DOCSLIB.ORG

Asteraceae): Evidence from Morphology, Karyotype, and ITS Sequences

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Asteraceae): Evidence from Morphology, Karyotype, and ITS Sequences Botanical Studies (2006) 47: 191-197. PLANT BIOSYSTEMATICS Natural hybridization between Aster ageratoides var. scaberulus and Kalimeris indica (Asteraceae): evidence from morphology, karyotype, and ITS sequences Wei-PingLI* College of Life Sciences, Hunan Normal University, Changsha 410081, P. R. China (ReceivedApril14,2004;AcceptedNovember4,2005) ABSTRACT. AnewnaturalhybridfromtheHengshanMountaininHunanProvince,China,wasfound. Comparisonsofmorphology,karyotype,andITSsequencesamongthehybridanditsparentalspeciesshow thatthehybridrepresentsF1progenyfromhybridizationbetween Aster ageratoidesvar.scaberulus and Ka- limeris indica.Basedonmorphologicalandkaryotypicalobservationsofthehybrid,thisstudysuggeststhat naturalhybridizationbetweenAster and Kalimeriscouldhaveleadtotheshorteningofthepappusanda specialkaryotype(LS-type)andmakesthedelimitingofAsterand Kalimeris difficult. This study also indi- catesthatkaryotypeinvestigationsmaybeparticularlyusefulinresolvingsomeofthetaxonomicconfusion betweenAster and Kalimeris. Keywords:Aster;Kalimeris;Karyotype;Naturalhybridization;Pappus. INTRODUCTION analyses,Tarasuggestedthathybridizationhadoccurred betweenAster ovatus (Franch.etSav.)SoejimaetMot. Naturalhybridizationisafrequentphenomenonin Ito(A. ageratoidessubsp.ovatus (Franch.etSav.)Ka- plantsandplaysanimportantroleinplantevolution, tam.)andKalimeris incisa(Fisch.)DC.,andthatinfact leadinginatleastsomecasestoformationofnewspe- A. ovatuswasanamphidiploidthatoriginatedfollowing cies.Inaddition,hybridizationoftengeneratesconsider- intergenerichybridizationbetweenAsterandKalimeris. abletaxonomicconfusionbyfacilitatingintrogressionof However,manysubsequentauthorshaveoverlookedthe plant traits. Therefore, confirmation of the hybrid nature morphologicalcharactersofhybridsandthepotential andparentageisimportantinstudyingplantevolution, impactofintergenerichybridizationonthecomplexand andmayhelptoresolvecertaintaxonomicproblems. uncertainrelationshipbetweenthesetwogenera.This Unfortunately,manyhybridsdescribedinthebotanical studyprovidesthefirstreportofhybridizationbetween literature(e.g.HsiehandWang,1989;Chang,1991;Sun Aster ageratoidesvar.scaberulus (Miq)LingandKalim- andHuang,1994;Zhangetal.,1995;ZhangandZhao, eris indica (L.) Sch.-Bip. with verification of the parent- 1995;QianandSun,1998;Ren,1996;ZhouandWu, age.Thisstudydemonstratestheuseofkaryotypingand 2001;Zhangetal.,2003)weredeterminedbasedonlyon ofmolecularsequencingasameanstodetectinghybrids theirmorphologicalintermediacybetweentheirputative anddiscussestheimplicationoftheseresultsforthephy- parents.However,morphologicalintermediacymayresult logenyofAsterandKalimeris. fromcontinuousvariationandthehighplasticityofmany traits(Xu,1998;Craftetal.,2002).Inrecentyears,mo- MATERIALS AND METHODS leculardatahaveplayedanincreasingroleinthedetection andverificationofputativehybrids(Smithetal.,1996; Study site and materials MorrellandRieseberg,1998;Milne,1999;Durand,2002; Plantmaterialsforthisstudywerecollectedfrom DendaandYokota,2003). HengshanMountain,locatedinthemiddle-subtropical Tara (1972, 1977, 1978a, 1978b, 1979) first described monsoonzoneincentralHunanProvince,inChina,at intergenerichybridizationbetweenAsterandKalimeris 112°34’to112°44’Eand27°10’to27°20’N.Theputative (Asteraceae,Astereae,Asterinae).Basedoncytological hybridplantswerefoundatasunnydeforestedsiteneara subtropicalconiferousforestat300malt. Thesehybrids *Correspondingauthor:E-mail:[email protected];Tel: appearedtohaveleavesandinflorescencesintermedi- 86-731-8871052;Fax:86-731-8883310. atebetweentwosympatrictaxa,Aster ageratoidesvar. 