DOCSLIB.ORG

Actinobacillus Pleuropneumoniae Exprimés En Conditions D’Infection

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Actinobacillus Pleuropneumoniae Exprimés En Conditions D’Infection Université de Montréal ÉTUDE DES GÈNES D’ACTINOBACILLUS PLEUROPNEUMONIAE EXPRIMÉS EN CONDITIONS D’INFECTION par VINCENT DESLANDES Département de pathologie et microbiologie Faculté de médecine vétérinaire Thèse présentée à la Faculté de médecine vétérinaire en vue de l’obtention du grade de philosophiae doctor (Ph.D.) en Sciences Vétérinaires option microbiologie Août 2010 © Vincent Deslandes, 2010 ii Université de Montréal Faculté de médecine vétérinaire Cette thèse intitulée : ÉTUDE DES GÈNES D’ACTINOBACILLUS PLEUROPNEUMONIAE EXPRIMÉS EN CONDITIONS D’INFECTION présentée par VINCENT DESLANDES a été évaluée par un jury composé des personnes suivantes Dr Daniel Dubreuil Président rapporteur Dr Mario Jacques Directeur de recherche Dre Josée Harel Codirectrice Dr John H.E. Nash Codirecteur Dre Mariela Segura Membre du jury Dr Roger Lévesque Examinateur externe John Morris Fairbrother Représentant du doyen iii RÉSUMÉ Actinobacillus pleuropneumoniae est l’agent étiologique de la pleuropneumonie porcine. La bactérie se transmet par voies aériennes et contacts directs. Plusieurs facteurs de virulence ont été identifiés, nommément les polysaccharides capsulaires, les lipopolysaccharide, les exotoxines ApxI à IV et de nombreux mécanismes d’acquisition du fer. Aucun vaccin efficace contre tous les sérotypes de la bactérie n’a encore été élaboré. Afin de mieux comprendre de quelle façon A. pleuropneumoniae régule la transcription de ses nombreux facteurs de virulence et de découvrir de nouvelles cibles potentielles pour l’élaboration de vaccins efficaces, le profil transcriptomique de la bactérie a été étudié dans des conditions simulant l’infection ainsi qu’à la suite d’une infection naturelle aiguë chez l’animal. Des biopuces de première et de seconde génération (AppChip1 et AppChip2) comportant respectivement 2025 cadres de lecture ouverts (ORF) de la version préliminaire du génome d’A. pleuropneumoniae sérotype 5b souche L20 et 2033 ORF de la version finale annotée du même génome ont été utilisées. Dans un premier temps, des expériences réalisées dans des conditions de concentration restreinte en fer ont permis d’identifier 210 gènes différentiellement exprimés, dont 92 étaient surexprimés. Plusieurs nouveaux mécanismes d’acquisition du fer ont pu être identifiés, incluant un système homologue au système YfeABCD de Yersinia pestis, impliqué dans l’acquisition du fer chélaté, ainsi que des gènes homologues aux composantes du système HmbR de Neisseria meningitidis impliqué dans l’acquisition du fer à partir de l’hémoglobine. Dans des conditions de culture permettant la formation de biofilms, les gènes tadC et tadD d’un opéron tad (« tight adherence locus ») putatif, les gènes pgaBC impliqués dans la synthèse d’un polysaccharide de la matrice du biofilm ainsi que deux gènes présentant de fortes homologies avec un gène codant pour l’adhésine auto- transporteur Hsf retrouvée chez Haemophilus influenzae ont montré une surexpression significative. Plusieurs de ces gènes ont également été retrouvés lors iv d’expériences réalisées avec des cellules épithéliales d’origine pulmonaire en culture, qui ont permis d’identifier 170 gènes différentiellement exprimés après la croissance planctonique au-dessus des cellules, et 131 autres suite à l’adhésion à ces cellules. Parmis les gènes surexprimés, les gènes tadB et rcpA de l’opéron tad putatif, les gènes pgaBC ainsi que le gène codant pour l’homologue d’Hsf ont été retrouvés. En présence de liquide de lavage broncho-alvéolaire (BALF), 156 gènes ont montré un profil d’expression modifié, et le gène apxIVA, identifié comme étant surexprimé, a pu être détecté pour la première fois dans des conditions de croissance in vitro. Finalement, des expériences visant à déterminer les gènes utilisés directement chez l’animal en phase aiguë de la pleuropneumonie porcine ont permis d’identifier 150 gènes qui étaient différentiellement exprimés. En plus d’identifier des gènes d’un possible opéron codant pour un fimbriae de type IV, 3 des 72 gènes surexprimés sont conservés chez tous les sérotypes d’A. pleuropneumoniae et codent pour des protéines ou lipoprotéines de surface. Nos expériences ont permis d’identifier plusieurs nouveaux facteurs de virulence potentiels chez A. pleuropneumoniae ainsi que plusieurs nouvelles cibles potentielles pour l’élaboration de vaccins efficaces contre tous les sérotypes. Mots clés : Actinobacillus pleuropneumoniae, trancriptomique, fer, biofilm, culture cellulaire, liquide de lavage broncho-alvéolaire, in vivo, vaccin v ABSTRACT Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia. Transmission of the disease occurs through direct contact or aerosols. The bacteria