DOCSLIB.ORG

Table 1 the Primers Sequences Used for Real-Time Quantitative RT-PCR

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Table 1 the Primers Sequences Used for Real-Time Quantitative RT-PCR Table 1 The Primers Sequences used for Real-Time quantitative RT-PCR Analysis Gene symbol Sense Primer Antisense Primer Size (bp) p21WAF1/Cip1 CTTTGACTTCGTCACGGAGAC AGGCAGCGTATATCAGGAGAC 150 Max CGAAAACGTAGGGACCACAT TGCTGGTGTGTGGTTTTT 200 APC GATGAAATAGGATGTAATCAGACGAC GCTAAACATGAGTGGGGTCTC 350 BCL-2 CAGCTGCACCTGACG ATGCACCTACCCAGC 320 p53 GGAGGTTGTGAGGCGCTGG CACGCACCTCAAAGCTGTTC 330 Bax TGCAGAGGATGATTGCTGAC GAGGACTCCAGCCACAAAGA 270 Syndecan-1 TCTGACTCGGTTTCTCCAA ATTGCTGTCTCCCGACCAA 360 Syndecan-3 TTTGGGGCAGACCCCACTA ATCCCTAAACCCTGAACCT 550 Perlecan ACAGTGCAACAAGTGCAAGG CTGAAAGTGACCAGGCTCCTC 450 Vitronectin ACTTCTTCAAGGGGAAACAG TATGGCTGCGTCCACTTTG 400 PCAF TTTTTTTAATCCAGCTTCC AAGAAACAGGGTTTCTCCAAG 750 APO1A CAAGAACGGCGGCGCCAGA GCTCTCCAGCACGGGCAGGCA 220 β-Actin CCTTCTACAATGAGC ACGTCACACTTCATG 260 EGR-1 GCCAAACAGTCACTTTGTT GAAAGTGTTTTTTCTTCGTCG 400 MAPK3 ACCTGCGACCTTAAGATTTGT GAAAAGCTTGGCCCAAGCC 300 TIMP-1 CCCTGATGACGAGGTCGGAA AGATCCAGCGCCCAGAGAGA 220 Caspase-3 ATGGAGAACACTGAAAACTCA TTAGTGATAAAAATAGAGTTC 200 TIMP-3 CCCCATGTGCAGTACATCCA GCACAGCCCCGTGTACATCT 180 Biglycan GATGGCCTGAAGCTCAA GGTTTGTTGAAGAGGCTG 460 Stat3 TTTCTCTATTTTTAAAAGTGC AAGTATTGTCGGCCAGAGAGC 460 TIMP2 CAAGAGGATCCAGTATGAGAT GCCCGTGTAGATAAACTCTAT 570 CCRK ACCTGCAGATGCTGCTCAAG GAAATGAACCCAACAAACCA 200 GAPDH CCACCCATGGCAAATTCCATGGGA TCTAGACGGCAGGTCAGGTCCACC 500 Table 2. Genes with Altered Expression in Cleaved vs. Native Antithrombin-Treated HUVECs Gene Fold Changes Gene Symbol Gene Description Cluster ID (ATC/ATN) Adhesion/ECM ARGN Agrin Hs.273330 2.18 CDH24 Caderhrin-like 24 Hs.155912 2.84 CENTB1 Centaurin, beta 1 Hs.337242 2.43 CENTG1 Centaurin ,gamma 1 Hs.302435 2.25 VTN vitronectin Hs.2257 2.16 BGN biglycan Hs.821 0.34 DNM2 dynamin 2 Hs.211463 0.45 DSTN destrin (actin depolymerizing factor) Hs.304192 0.44 FGA fibrinogen alpha chain Hs.351593 0.48 FGL1 fibrinogen-like 1 Hs.491143 0.44 FGL2 fibrinogen-like 2 Hs.520989 0.34 HSPG2 heparan sulfate proteoglycan 2 (perlecan) Hs.555874 0.44 LAMA5 laminin, alpha 5 Hs.244352 0.45 NIN ninein (GSK3B interacting protein) Hs.310429 0.45 PRG4 proteoglycan 4 Hs.432458 0.34 SDC1 syndecan 1 Hs.224607 0.37 SDC3 syndecan 3 (N-syndecan) Hs.158287 0.42 Cell Cycle control CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) Hs.370771 2.72 CCRK cell cycle related kinase Hs.522274 0.38 CDCA3 cell division cycle associated 3 Hs.524216 0.49 CDCA5 cell division cycle associated 5 Hs.434886 0.37 CDC16 cell division cycle 16 homolog Hs.374127 0.44 CDK2 cyclin-dependent kinase 2 Hs.19192 0.52 CDK2AP1 CDK2-associated protein 1 Hs.433201 0.62 CDK5 cyclin-dependent kinase 5 Hs.166071 0.42 CDKL5 cyclin-dependent kinase-like 5 Hs.435570 0.47 Malignancy APC adenomatosis polyposis coli Hs.158932 2.27 TIMP1 tissue inhibitor of metalloproteinase 1 Hs.522632 2.12 TIMP2 tissue inhibitor of metalloproteinase 2 Hs.104839 2.72 TIMP3 tissue inhibitor of metalloproteinase 3 Hs.297324 2.33 ELK1 ELK1, member of ETS oncogene family Hs.181128 0.46 FAP fibroblast