192 Botanical Studies, Vol. 47, 2006 scaberulus andKalimerisindica,whichwerecommon automatedsequencer(PEAppliedBiosystems,Inc.).Prim- atthesite.Aster ageratoidesvar.laticorymbus(Vant.) erswerethesameasthoseoftheinitialPCR.Foreach Hand.-Mazz.alsooccursatHengshanMountain,butthe sample,bothforwardandreversesequencesofITS1,5.8S populationwasfoundtobeahexaploid(Li,unpublished) andITS2wereobtained.Eachbasepositionwasexamined andwasspatiallydistantfromtheputativehybrid,sug- foragreementbetweencomplementarystrands. gestingthatitcouldnotbeoneoftheparentsoftheputa- tivehybrid.Itisthusexcludedfromthisstudy. RESULTS Twelveputativehybridindividualswerecollectedand preparedasspecimensformorphological analyses,and Morphology rhizomesofthreeindividualsweretransplantedtoHunan Amorphologicalcomparisonamongthethreetaxais NormalUniversityforcytologicalandmolecularinvesti- summarizedinTable1.Thetwoputativeparentsdiffer gation.ThirtyplantseachofA. ageratoidesvar.scaberulus significantlyinall16characters.Bycontrast,thepre- andK. indicathatgrewneartheputativehybridswere sumedhybridshaveintermediatecharacterstatesineight preparedasspecimensformorphological analyses,and characters,includingdistributionofstomata,numberof five each were transplanted for cytological and molecular florets, size of achenes, and especially length of pappus. investigation. All specimens were identified according to ThehybridsresembleA. ageratoidesvar. scaberulus,in LingandChen(1985)andweredepositedasherbarium five characters, such as lack of stomata on upper leaves, vouchersatHunanNormalUniversity(HNNU). shapeofinnerphyllaries,widthofmiddlephyllaries,and lackofglandsonphyllariesandovaries,andresembleK. Methods indicaintheotherthree,includingnumberofbranches After preliminary observation, 16 morphologi- above, size of middle leaves, and color of ray florets. calcharacters—includingfeaturesofbranches,middle leaves,phyllaries,florets,andachenes—werefound Karyotype todifferbetweenthetwoputativeparentalspecies.All Themetaphasechromosomesandthekaryotypeofthe field collections were scored for these 16 characters. For threetaxaareshowninFigure1.Allthreetaxaaretetra- quantitativefeatures,suchassizeofmiddleleavesand ploid with 2n=4x=36. However, there are significant dif- numberofflorets,themeasurementsarepresentedasa ferencesinkaryotypeamongthem.All36chromosomes rangeofvariation. inA. ageratoidesvar.scaberulusareL-type(largechro- Actively growing root tips for chromosome mosomes), with the length varying from 2.51-4.35 μm observationswerecutfromlivingplants,pretreatedwith whileall36chromosomesofK. indicaareS-type(short 0.1%colchicineat8-12°Cfor4h,fixedinCarnoyI chromosomes), ranging in length from 1.4-1.93 μm. The (glacial acetic acid: 95% ethanol=1:3) at room temperature longestchromosomepairofK. indica,1.93inlength,is for12h,thenmaceratedin1mol/Lhydrochloricacid