possess many virulence factors, namely capsular polysaccharides, lipopolysaccharides, four Apx toxins and iron acquisition mechanisms. To this day, an efficient cross-serotype vaccine has yet to be developed. In order to investigate regulation mechanisms in A. pleuropneumoniae and to identify new potential targets for the synthesis of subunit vaccines, the transcriptomic profile of the bacteria under conditions that simulate the infection and following a natural acute infection in vivo were studied. The experiences relied on first and second generation microarrays (AppChip1 and AppChip2) designed using 2025 ORFs of the draft version of the A. pleuropneumoniae serotype 5b strain L20 genome and 2033 ORFs of the final and annotated version of the same genome respectively. First, experiments were conducted under iron-restricted conditions and 210 genes were deemed differentially expressed, 92 of which were up-regulated. Some new putative iron acquisition mechanisms were identified, including genes homologous to those of the Yersinia pestis YfeABCD chelated-iron acquisition system, as well as other genes homologous to components of the HmbR iron uptake from hemoglobin system of Neisseria meningitidis. When cultured in conditions promoting biofilm production, genes tadC and tadD from a putative tad (« tight adherence locus ») operon, genes pgaABC involved in the biosynthesis of a polysaccharide of the biofilm matrix as well as two ORFs encoding a putative autotransporter adhesins similar to the Haemophilus influenzae Hsf adhesin were all significantly overexpressed. Many of these genes were also overexpressed when lung epithelial cells were infected with A. pleuropneumoniae. While 170 genes were differentially expressed after planktonic growth in the culture medium above the cells, another 131 were identified following direct adhesion to the vi cells. Genes tadB and rcpA of the tad locus, as well as genes pgaBC and an ORF coding for the Hsf homolog where all found among overexpressed genes. When A. pleuropneumoniae was cultured in contact with broncho-alveolar lavage fluids (BALF), 156 genes were significantly differentially expressed and gene apxIVA, which was up-regulated, was detected for the first time during in in vitro growth conditions. Finally, experiments were conducted in vivo in animals naturally infected with A. pleuropneumoniae in the late stage of the acute phase in order to identify genes that are expressed during the infection of the natural host. While 150 genes were deemed differentially expressed, genes apxIVA as well as two genes from an operon coding for a putative type IV fimbriae were up-regulated. Out of those 72 genes that were overexpressed, 3 encode proteins or lipoproteins of the outer membrane which are conserved among all serotypes of the bacteria. Overall, we were able to identify several new potential virulence factors for A. pleuropneumoniae in the course of our experiments, as well as several new potential targets for the elaboration of an efficient cross-serotype vaccine. Key words: Actinobacillus pleuropneumoniae, trancriptomic, iron, biofilm, cell culture, BALF, in vivo, vaccine vii TABLE DES MATIÈRES LISTE DES TABLEAUX ........................................................................................... x LISTE DES FIGURES ........................................................................................... xiv LISTE DES SIGLES ET DES ABBRÉVIATIONS ............................................. xix DÉDICACE ........................................................................................................... xxiv REMERCIEMENTS ............................................................................................ xxvi INTRODUCTION ...................................................................................................... 1 REVUE DE LITTÉRATURE .................................................................................... 4 1. ACTINOBACILLUS PLEUROPNEUMONIAE ................................................................... 5 1.1 Généralités et caractéristiques biochimiques .................................................. 5 1.2 La pleuropneumonie porcine .......................................................................... 6 1.3 Les facteurs de virulence ................................................................................ 8 1.3.1 La capsule polysaccharidique .................................................................. 8 1.3.2 Les lipopolysaccharides (LPS) de la surface bactérienne ...................... 10 1.3.3 Fimbriae ................................................................................................. 13 1.3.4 Formation de biofilms ............................................................................ 15 1.3.5 Mécanismes d’acquisition du fer ..........................................................