activation protein, alpha Hs.516493 0.33 MLANA Melan-A Hs.154069 0.49 MSP transmembrane protease, serine 13 Hs.266308 0.42 RRAD Ras-related associated with diabetes Hs.1027 0.47 Transport APOA1 apolipoprotein A-I Hs.93194 2.00 APOC1 apolipoprotein C-I Hs.110675 2.26 HP haptoglobin Hs.513711 0.44 PLTP phospholipid transfer protein Hs.439312 2.13 Transcription/ Translation Nuclear factor of kappa light polypeptide gene enhancer NFKBIE in B-cells inhibitor, epsilon Hs.458276 2.11 EIF3S10 eukaryotic translation initiation factor 3, subunit 10 theta Hs.523299 0.45 HIST1H3H histone 1, H3h Hs.70937 0.34 HIST2H2BE histone 2, H2be Hs.2178 0.23 PCAF P300/CBP-associated factor Hs.533055 0.42 POU5F1 POU domain, class 5, transcription factor 1 Hs.249184 0.46 SPDEF SAM pointed domain containing ets transcription factor Hs.485158 0.24 SFPQ splicing factor proline/glutamine rich Hs.355934 0.50 TCF4 transcription factor 4 Hs.200285 0.42 TIP120A Cullin-associated and neddylation-dissociated 1 Hs.546407 0.42 Signal Transduction MST4 Mst3 and SOK1-related kinase Hs.444247 1.77 PRKACA protein kinase, cAMP-dependent, catalytic, lpha Hs.194350 1.74 PTPN2 protein tyrosine phosphatase, non-receptor type 2 Hs.123352 2.39 RAB3-GAP150 RAB3 GTPase-activating protein, non-catalytic subunit Hs.558471 1.86 DKFZp566C0424 Putative MAPK activating protein Hs.252967 0.45 EGR1 early growth response protein 1 Hs.326035 0.41 FGF20 fibroblast growth factor 20 Hs.199905 0.31 Ras-GTPase-activating protein SH3-domain-binding G3BP protein Hs.3353 0.30 GRLF1 glucocorticoid receptor DNA binding factor 1 Hs.509447 0.52 HIPK2 homeodomain interacting protein kinase 2 Hs.397465 0.25 IER3 immediate early response 3 Hs.76095 0.46 IGFBP1 insulin-like growth factor binding protein 1 Hs.401316 0.59 MAP3K14 mitogen-activated protein kinase kinase kinase 14 Hs.404183 0.53 MAP3K8 mitogen-activated protein kinase kinase kinase 8 Hs.432453 0.50 MAPK3 mitogen-activated protein kinase 3 Hs.861 0.42 MED28 Mediator of RNA polymerase II transcription, subunit 28 Hs.434075 0.44 PDE2A phosphodiesterase 2A, cGMP-stimulated Hs.503163 0.43 PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 Hs.132225 0.35 PLA2R1 phospholipase A2 receptor 1, 180kDa Hs.410477 0.45 PMVK phosphomevalonate kinase Hs.30954 0.66 PTPRF Protein tyrosine phosphatase, receptor type, f polypeptide Hs.530749 0.40 PPP2R5C protein phosphatase 2, regulatory subunit B (B56) Hs.368264 0.47 Protein kinase, cAMP-dependent, regulatory, type I, PRKAR1A alpha Hs.280342 0.37 SGK2 serum/glucocorticoid regulated kinase 2 Hs.472793 0.42 SIPA1L2 signal-induced proliferation-associated 1 like 2 Hs.268774 0.44 SLA Src-like-adaptor Hs.75367 0.63 STAT2 signal transducer and activator of transcription 2 Hs.530595 0.36 STAT3 signal transducer and activator of transcription 3 Hs.463059 0.48 STAT6 signal transducer and activator of transcription 6 Hs.524518 0.48 STK24 serine/threonine kinase 24 Hs.403917 0.42 Apoptosis CASP3 caspase 3, apoptosis-related cysteine protease Hs.141125 2.47 CIDEB Cell death-inducing DFFA-like effector b Hs.448590 1.88 DDX48 DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 Hs.389649 2.31 