shorterthantheshortestpairofA. ageratoidesvar.scab- at60°Cfor8min,stainedin5%NH4Fe(SO4)2,atroom erulus.Theputativehybridisintermediateinkaryotype, temperaturefor3h,stainedin0.75%hematoxylinfor with 18 L-type chromosomes (2.49-4.1 μm) and 18 S-type 3h,washedindistilledwaterfor30min,andfinally chromosomes (1.35-1.85 μm). depigmentedandsquashedin45%aceticacid. FoursamplesforITSanalysis,oneeachfromA. ag- ITS sequences eratoidesvar.scaberulus andK. indica,andtwo,respec- TheboundariesoftheITSregion(ITS1,5.8S,and tively,fromputativehybridindividuals wereobtained ITS2)weredeterminedbycomparisontopublishedITS fromplantscultivatedatHunanNormalUniversity.Total sequencesofAster amellusL.andKalimeris integrifolia genomicDNAwasisolatedfromfreshleaftissueusing (L.)Less(NoyesandRieseberg,1999).Thelengthof theCTABmethodofRogerandBendish(1988).The theITSsequenceofallthematerialsstudiedis630bp. twointernaltranscribedspacers(ITS-1,ITS-2)and5.8S ThesequencesofA. geratoidesvar.scaberulusandK. nrDNA were amplified using the primers “ITS1” (5´AGT indicadifferfromoneanotherat13sites(2%;Table2). CGTAACAAGGTTTCCGTAG3´)and“ITS4”(5´ Ateachofthese13sitesthesequencespectrumofthe TCCTCCGCTTATTGATATGC3´). The amplification putativehybridindividualsshowstwooverlappedbands reaction was performed in 50 μL volumes using 10-20 ng withthepeakabouthalfashighasthoseofneighboring of genomic DNA, 5 μl MgCl2 (25 mmol/L), 4 μl dNTP (2.5 sites,indicatingthattwodifferentbasepairsareateach mmol/L), 1 μl (6.25 pmol) of each primer, and 0.25 μl (5 ofthesesitesthatcorrespondwiththoseofA. geratoides U/μl) Taq DNA polymerase. The following temperature var.scaberulusandK. indica,respectively(Table2), and time profile was used in the amplification of the Poly- exhibitingacombinationoftheITSsequencesofthe meraseChainReaction(PCR):aninitialdenaturationstep twoputativeparentspecies.Theforwardandreverse of94ºCfor5min;36cyclesof94ºCfor1min,57ºCfor1 sequencesagreewitheachotherforcomplementary min, and 72ºC for 2 min, and a final extension of 10 min strands.The ITS sequences from the two hybrids at72ºC.TheamplifieddoublestrandedDNAfragments wereidentical. Therefore,theoverlappedbands,asa were purified and then directly sequenced on an ABI 377 polymorphism,canbeattributedtothefactthatthereare LI — Natural hybridization between A. ageratoides var. scaberulus and K. indica 193 Table 1.AmorphologicalcomparisonamongAster ageratoidesvar.scaberulus,Kalimeris indicaandtheirputativehybrid. Features Aster ageratoidesvar.scaberulus Theputativehybrid Kalimeris indica Branchesabove Noneorrarely1-3 Many(>5) Many(>5) Sizeofmiddleleaves(Length× 6-15×2-6 6-9×2-3.5 6-9.5×2-4 Width)(cm) Stomataontheuppersurfaceof None None Present,butrare middleleaves Sizeofleaveonbranches 3-8×1.4-3 2-4×0.5-1.5 1-2.5×0.5-1 (Length×Width)(cm) Lengthofpeduncles(cm) 0.3-2.1 0.3-9 1.2-10 No.oflayersofphyllaries 4-5 3-4 2-3 Shapeofinnerphyllaries Linearoblanceolate Linearoblanceolate Ovateintheupper2/3,and constrictedandlanceolatein thelower1/3 Glandsonmiddlephyllaries None None Present Widthofmiddlephyllaries 0.8-1 0.85-1 1.3-1.6 No. of florets per head 24-40 54-72 100-130 No. of ray florets
Load more

Recommended publications
  • Toronto Master Gardeners Ask Plant Id Questions
