochemical Engineering, Pusan National University, Busan 609-735, Korea *School of Chemical Engineering, and Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-742, Korea Received April 24, 2006; Accepted May 22, 2006 Abstract: A recombinant Escherichia coli overexpressing CMP-kinase was constructed and employed as a whole cell biocatalyst for the conversion of cytidine 5′-monophosphate to cytidine 5′-triphosphate. In the whole cell biocatalysis, recombinant CMP kinase catalyzed the conversion of CMP to CDP, and endogenous acetate kinase of the E. coli was utilized for the ATP regeneration as well as for the conversion of CDP to CTP. A conversion yield of ca. 88 % CTP was obtained when starting with 20 mM CMP, 1 mM ATP, and 80 mM acetyl phosphate based on the initial CMP concentration. Endogenous pyruvate kinase and poly- phosphate kinase were inefficient in the process. The CTP production system was applied to the production of CMP-NeuAc by additionally introducing the CMP-NeuAc synthetase gene into the recombinant E. coli. Keywords: CMP-kinase, whole cell biocatalysis, ATP regeneration, cytidine 5′-monophosphate Introduction employing enzymes [4]. They applied various enzymatic 1) methods and chemical methods and concluded that the As glycosyltransferase-catalyzed synthetic techniques enzymatic method based on adenylate kinase/pyruvate are becoming recognized as powerful methods for the kinase provided the most convenient route to CTP. In the preparation of biologically important oligosaccharides, process, CTP was generated efficiently from an inexpen- the development of cost-efficient production methods for sive substrate, CMP. Adenylate kinase catalyzes the sugar-nucleotides (i.e., substrates of glycosyltransferases) conversion of CMP to CDP with catalytic amounts of and nucleoside 5′-triphosphates (NTPs; i.e., precursors ATP, and pyruvate kinase catalyzes both the conversion for sugar-nucleotides), has become important [1]. CTP is of CDP to CTP and ATP regeneration. However, the an especially important intermediate in the synthesis of system required large quantities of adenylate kinase to donor substrates of sialyltransferases, such as CMP- achieve useful rates because of the low specificity of the NeuAc, CMP-3-deoxy-β-glycero-galacto-2-nonulopyr- enzyme for CMP, and also required purified enzyme pre- anosonic acid (CMP-KDN), and CMP-3-deoxy-D- manno- parations. 2-octulosonate (CMP-KDO) [2]. In addition, cytidine Recently, the development of processes using whole diphosphate choline (CDP-choline), a drug for brain microbial cells as biocatalysts has been accelerated by injuries, can be obtained through the cholinephosphate advances in recombinant DNA technology, leading to the cytidyltransferase-catalyzed reaction using CTP as an efficient manufacturing of various amino acids, vitamins, intermediate [3], and uridine 5′-triphosphate (UTP) can and ribonucleotides [5]. The processes employ genet- be synthesized through the chemical deamination of CTP ically engineered microbial cells as bags of enzymes, and [4]. products are formed through one or a few reactions using For the production of CTP, Simon and coworkers the whole cells or their extracts. This kind of process (1990) developed a very convenient synthetic method permits the production of a desired compound through specific and simple bioconversion. † To whom all correspondence should be addressed. In this paper we describe the production of CTP (e-mail: [email protected]) through a simple conversion process using recombinant 758 Sun-Gu Lee and Byung-Gee Kim T easy vector system was obtained from Promega Corpo- ration (WI, USA). The pET15b and E. coli BL21 (DE3) samples were obtained from Novagen (WI, USA). The pNSY05 sample was kindly donated by the National Research Council (Ontario, Canada). The pHSP210 and pET24 ma samples were kindly donated by Dr. Hiroshi Sakamoto (Pasteur Institute, Paris, France). DNA Manipulation DNA manipulations were performed according to the procedures described by Sambrook and coworkers (1989) [9]; the pGMEⓇ-T easy vector system (Promega) was used for cloning of the PCR product. The PCR reaction was conducted in 50 µL of a mixture containing chromo- somal DNA or plasmid, 50 pmoles of each primer, 2.5 mM dNTP, 1.5 mM MgCl2, and 2.5 U of Taq polymerase (Takara, Japan). Conditions for PCR cycling included denaturation at 94 oC for 1 min, annealing at 50 oC for 1 o Figure 1. Schematic diagram of the whole-cell-catalyzed min, and extension at 72 C for 2 min. conversion of CMP to CTP (CMK: CMP kinase; ACK: acetate kinase). Plasmid Construction The plasmid pET24ma, a derivative of pET24a (No- whole cell extracts. The concept of a CTP production vagen), which contains the p15 A replication