Load more

Recommended publications
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd
    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
    [Show full text]
  • Recombinant Escheichia Coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate
    J. Ind. Eng. Chem., Vol. 12, No. 5, (2006) 757-761 Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate Sun-Gu Lee† and Byung-Gee Kim* Department of Chemical and Biochemical Engineering, Pusan National University, Busan 609-735, Korea *School of Chemical Engineering, and Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-742, Korea Received April 24, 2006; Accepted May 22, 2006 Abstract: A recombinant Escherichia coli overexpressing CMP-kinase was constructed and employed as a whole cell biocatalyst for the conversion of cytidine 5′-monophosphate to cytidine 5′-triphosphate. In the whole cell biocatalysis, recombinant CMP kinase catalyzed the conversion of CMP to CDP, and endogenous acetate kinase of the E. coli was utilized for the ATP regeneration as well as for the conversion of CDP to CTP. A conversion yield of ca. 88 % CTP was obtained when starting with 20 mM CMP, 1 mM ATP, and 80 mM acetyl phosphate based on the initial CMP concentration. Endogenous pyruvate kinase and poly- phosphate kinase were inefficient in the process. The CTP production system was applied to the production of CMP-NeuAc by additionally introducing the CMP-NeuAc synthetase gene into the recombinant E. coli. Keywords: CMP-kinase, whole cell biocatalysis, ATP regeneration, cytidine 5′-monophosphate Introduction employing enzymes [4]. They applied various enzymatic 1) methods and chemical methods and concluded that the As glycosyltransferase-catalyzed synthetic techniques enzymatic method based on adenylate kinase/pyruvate are becoming recognized as powerful methods for the kinase provided the most convenient route to CTP. In the preparation of biologically important oligosaccharides, process, CTP was generated efficiently from an inexpen- the development of cost-efficient production methods for sive substrate, CMP.
    [Show full text]
  • Photosynthetic Metabolism and Nitrogen Reshuffling Are Regulated
    plants Article Photosynthetic Metabolism and Nitrogen Reshuffling Are Regulated by Reversible Cysteine Thiol Oxidation Following Nitrogen Deprivation in Chlamydomonas Amanda L. Smythers , Evan W. McConnell , Hailey C. Lewis, Saher N. Mubarek and Leslie M. Hicks * Department of Chemistry, The University of North Carolina at Chapel Hill, Chapel Hill, NC, 27599, USA; [email protected] (A.L.S.); [email protected] (E.W.M.); [email protected] (H.C.L.); [email protected] (S.N.M.) * Correspondence: [email protected]; Tel.: +1-919-843-6903 Received: 30 April 2020; Accepted: 19 June 2020; Published: 23 June 2020 Abstract: As global temperatures climb to historic highs, the far-reaching effects of climate change have impacted agricultural nutrient availability. This has extended to low latitude oceans, where a deficit in both nitrogen and phosphorus stores has led to dramatic decreases in carbon sequestration in oceanic phytoplankton. Although Chlamydomonas reinhardtii, a freshwater model green alga, has shown drastic systems-level alterations following nitrogen deprivation, the mechanisms through which these alterations are triggered and regulated are not fully understood. This study examined the role of reversible oxidative signaling in the nitrogen stress response of C. reinhardtii. Using oxidized cysteine resin-assisted capture enrichment coupled with label-free quantitative proteomics, 7889 unique oxidized cysteine thiol identifiers were quantified, with 231 significantly changing peptides from 184 proteins following 2 h of nitrogen deprivation. These results demonstrate that the cellular response to nitrogen assimilation, photosynthesis, pigment biosynthesis, and lipid metabolism are regulated by reversible oxidation. An enhanced role of non-damaging oxidative pathways is observed throughout the photosynthetic apparatus that provides a framework for further analysis in phototrophs.