    TORONTO MASTER GARDENERS ASK PLANT ID QUESTIONS Image Question Answer Growing in ditches beside a gravel road It is challenging to identify a plant from a single leaf, and I consulted our team in Township of Perry 25 minutes north of Master Gardeners, several of whom feel that the plant is likely some sort of Huntsville. Cant find it in any of our of dock. Consider the following: reference books. Leaves are emerging from ground singly and veins are deep ñ Rumex sanguineus var.sanguineus (red-veined or bloody red. dock). See the Missouri Botanical Garden monograph ñ Rumex obtusifolius (broadleaved dock/ bitter dock). See Illinois Wildflowers – Bitter Dock ñ Rumex aquaticus (Scottish dock). See Nature Gate’s Scottish Dock Another suggestion was this might be pokeweed (Phytolacca Americana). See Ohio State University’s Ohio Perennial and Biennial Weed May 2019 Guide – Common PokeweedClick on the above links and you'll see photos that show that these plants have leaves that resemble those of your mystery plant, in many respects. However, with docks and the common pokeweed, leaves generally emerge from the same clump, not singly. As well, these plants have lance-shaped leaves, which seem to differ quite a bit from the oblong-shaped leaf of shown in the photo you submitted.Finally, it is possible that the plant is related to dock, but is a sorrel (Rumex acetosa) - some sorrels have leaves that are shaped more like the leaf in your photo. For example, see Nature Gate's Common sorrel My neighbour gave me this plant, that I Your neighbour gave you a Bergenia cordifolia, commonly called Bergenia or planted las year.
    [Show full text]
  • The Relation Between Road Crack Vegetation and Plant Biodiversity in Urban Landscape
    Int. J. of GEOMATE, June, 2014, Vol. 6, No. 2 (Sl. No. 12), pp. 885-891 Geotech., Const. Mat. & Env., ISSN:2186-2982(P), 2186-2990(O), Japan THE RELATION BETWEEN ROAD CRACK VEGETATION AND PLANT BIODIVERSITY IN URBAN LANDSCAPE Taizo Uchida1, JunHuan Xue1,2, Daisuke Hayasaka3, Teruo Arase4, William T. Haller5 and Lyn A. Gettys5 1Faculty of Engineering, Kyushu Sangyo University, Japan; 2Suzhou Polytechnic Institute of Agriculture, China; 3Faculty of Agriculture, Kinki University, Japan; 4Faculty of Agriculture, Shinshu University, Japan; 5Center for Aquatic and Invasive Plants, University of Florida, USA ABSTRACT: The objective of this study is to collect basic information on vegetation in road crack, especially in curbside crack of road, for evaluating plant biodiversity in urban landscape. A curbside crack in this study was defined as a linear space (under 20 mm in width) between the asphalt pavement and curbstone. The species composition of plants invading curbside cracks was surveyed in 38 plots along the serial National Route, over a total length of 36.5 km, in Fukuoka City in southern Japan. In total, 113 species including native plants (83 species, 73.5%), perennial herbs (57 species, 50.4%) and woody plants (13 species, 11.5%) were recorded in curbside cracks. Buried seeds were also obtained from soil in curbside cracks, which means the cracks would possess a potential as seed bank. Incidentally, no significant differences were found in the vegetation characteristics of curbside cracks among land-use types (Kolmogorov-Smirnov Test, P > 0.05). From these results, curbside cracks would be likely to play an important role in offering habitat for plants in urban area.