DDX6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Hs.408461 2.81 NK4 Interleukin 32 Hs.943 2.21 TNFRSF12A tumor necrosis factor receptor superfamily, member 12A Hs.355899 2.42 TP53I11 tumor protein p53 inducible protein 11 Hs.554791 2.32 Structural DNCL12 Dynein, cytoplasmic, light intermediate polypeptide 2 Hs.369068 2.0 KPNB1 Karyopherin (importin) beta 1 Hs.532793 0.43 PRH1 Proline-rich protein Hae III subfamily I Hs.558369 0.50 ZZANK1 Mindbomb homolog 2 (Drosophila) Hs.135805 2.1 Metabolism ENPP7 Ectonucleotide pyrophosphate/phosphodiesterase 7 Hs.114084 2.52 GSTPI Glutathione S-transferase pi Hs.523836 2.51 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, NDUFA11 11, 14.7 kDa Hs.406062 2.27 PCSK2 Proprotein convertase subtilisin kexin type 2 Hs.315186 2.17 PDHA1 Pyruvate dehydrogenase (lipoamide) alpha 1 Hs.530331 2.14 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase Hs.195471 3.29 PGM2 Phosphoglucomutase Hs.23363 2.25 SELK Selenoprotein K Hs.58471 2.59 COMT Catechol-O-methyl transferase Hs.370408 0.42 COX7A2 Cytochrome c oxidase subunit VIIa polypeptide 2 Hs.70312 0.42 CYP3A7 Cytochrome P450, family 3, subfamily A, polypeptide 7 Hs.111944 0.49 CYP11B1 Cytochrome P450, family 11, subfamily B, polypeptide 1 Hs.184927 0.24 DEGS1 Degenerative spermatocyte homolog 1, lipid desaturase Hs.299878 0.46 HEXB Hexosaminidase B (beta polypeptide) Hs.69293 0.47 LYZL6 Lysozyme-like 6 Hs.97477 0.49 NDUFS8 NADH dehgydrogenase (ubiquinone) Fe-S protein 8 Hs.90443 0.23 NPEPL1 Aminopeptidase-like 1 Hs.528513 0.50 Nudix (nucleoside diphosphate linked moiety X)-type NUDT14 motif 14 Hs.526432 0.35 PGK1 Phosphoglycerate kinase 1 Hs.78771 0.49 Immune response Fc fragment of IgE, high affinity I, receptor for; gamma FCER1G polypeptide Hs.433300 0.30 FCGR2B Fc fragment of IgG, low affinity Iib, receptor (CD32) Hs.492655 0.46 FCRL4 Fc receptor-like 4 Hs.120260 0.29 IGLL1 Immunoglobulin lambda-like polypeptide 1 Hs.348935 0.28 IL18BP Interleukin 18 binding protein Hs.325978 0.46 Other PVR Poliovirus receptor Hs.171844 3.27 APLN Apelin, AGTRLI ligand Hs.303084 0.29 CPNE5 Copine V Hs.372129 0.49 GPR143 G protein-coupled receptor 143 Hs.74124 0.48 HEYL Hairy/enhancer-of-split related with YRPW motif-like Hs.472566 0.50 MARCH7 Membrane-associated ring finger (C3HC4) 7 Hs.529272 0.42 NRP2 Neuropilin 2 Hs.471200 0.48 NYD-SP18 Testes development-related NYD-SP18 Hs.131098 0.43 OS9 Amplified in osteosarcoma Hs.527861 0.50 PARVB Parvin, beta Hs.475074 0.51 PER3 Period homolog 3 (Drosophila) Hs.533339 0.34 PWP1 PWP1 homolog (S. cerevisiae) Hs.506652 0.48 Peroxisomal membrane protein 3, 35 kDa (Zellweger PXMP3 syndrome) Hs.437966 0.51 PZP Pregnancy-zone protein Hs.480143 0.47 .
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer
    diagnostics Review Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer Shunsuke Kato Department of Clinical Oncology, Juntendo University Graduate School of Medicine, 2-1-1, Hongo, Bunkyo-ku, Tokyo 113-8421, Japan; [email protected]; Tel.: +81-3-5802-1543 Abstract: The prognosis of patients with solid tumours has remarkably improved with the develop- ment of molecular-targeted drugs and immune checkpoint inhibitors. However, the improvements in the prognosis of pancreatic cancer and biliary tract cancer is delayed compared to other carcinomas, and the 5-year survival rates of distal-stage disease are approximately 10 and 20%, respectively. How- ever, a comprehensive analysis of tumour cells using The Cancer Genome Atlas (TCGA) project has led to the identification of various driver mutations. Evidently, few mutations exist across organs, and basket trials targeting driver mutations regardless of the primary organ are being actively conducted. Such basket trials not only focus on the gate keeper-type oncogene mutations, such as HER2 and BRAF, but also focus on the caretaker-type tumour suppressor genes, such as BRCA1/2, mismatch repair-related genes, which cause hereditary cancer syndrome. As oncogene panel testing is a vital approach in routine practice, clinicians should devise a strategy for improved understanding of the cancer genome. Here, the gene mutation profiles of pancreatic cancer and biliary tract cancer have been outlined and the current status of tumour-agnostic therapy in these cancers has been reported. Keywords: pancreatic cancer; biliary tract cancer; targeted therapy; solid tumours; driver mutations; agonist therapy Citation: Kato, S. Tumour-Agnostic Therapy for Pancreatic Cancer and 1.
    [Show full text]
  • Prioritization and Comprehensive Analysis of Genes Associated with Melanoma
    ONCOLOGY LETTERS 18: 127-136, 2019 Prioritization and comprehensive analysis of genes associated with melanoma CHENG FENG, MING BAI, HAILIN ZHANG, ANG ZENG and WENCHAO ZHANG Department of Plastic Surgery, Peking Union Medical College Hospital, Beijing 100730, P.R. China Received August 13, 2018; Accepted February 28, 2019 DOI: 10.3892/ol.2019.10284 Abstract. Melanoma is a malignant tumor derived from accuracy and appropriate treatment due to medical advances, melanocytes, which occurs mostly in the skin. A major chal- its pathogenesis and natural course remain unclear. lenge in cancer research is the biological interpretation of the Melanoma is a malignant type of tumor, which may be complexity of cancer somatic mutation profiles. The aim of the composed of epidermal melanocytes, nevocytes or dermal present study was to obtain a comprehensive understanding of melanocytes. Epidemiology studies revealed that melanoma the formation and development of melanoma and to identify its is likely to be caused by hereditary factors and environmental associated genes. In the present study, a pipeline was proposed risk factors, including sex, age, ethnicity and geographic loca- for investigating key genes associated with melanoma based tion (6,7). This is in line with the most vital and potentially on the Online Mendelian Inheritance in Man and Search Tool reversible risk factor of malignant melanoma arising from for the Retrieval of Interacting Genes/Proteins databases an interaction between environmental exposure and genetic through a random walk model. Additionally, functional enrich- susceptibility. Gandini et al (8) revealed the association ment analysis was performed for key genes associated with between melanoma and ultraviolet (UV)-irradiation, and melanoma.