    [Show full text]
  • Découverte D'une Nouvelle Famille De Protéine Kinases Bactériennes
    Découverte d’une nouvelle famille de protéine kinases bactériennes : mécanismes de fonctionnement et rôle cellulaire de YdiB, un archétype chez Baccillus subtilis Hien-Anh Nguyen To cite this version: Hien-Anh Nguyen. Découverte d’une nouvelle famille de protéine kinases bactériennes : mécanismes de fonctionnement et rôle cellulaire de YdiB, un archétype chez Baccillus subtilis. Sciences agricoles. Université de Grenoble, 2012. Français. NNT : 2012GRENV017. tel-00721757 HAL Id: tel-00721757 https://tel.archives-ouvertes.fr/tel-00721757 Submitted on 30 Jul 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITÉ DE GRENOBLE Spécialité : Chimie-Biologie Arrêté ministériel : 7 août 2006 Présentée par Hien-Anh NGUYEN Thèse dirigée par le Dr. Jean-Michel JAULT préparée au sein de l’Institut de Biologie Structurale J.-P. Ebel, et du CEA de Grenoble dans l'École Doctorale Chimie et Sciences du Vivant Découverte d’une nouvelle famille de protéines kinases bactériennes : Mécanisme de fonctionnement et rôle cellulaire de YdiB, un représentant chez B. subtilis Thèse soutenue publiquement le 23 mai 2012 devant le jury composé de : Mme. Patricia DOUBLET Rapporteur Prof.
    [Show full text]
  • Two-Dimensional Isobutyl Acetate Production Pathways to Improve Carbon Yield
    ARTICLE Received 23 Apr 2015 | Accepted 13 May 2015 | Published 25 Jun 2015 DOI: 10.1038/ncomms8488 OPEN Two-dimensional isobutyl acetate production pathways to improve carbon yield Yohei Tashiro1, Shuchi H. Desai1,2 & Shota Atsumi1,2 For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. 1 Department of Chemistry, University of California, Davis, One Shields Avenue, Davis, California 95616, USA. 2 Microbiology Graduate Group, University of California, Davis, One Shields Avenue, Davis, California 95616, USA. Correspondence and requests for materials should be addressed to S.A. (email: [email protected]). NATURE COMMUNICATIONS | 6:7488 | DOI: 10.1038/ncomms8488 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8488 iochemical production from biomass, a renewable resource OH synthesized from CO2 and sunlight, may contribute to a 1 Bcarbon-neutral society .
    [Show full text]
  • Acetate Activation in Methanosaeta Thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-Coa Synthetase
    Hindawi Publishing Corporation Archaea Volume 2012, Article ID 315153, 10 pages doi:10.1155/2012/315153 Research Article Acetate Activation in Methanosaeta thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-CoA Synthetase Stefanie Berger, Cornelia Welte, and Uwe Deppenmeier Institute for Microbiology and Biotechnology, University of Bonn, Meckenheimer Allee 168, 53115 Bonn, Germany Correspondence should be addressed to Uwe Deppenmeier, [email protected] Received 16 May 2012; Accepted 30 June 2012 Academic Editor: Francesca Paradisi Copyright © 2012 Stefanie Berger et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The thermophilic methanogen Methanosaeta thermophila uses acetate as sole substrate for methanogenesis. It was proposed that the acetate activation reaction that is needed to feed acetate into the methanogenic pathway requires the hydrolysis of two ATP, whereas the acetate activation reaction in Methanosarcina sp. is known to require only one ATP. As these organisms live at the thermodynamic limit that sustains life, the acetate activation reaction in Mt. thermophila seems too costly and was thus reevaluated. It was found that of the putative acetate activation enzymes one gene encoding an AMP-forming acetyl-CoA synthetase was highly expressed. The corresponding enzyme was purified and characterized in detail. It catalyzed the ATP-dependent formation of acetyl- CoA, AMP, and pyrophosphate (PPi) and was only moderately inhibited by PPi. The breakdown of PPi was performed by a soluble pyrophosphatase. This enzyme was also purified and characterized. The pyrophosphatase hydrolyzed the major part of PPi (KM = 0.27 ± 0.05 mM) that was produced in the acetate activation reaction.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Sex Differences in the Genetic Architecture of Depression
    www.nature.com/scientificreports OPEN Sex diferences in the genetic architecture of depression Hee-Ju Kang1,3, Yoomi Park2,3, Kyung-Hun Yoo2, Ki-Tae Kim2, Eun-Song Kim1, Ju-Wan Kim1, Sung-Wan Kim1, Il-Seon Shin1, Jin-Sang Yoon1, Ju Han Kim2,3 ✉ & Jae-Min Kim1,3 ✉ The prevalence and clinical characteristics of depressive disorders difer between women and men; however, the genetic contribution to sex diferences in depressive disorders has not been elucidated. To evaluate sex-specifc diferences in the genetic architecture of depression, whole exome sequencing of samples from 1000 patients (70.7% female) with depressive disorder was conducted. Control data from healthy individuals with no psychiatric disorder (n = 72, 26.4% female) and East-Asian subpopulation 1000 Genome Project data (n = 207, 50.7% female) were included. The genetic variation between men and women was directly compared using both qualitative and quantitative research designs. Qualitative analysis identifed fve genetic markers potentially associated with increased risk of depressive disorder in females, including three variants (rs201432982 within PDE4A, and rs62640397 and rs79442975 within FDX1L) mapping to chromosome 19p13.2 and two novel variants (rs820182 and rs820148) within MYO15B at the chromosome 17p25.1 locus. Depressed patients homozygous for these variants showed more severe depressive symptoms and higher suicidality than those who were not homozygotes (i.e., heterozygotes and homozygotes for the non-associated allele). Quantitative analysis demonstrated that the genetic burden of protein-truncating and deleterious variants was higher in males than females, even after permutation testing. Our study provides novel genetic evidence that the higher prevalence of depressive disorders in women may be attributable to inherited variants.