    [Show full text]
  • Patterns of Resource Allocation in Different Habitats of Kalimeris Intergrifolia in Northeast China Z
    Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA) Spanish Journal of Agricultural Research 2011 9(4), 1224-1232 Available online at www.inia.es/sjar ISSN: 1695-971-X doi: http://dx.doi.org/10.5424/sjar/20110904-162-11 eISSN: 2171-9292 Patterns of resource allocation in different habitats of Kalimeris intergrifolia in Northeast China Z. N. Yuan1,2, J. M. Lu1*, J. Y. Chen1 and S. Z. Jiang2 1College of Life Sciences, Northeast Normal University. Changchun 130024. P. R. China 2 Key Laboratory of Molecular Cytogenetics and Genetic Breeding of Heilongjiang Province; College of life Sciences and Technology, Harbin Normal University. Harbin 150025. P. R. China Abstract Understanding parameters that drive plant resource allocation for reproduction in potentially economically and environ- mentally important species, such as Kalimeris intergrifolia, is essential to maximize production rates. Hence, this study evaluates the characteristics in reproductive resource allocation of two K. intergrifolia communities at a saline-alkali open meadow and at a semi-enclosed secondary broad-leaved forest fringe, in the Songnen plains region of northeast China. Ramets from each habitat type were sampled at three intervals during the ripening stage (June-October). Relative resource distribution was quantified by measuring the dry weight of the above-ground ramet components, including the stem, leaf, corymb and seeds. The results indicated high variability in the distribution of resource allocation for both types, with larger phenotypic plasticity being recorded for the forest fringe than the open meadow. However, the allocation of re- sources into reproductive organs was higher in the open meadow than in the forest fringe, demonstrating that the open community was advantageous to the reproduction.
    [Show full text]
  • Sequencing and Analysis of Chrysanthemum Carinatum Schousb and Kalimeris Indica
    molecules Article Sequencing and Analysis of Chrysanthemum carinatum Schousb and Kalimeris indica. The Complete Chloroplast Genomes Reveal Two Inversions and rbcL as Barcoding of the Vegetable Xia Liu * ID , Boyang Zhou, Hongyuan Yang, Yuan Li, Qian Yang, Yuzhuo Lu and Yu Gao State Key Laboratory of Food Nutrition and Safety, Key Laboratory of Food Nutrition and Safety, Ministry of Education of China, College of Food Engineering and Biotechnology, Tianjin University of Science &Technology, Tianjin 300457, China; [email protected] (B.Z.); [email protected] (H.Y.); [email protected] (Y.L.); [email protected] (Q.Y.); [email protected] (Y.L.); [email protected] (Y.G.) * Correspondence: [email protected]; Tel.: +86-022-6091-2406 Received: 20 April 2018; Accepted: 31 May 2018; Published: 5 June 2018 Abstract: Chrysanthemum carinatum Schousb and Kalimeris indica are widely distributed edible vegetables and the sources of the Chinese medicine Asteraceae. The complete chloroplast (cp) genome of Asteraceae usually occurs in the inversions of two regions. Hence, the cp genome sequences and structures of Asteraceae species are crucial for the cp genome genetic diversity and evolutionary studies. Hence, in this paper, we have sequenced and analyzed for the first time the cp genome size of C. carinatum Schousb and K. indica, which are 149,752 bp and 152,885 bp, with a pair of inverted repeats (IRs) (24,523 bp and 25,003) separated by a large single copy (LSC) region (82,290 bp and 84,610) and a small single copy (SSC) region (18,416 bp and 18,269), respectively. In total, 79 protein-coding genes, 30 distinct transfer RNA (tRNA) genes, four distinct rRNA genes and two pseudogenes were found not only in C.