    [Show full text]
  • Significant Shortest Paths for the Detection of Putative Disease Modules
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SIGNIFICANT SHORTEST PATHS FOR THE DETECTION OF PUTATIVE DISEASE MODULES Daniele Pepe1 1Department of Oncology, KU Leuven, LKI–Leuven Cancer Institute, Leuven, Belgium Email address: DP: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Keywords Structural equation modeling, significant shortest paths, pathway analysis, disease modules. Abstract Background The characterization of diseases in terms of perturbated gene modules was recently introduced for the analysis of gene expression data. Some approaches were proposed in literature, but many times they are inductive approaches. This means that starting directly from data, they try to infer key gene networks potentially associated to the biological phenomenon studied. However they ignore the biological information already available to characterize the gene modules. Here we propose the detection of perturbed gene modules using the combination of data driven and hypothesis-driven approaches relying on biological metabolic pathways and significant shortest paths tested by structural equation modeling.
    [Show full text]
  • Epithelial Ovarian Cancer: Searching for New Modulators of Drug Resistance
    UNIVERSITÀ DEGLI STUDI DI UDINE Dipartimento di scienze mediche e biologiche PhD COURSE IN BIOMEDICAL SCIENCES AND BIOTECHNOLOGY XXIX cycle PhD THESIS Epithelial Ovarian Cancer: searching for new modulators of drug resistance. PhD student Supervisor Prof. Carlo Ennio Michele Pucillo Valentina Ranzuglia Co-supervisors Dr. Gustavo Baldassarre Dr. Monica Schiappacassi PhD coordinator Prof. Claudio Brancolini Academic year 2015/2016 This PhD work was done at Centro di Riferimento Oncologico (CRO, National Cancer Institute ) of Aviano, in the Division of Experimental Oncology 2 directed by Dr. Gustavo Baldassarre. i Table of contents Abstract 3 1. Introduction 4 1.1 Epithelial Ovarian Cancer 4 1.1.1 Platinum resistance 5 1.2 Functional Genomic Screening 8 1.3 Serum and glucocorticoid-regulated kinases 9 1.3.1 SGK structure 10 1.3.2 SGK activation and regulation 11 1.3.3 Role of SGKs in regulation of molecular and cellular functions 13 1.3.4 Serum- and glucocorticoid-regulated kinases in cancer 15 1.4 Autophagy 17 2.Aim of the study 21 3.Results 22 3.1 Identification of SGK2 as a mediator of platinum sensitivity in EOC cells. 22 3.2 SGK2 silencing sensitizes EOC cells to platinum. 23 3.3 SGK2 overexpression confers an increased resistance to platinum drug. 25 3.4 SGK2-overexpressing cells present an increased in vitro and in vivo growth 26 rate 3.5 SGK2 kinase activity is involved in EOC sensitivity to platinum treatment. 28 3.6 The SGK1/SGK2 kinase inhibitor, GSK650394, reduces cell viability in 29 combination with platinum. 3.7 GSK650394 is able to make SGK2-expressing cells more sensitive to platinum.