    [Show full text]
  • A Novel Complex Neurological Phenotype Due to a Homozygous Mutation in FDX2
    doi:10.1093/brain/awy172 BRAIN 2018: 141; 2289–2298 | 2289 Downloaded from https://academic.oup.com/brain/article-abstract/141/8/2289/5054138 by FAC.MED.RIB.PRETO-BIBL.CENTRAL-USP user on 26 October 2018 A novel complex neurological phenotype due to a homozygous mutation in FDX2 Juliana Gurgel-Giannetti,1,* David S. Lynch,2,3,* Anderson Rodrigues Branda˜o de Paiva,4 Leandro Tavares Lucato,5 Guilherme Yamamoto,6 Christer Thomsen,7 Somsuvro Basu,8 Fernando Freua,4 Alexandre Varella Giannetti,9 Bruno Della Ripa de Assis,4 Mara Dell Ospedale Ribeiro,4 Isabella Barcelos,4 Katiane Saya˜o Souza,4 Fernanda Monti,4 Uira´ Souto Melo,6 Simone Amorim,4 Leonardo G. L. Silva,6 Lu´cia Ineˆs Macedo-Souza,6 Angela M. Vianna-Morgante,6 Michio Hirano,10 Marjo S. Van der Knaap,11 Roland Lill,8,12 Mariz Vainzof,6 Anders Oldfors,7 Henry Houlden2,3 and Fernando Kok4,6 *These authors contributed equally to this work. Defects in iron–sulphur [Fe-S] cluster biogenesis are increasingly recognized as causing neurological disease. Mutations in a number of genes that encode proteins involved in mitochondrial [Fe-S] protein assembly lead to complex neurological phenotypes. One class of proteins essential in the early cluster assembly are ferredoxins. FDX2 is ubiquitously expressed and is essential in the de novo formation of [2Fe-2S] clusters in humans. We describe and genetically define a novel complex neurological syndrome identified in two Brazilian families, with a novel homozygous mutation in FDX2. Patients were clinically evaluated, underwent MRI, nerve conduction studies, EMG and muscle biopsy.
    [Show full text]
  • Bacteriostatic and Bactericidal Effects of Free Nitrous Acid on Model Microbes in Wastewater Treatment
    Bacteriostatic and bactericidal effects of free nitrous acid on model microbes in wastewater treatment Shuhong Gao Master of Science Harbin Institute of Technology, Harbin, China A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2016 School of Chemical Engineering Advanced Water Management Centre Abstract There is great potential to use free nitrous acid (FNA), the protonated form of nitrite (HNO2), as an antimicrobial agent due to its bacteriostatic and bactericidal effects on a range of microorganisms. However, the antimicrobial mechanism of FNA is largely unknown. The overall objective of this thesis is to elucidate the responses of two model bacteria, namely Psuedomonas aeruginosa PAO1 and Desulfovibrio vulgaris Hildenborough, in wastewater treatment in terms of microbial susceptibility, tolerance and resistance to FNA exposure. The effects of FNA on the opportunistic pathogen P. aeruginosa PAO1, a well-studied denitrifier capable of nitrate/nitrite reduction through anaerobic respiration, were determined. It was revealed that the antimicrobial effect of FNA is concentration-determined and population-specific. By applying different levels of FNA, it was seen that 0.1 to 0.2 mg N/L FNA exerted a temporary inhibitory effect on P. aeruginosa PAO1 growth, while complete respiratory growth inhibition was not detected until an FNA concentration of 1.0 mg N/L was applied. The FNA concentration of 5.0 mg N/L caused complete cell killing and likely cell lysis. Differential killing by FNA in the P. aeruginosa PAO1 subpopulations was detected, suggesting intra-strain heterogeneity. A delayed recovery from FNA treatment suggested that FNA caused cell damage which required repair prior to P.