    [Show full text]
  • 2021 Online Plant Discovery Day Woody Plant List (Based on Availability, Subject to Change
    2021 Online Plant Discovery Day Woody Plant List (Based on availability, subject to change. Rev. 4/1/21) Botanical Name Common Name Acer circinatum Vine Maple Acer griseum Paperbark Maple Aesculus pavia Red Buckeye Amelanchier canadensis Serviceberry Aronia arbutifolia 'Brilliantissima' Red Chokeberry Buddlea x 'SMNBDW' Pugster White® Butterfly Bush Buddlea x 'SMNBDD' Lo & Behold Ruby Chip™ Butterfly Bush Callicarpa x 'NCCX2' PEARL GLAM® Beautyberry Calycanthus floridus Sweetshrub Calycanthus x 'Venus' Carolina Allspice Carex glauca Blue Sedge Carpinus caroliniana Wisconsin Red™ 'My Select Strain' Wisconsin Red™ Musclewood Carpinus cordata Bigleaf Hornbeam Carpinus japonica Japanese Hornbeam Caryopteris x clandonesis 'CT-9-12' Beyond Midnight® Bluebeard Cephalotaxus harringtonia 'Duke Gardens' Japanese Plum Yew Cercis canadensis 'Black Pearl'™ 'JN-16' Black Pearl Redbud Cercis canadensis var. texensis 'Oklahoma' Texas Redbud Cercis canadensis var. texensis 'Pink Pom Poms' Texas Redbud Cercis chinensis 'Don Egolf' Chinese Redbud Chamaecyparis lawsoniana 'SMNCLGTB' Pinpoint® Blue False Cypress Chamaecyparis pisifera 'Dow Whiting' Soft Serve® False Cypress Chionathus virginicus Fringetree Clematis heracleifolia Clematis Clethra alnifolia 'Hummingbird' Hummingbird Summersweet Comptonia peregrina Sweet Fern Cornus controversa 'Janine' Janine Giant Pagoda Dogwood Cornus kousa 'KN30-8' Rosy Teacups® Dogwood Cornus kousa 'Scarlet Fire' Scarlet Fire Dogwood Cornus kousa 'Summer Gold' Summer Gold Chinese Dogwood Cornus kousa var. chinensis Chinese Dogwood Cornus sericea 'Budd's Yellow' Yellowtwig Dogwood Cotinus coggygria 'MINCOJAU3' Winecraft Gold® Smokebush Cotinus coggygria 'NCC01' Winecraft Black® Smokebush Corylus avellana 'Burgundy Lace' Burgundy Lace Filbert Cryptomeria japonica 'Globosa Nana' Dwarf Japanese Cedar Cytisus scoparius 'SMNCSAB' SISTER REDHEAD® Scotch Broom Ficus carica 'Brown Turkey' Brown Turkey Fig Ficus carica 'Chicago Hardy' Chicago Hardy Fig Fothergilla 'Mt.
    [Show full text]
  • Deer Management in the Garden
    DEER MANAGEMENT IN THE GARDEN Deer can be a nuisance at times to gardeners in the Washington D.C. metropolitan area. As development alters habitats and eliminates predators, deer have adapted to suburban life and their population has grown, increasing the demand and competition for food. In some areas, landscape plants have become one of their food sources. When food is limited, deer may eat plants they normally don’t touch to satisfy their hunger. Although no plant is deer proof, you can make your garden less inviting to wildlife. Below are several strategies, including a list of plants that have been shown that deer dislike in order to discourage these uninvited guests. Deer will continue to adapt to their changing environment, and you’ll need to continue trying different control strategies. But with just a little planning, you can have a beautiful garden and co-exist with deer. METHODS OF DEER MANAGEMENT EXCLUSION: A physical barrier is the most effective method to keep deer from foraging. A 7’ tall fence is required to be effective. Deer fencing should be within easy view of the deer and should lean out towards the deer, away from your garden. A fine mesh is used for the black plastic fencing, which does not detract from the beauty of your landscape. If fencing is not practical, drape deer netting over vulnerable plants. Anchor or fasten deer netting to the ground to prevent the deer from pulling it off of the plants. REPELLENTS: Deer repellents work either through taste, scent, or a combination of both.
    [Show full text]
  • Ecological Ranges of Plant Species in the Monsoon Zone of the Russian Far East
    In: Horizons in Earth Science Research, Volume 3 ISBN: 978-1-61122-197-8 Editors: Benjamin Veress and Jozsi Szigethy © 2011 Nova Science Publishers, Inc. The exclusive license for this PDF is limited to personal website use only. No part of this digital document may be reproduced, stored in a retrieval system or transmitted commercially in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services. Chapter 2 ECOLOGICAL RANGES OF PLANT SPECIES IN THE MONSOON ZONE OF THE RUSSIAN FAR EAST Vitaly P. Seledets1* and Nina S. Probatova2 1Pacific Institute of Geography FEB RAS, 690041 Vladivostok, Russia 2Institute of Biology and Soil Science FEB RAS, 690022 Vladivostok, Russia ABSTRACT The monsoon zone covers a considerable part of the Russian Far East (RFE), which includes the Kamchatka Peninsula, Sakhalin, the Kurile Islands, the continental coasts and islands of the Bering Sea, the Sea of Okhotsk, the Sea of Japan, and the Amur River basin. The problem of biodiversity in the monsoon zone is connected to species adaptations, speciation and florogenesis, the formation of plant communities, vegetation dynamics, and population structure. Our concept of the ecological range (ecorange, ER) of plant species (Seledets & Probatova 2007b) is aimed at adaptive strategies in the RFE monsoon zone compared with Inner Asia.