    [Show full text]
  • A Central Role of IKK2 and TPL2 in JNK Activation and Viral B-Cell Transformation
    ARTICLE https://doi.org/10.1038/s41467-020-14502-x OPEN A central role of IKK2 and TPL2 in JNK activation and viral B-cell transformation Stefanie Voigt1, Kai R. Sterz 1, Fabian Giehler1,2, Anne-Wiebe Mohr 1,2, Joanna B. Wilson 3, Andreas Moosmann 1,2,4 & Arnd Kieser 1,2* IκB kinase 2 (IKK2) is well known for its pivotal role as a mediator of the canonical NF-κB pathway, which has important functions in inflammation and immunity, but also in cancer. 1234567890():,; Here we identify a novel and critical function of IKK2 and its co-factor NEMO in the activation of oncogenic c-Jun N-terminal kinase (JNK) signaling, induced by the latent membrane protein 1 (LMP1) of Epstein-Barr virus (EBV). Independent of its kinase activity, the TGFβ- activated kinase 1 (TAK1) mediates LMP1 signaling complex formation, NEMO ubiquitination and subsequent IKK2 activation. The tumor progression locus 2 (TPL2) kinase is induced by LMP1 via IKK2 and transmits JNK activation signals downstream of IKK2. The IKK2-TPL2-JNK axis is specific for LMP1 and differs from TNFα, Interleukin−1 and CD40 signaling. This pathway mediates essential LMP1 survival signals in EBV-transformed human B cells and post-transplant lymphoma, and thus qualifies as a target for treatment of EBV-induced cancer. 1 Helmholtz Centre Munich - German Research Centre for Environmental Health, Research Unit Gene Vectors, Marchioninistrasse 25, 81377 Munich, Germany. 2 German Centre for Infection Research (DZIF), Partner Site Munich, Munich, Germany. 3 School of Life Sciences, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8QQ, UK.
    [Show full text]
  • AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
    Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date.
    [Show full text]
  • MAPK1/MAPK3 Monoclonal Antibody, Clone Sb46b
    MAPK1/MAPK3 monoclonal antibody, clone SB46b Catalog # : MAB3337 規格 : [ 500 ug ] List All Specification Application Image Product Mouse monoclonal antibody raised against recombinant Western Blot Description: MAPK1/MAPK3. Immunogen: Recombinant protein corresponding to human MAPK1/MAPK3. Host: Mouse enlarge Reactivity: Human Immunoprecipitation Specificity: human Erk 1 and human Erk2. Form: Liquid Isotype: IgG2a Recommend Western Blot (1-2 ug/mL) Usage: Immunoprecipitation (10-15ug) The optimal working dilution should be determined by the end user. Storage Buffer: In 100 mM BBS, pH 8.0 Storage Store at 4°C. Instruction: Datasheet: Download Publication Reference 1. Hydrophobic as well as charged residues in both MEK1 and ERK2 are important for their proper docking. Xu Be, Stippec S, Robinson FL, Cobb MH.J Biol Chem. 2001 Jul 13;276(28):26509-15. Epub 2001 May 14. 2. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH.Endocr Rev. 2001 Apr;22(2):153-83. 3. Molecular cloning, expression, and characterization of the human mitogen-activated protein kinase p44erk1. Charest DL, Mordret G, Harder KW, Jirik F, Pelech SL.Mol Cell Biol. 1993 Aug;13(8):4679-90. Applications Western Blot Page 1 of 3 2021/6/20 Human PBMC (Lane 1) and spleen lysate (Lane 2) was stained with MAPK1/3 monoclonal antibody, clone SB46b (Cat # MAB3337). Goat anti-Mouse IgG2a was used to develop. Immunoprecipitation MAPK1 MAPK3 Gene Information Entrez GeneID: 5595 Gene Name: MAPK3 Gene Alias: ERK1,HS44KDAP,HUMKER1A,MGC20180,P44ERK1,P44MAPK,PRKM3 Gene mitogen-activated protein kinase 3 Description: Omim ID: 601795 Gene Ontology: Hyperlink Gene Summary: The protein encoded by this gene is a member of the MAP kinase family.