origin, ka- system using adenylate kinase/pyruvate kinase was namycin resistance gene, and T7 promoter, was used for introduced in our process, but the process was incor- the construction of pETCMK02, the plasmid expressing porated into a microbial cell. Figure 1 shows the sche- CMP kinase. The plasmid pETCMK02 was obtained by matic diagram of the CTP production process. Instead of digesting the plasmid pHSP210 [10] harboring the CMP adenylate kinase, CMP-kinase, an enzyme showing high kinase gene from E. coli with NdeI and EcoRI and specificity for CMP, was utilized for the conversion of cloning the NdeI-EcoRI fragment into the NdeI and CMP to CDP. For both the conversion of CDP to CTP EcoRI sites of pET24ma. The plasmid pET15b, con- and for ATP regeneration, acetate kinase was employed taining the replication origin and ampicillin resistance instead of pyruvate kinase because, for large-scale gene from pBR322, and T7 promoter was used for the processing, an ATP regeneration system using acetate construction of pETNEU08, the plasimid expressing CMP- kinase has economic advantages [6]. For this bioconver- NeuAc synthetase. The CMP-NeuAc synthetase gene was sion of CMP to CTP, we utilized the endogenous acetate amplified using the 5′ primer (32-mer: 5′- CCATGG- kinase in E. coli because it was reported that endogenous AAAAACAAAATATTGCGGTTATACTT-3′; the NcoI acetate kinase in E. coli can induce an efficient ATP site is in italics) and the 3′ primer (36-mer: 5′- regeneration [7,8]. CTCGAGTTAGCTTTCCTTGTGATTAAGAATGTTTT In this study, the parameters affecting CTP production C-3′; the XhoI site is in italics) and the pNSY05 [11] were investigated and the whole cell reaction was harboring the CMP-NeuAc synthetase gene from characterized. Furthermore, we found that the recom- Neisseria meningitidis as the template. The 0.7-kb PCR binant E. coli could be used for the production of CMP- product was digested with NcoI and XhoI, and cloned NeuAc by additionally introducing the CMP-NeuAc syn- into the NcoI and XhoI sites of pET15b to form thetic gene into the recombinant E. coli. pETNEU08. Preparation of Cell Extracts Experimental E. coli BL21 (DE3) carrying the pETCMK02 was grown at 37 oC in 5 mL of LB medium containing kana- Materials mycin (50 µg/mL) until A600 reached 0.6, induced with 1 All chemicals used in this study were purchased from mM isopropyl β-D-thiogalactopyranoside (IPTG), and Sigma (MO, USA); the enzymes used for DNA manipu- harvested after further incubation for 5 h. Cell extracts lations were from Boehringer Mannheim GmbH were prepared by the method using polymixin B sulfate (Mannheim, Germany). Primers were synthesized from [12]; the protein concentration of the extracts was Bioneer Corporation (Chungwon, Korea). The pGMEⓇ- determined using the Bradford method. Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate 759 Measurements of Enzyme Activities Table 1. Effect of Acetyl Phosphate Concentration on the Acetate kinase activity was determined using the previ- Conversion of CMP to CTP ously described hydroxylamine method [13], which de- [Acetyl P]0/[CMP]0 CTP (mM) CDP (mM) CMP (mM) cytidine tects the formation of acetyl phosphate. One unit of 0 0 0.9 18.9 0.18 enzyme activity was defined as the amount catalyzing the 2 12.8 5.13 2.56 0.12 formation of 1 µmol of acetylphosphate per min. CMP 3 16.4 2.93 0.57 0.09 kinase activity was assayed at 37 oC using 5 mM CMP and 5 mM ATP in 100 mM Tris buffer (pH 7.5). The 4 17.4 2.25 0.28 0.08 CDP formation was monitored by HPLC; one unit of Reaction conditions: 20 mM CMP, 1 mM ATP, AcetylP (0, 40, 60, enzyme activity was defined as the amount catalyzing the 80 mM), 25 mg (wet weight)/mL of BL1 (DE3)/pETCMK02, 20 formation of 1 µmol of CDP per min. CMP-NeuAc mM MgCl2, 200 mM Tris․Cl (pH 7.5). synthetase activity was assayed at 37 oC using 5 mM CTP and 5 mM NeuAc in 100 mM Tris buffer (pH 8.0). conversion of CMP to CTP, the cmk gene from E. coli The CMP-NeuAc formation was monitored by HPLC; was cloned into the expression vector containing p15 A one unit of enzyme activity was defined as the amount replication origin to form pETCMK02. The pETCMK02 catalyzing the formation of 1 µmol of CMP- NeuAc per was transformed into E. coli BL21 (DE3), to form BL21 min. (DE3)/pETCMK02, and induced with 1 mM IPTG. The activities of CMP-kinase and endogenous acetate kinase HPLC Analysis in the extracts were measured (11.5 and 2.5 U/mg, re- Various nucleotides (cytidine, CMP, CDP, CTP, AMP, spectively). ADP, and ATP) and CMP-NeuAc were monitored using a Waters 660 liquid chromatograph following a separa- Effect of the Acetyl Phosphate Concentration on the tion method described by Ryll and Wagner (1991) [14] Conversion Yield of CTP with some modifications.