    [Show full text]
  • Structure and Functional Dynamics of the Mitochondrial Fe/S Cluster Synthesis Complex
    ARTICLE DOI: 10.1038/s41467-017-01497-1 OPEN Structure and functional dynamics of the mitochondrial Fe/S cluster synthesis complex Michal T. Boniecki1, Sven A. Freibert 2, Ulrich Mühlenhoff2, Roland Lill 2,3 & Miroslaw Cygler 1,4 Iron–sulfur (Fe/S) clusters are essential protein cofactors crucial for many cellular functions including DNA maintenance, protein translation, and energy conversion. De novo Fe/S cluster synthesis occurs on the mitochondrial scaffold protein ISCU and requires cysteine 1234567890 desulfurase NFS1, ferredoxin, frataxin, and the small factors ISD11 and ACP (acyl carrier protein). Both the mechanism of Fe/S cluster synthesis and function of ISD11-ACP are poorly understood. Here, we present crystal structures of three different NFS1-ISD11-ACP complexes with and without ISCU, and we use SAXS analyses to define the 3D architecture of the complete mitochondrial Fe/S cluster biosynthetic complex. Our structural and biochemical studies provide mechanistic insights into Fe/S cluster synthesis at the catalytic center defined by the active-site Cys of NFS1 and conserved Cys, Asp, and His residues of ISCU. We assign specific regulatory rather than catalytic roles to ISD11-ACP that link Fe/S cluster synthesis with mitochondrial lipid synthesis and cellular energy status. 1 Department of Biochemistry, University of Saskatchewan, 107 Wiggins Road, Saskatoon, SK, Canada S7N 5E5. 2 Institut für Zytobiologie und Zytopathologie, Philipps-Universität, Robert-Koch-Strasse 6, 35032 Marburg, Germany. 3 LOEWE Zentrum für Synthetische Mikrobiologie SynMikro, Hans- Meerwein-Strasse, 35043 Marburg, Germany. 4 Department of Biochemistry, McGill University, 3649 Promenade Sir William Osler, Montreal, QC, Canada H3G 0B1.
    [Show full text]
  • Ruminal Microbiome-Host Crosstalk Stimulates the Development of the Ruminal Epithelium in a Lamb Model
    Lin et al. Microbiome (2019) 7:83 https://doi.org/10.1186/s40168-019-0701-y RESEARCH Open Access Ruminal microbiome-host crosstalk stimulates the development of the ruminal epithelium in a lamb model Limei Lin1,2†, Fei Xie1,2†, Daming Sun1,2, Junhua Liu1,2, Weiyun Zhu1,2 and Shengyong Mao1,2* Abstract Background: The development of the rumen is an important physiological challenge for young ruminants. Previous studies have shown that starter feeding can effectively facilitate the growth and development of the rumen in ruminants. However, the mechanism through which starter feeding stimulates the development of the rumen is not clear. Here, we performed an integrated analysis in ruminal microbiota and a host transcriptomic profile in a lamb model with the intervention of starter feed to understand the ruminal microbiome-host crosstalk in stimulating the development of the ruminal epithelium. Results: Decreased ruminal pH and increased acetate and butyrate concentrations in the rumen, followed by increasing rumen organ index, were observed in lambs supplemented with starter. Using metagenome sequencing in combination with 16S rRNA and 18S rRNA gene amplicon sequencing, the results showed the abundance of acetate-producing Mitsuokella spp., lactate-producing Sharpea spp., lactate-utilizing Megasphaera spp., and Entodinium spp. was enriched in rumen microbial communities in the starter-feed group. The abundances of genes involved in sugar degradation were decreased in starter-feed lambs, but the GH13 encoding α-amylase was obviously increased. Rumen epithelial transcriptome analysis revealed that seven differentially expressed genes, including MAPK1, PIK3CB, TNFSF10, ITGA6, SNAI2, SAV1,andDLG, related to the cell growth module were upregulated, and BAD’s promotion of cell death was downregulated.
    [Show full text]