    [Show full text]
  • Spitz Melanoma Is a Distinct Subset of Spitzoid Melanoma
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Mod Pathol Manuscript Author . Author manuscript; Manuscript Author available in PMC 2020 July 03. Published in final edited form as: Mod Pathol. 2020 June ; 33(6): 1122–1134. doi:10.1038/s41379-019-0445-z. Spitz Melanoma is a Distinct Subset of Spitzoid Melanoma Shyam Raghavan, MD1, Sandra Peternel, MD2,3, Thaddeus W. Mully, MD2, Jeffrey P. North, MD2, Laura B. Pincus, MD2, Philip E. LeBoit, MD2, Timothy H. McCalmont, MD2, Boris C. Bastian, MD, PhD2, Iwei Yeh, MD, PhD2 1Department of Pathology, Stanford University, Stanford, CA 2Departments of Pathology and Dermatology, University of California San Francisco, San Francisco, CA 3Department of Dermatovenerology, University of Rijeka, Faculty of Medicine, Rijeka, Croatia Abstract Melanomas that have histopathologic features that overlap with those of Spitz nevus are referred to as spitzoid melanomas. However, the diagnostic concept is used inconsistently and genomic analyses suggest it is a heterogeneous category. Spitz tumors, the spectrum of melanocytic neoplasms extending from Spitz nevi to their malignant counterpart Spitz melanoma, are defined in the 2018 WHO classification of skin tumors by the presence of specific genetic alterations such a kinase fusions or HRAS mutations. It is unclear what fraction of ‘spitzoid melanomas’ defined solely by their histopathologic features belong to the category of Spitz melanoma or to other melanoma subtypes. We assembled a cohort of 25 spitzoid melanomas diagnosed at a single institution over an eight-year period and performed high coverage DNA sequencing of 480 cancer related genes. Transcriptome wide RNA sequencing was performed for select cases.
    [Show full text]
  • N-Glycan Trimming in the ER and Calnexin/Calreticulin Cycle
    Neurotransmitter receptorsGABA and A postsynapticreceptor activation signal transmission Ligand-gated ion channel transport GABAGABA Areceptor receptor alpha-5 alpha-1/beta-1/gamma-2 subunit GABA A receptor alpha-2/beta-2/gamma-2GABA receptor alpha-4 subunit GABAGABA receptor A receptor beta-3 subunitalpha-6/beta-2/gamma-2 GABA-AGABA receptor; A receptor alpha-1/beta-2/gamma-2GABA receptoralpha-3/beta-2/gamma-2 alpha-3 subunit GABA-A GABAreceptor; receptor benzodiazepine alpha-6 subunit site GABA-AGABA-A receptor; receptor; GABA-A anion site channel (alpha1/beta2 interface) GABA-A receptor;GABA alpha-6/beta-3/gamma-2 receptor beta-2 subunit GABAGABA receptorGABA-A receptor alpha-2receptor; alpha-1 subunit agonist subunit GABA site Serotonin 3a (5-HT3a) receptor GABA receptorGABA-C rho-1 subunitreceptor GlycineSerotonin receptor subunit3 (5-HT3) alpha-1 receptor GABA receptor rho-2 subunit GlycineGlycine receptor receptor subunit subunit alpha-2 alpha-3 Ca2+ activated K+ channels Metabolism of ingested SeMet, Sec, MeSec into H2Se SmallIntermediateSmall conductance conductance conductance calcium-activated calcium-activated calcium-activated potassium potassium potassiumchannel channel protein channel protein 2 protein 1 4 Small conductance calcium-activatedCalcium-activated potassium potassium channel alpha/beta channel 1 protein 3 Calcium-activated potassiumHistamine channel subunit alpha-1 N-methyltransferase Neuraminidase Pyrimidine biosynthesis Nicotinamide N-methyltransferase Adenosylhomocysteinase PolymerasePolymeraseHistidine basic
    [Show full text]