    [Show full text]
  • Astereae, Asteraceae) Using Molecular Phylogeny of ITS
    Turkish Journal of Botany Turk J Bot (2015) 39: 808-824 http://journals.tubitak.gov.tr/botany/ © TÜBİTAK Research Article doi:10.3906/bot-1410-12 Relationships and generic delimitation of Eurasian genera of the subtribe Asterinae (Astereae, Asteraceae) using molecular phylogeny of ITS 1, 2,3 4 Elena KOROLYUK *, Alexey MAKUNIN , Tatiana MATVEEVA 1 Central Siberian Botanical Garden, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia 2 Institute of Molecular and Cell Biology, Siberian Branch of Russian Academy of Sciences, Novosibirsk, Russia 3 Theodosius Dobzhansky Center for Genome Bioinformatics, Saint Petersburg State University, Saint Petersburg, Russia 4 Department of Genetics & Biotechnology, Saint Petersburg State University, Saint Petersburg, Russia Received: 12.10.2014 Accepted/Published Online: 02.04.2015 Printed: 30.09.2015 Abstract: The subtribe Asterinae (Astereae, Asteraceae) includes highly variable, often polyploid species. Recent findings based on molecular methods led to revision of its volume. However, most of these studies lacked species from Eurasia, where a lot of previous taxonomic treatments of the subtribe exist. In this study we used molecular phylogenetics methods with internal transcribed spacer (ITS) as a marker to resolve evolutionary relations between representatives of the subtribe Asterinae from Siberia, Kazakhstan, and the European part of Russia. Our reconstruction revealed that a clade including all Asterinae species is paraphyletic. Inside this clade, there are species with unresolved basal positions, for example Erigeron flaccidus and its relatives. Moreover, several well-supported groups exist: group of the genera Galatella, Crinitaria, Linosyris, and Tripolium; group of species of North American origin; and three related groups of Eurasian species: typical Eurasian asters, Heteropappus group (genera Heteropappus, Kalimeris), and Asterothamnus group (genera Asterothamnus, Rhinactinidia).
    [Show full text]
  • Анатомия И Морфология Anatomy and Morphology
    86 Turczaninowia 2013, 16 (3) : 86–95 АНАТОМИЯ И МОРФОЛОГИЯ ANATOMY AND MORPHOLOGY УДК 582.998 (581.471) DOI: http:/dx.doi.org/10.14258/turczaninowia.16.3.15 Э.В. Бойко E.V. Boyko ПАПИЛЛЫ НА ПОВЕРХНОСТИ СЕМЯНОК ВИДОВ ASTERACEAE PAPILLAE ON THE SURFACE OF THE SEEDS OF SPECIES OF ASTERACEAE Аннотация. Методом сканирующей электронной микроскопии (СЭМ) исследована скульптура по- верхности семянок 371 вида из 168 родов, 21 трибы, пяти подсемейств семейства Asteraceae. У 75 видов из 45 родов, относящихся к 8 трибам, а также у Symphyllocarpus exilis (вида с неустановленным таксономическим положением в системе семейства) было выявлено наличие папилл. На поверхности семянок большинства видов трибы Cichorieae находятся папиллы разнообразного строения. Только у видов этой трибы папиллы об- разуют гребни (виды подтрибы Hypochaeridinae) и на поверхности экзокарпия многих видов находятся окру- глые гладкие гранулы эпикутикулярного воска, отсутствующие у видов других триб. На поверхности семянок видов триб Anthemideae, Astereae, Athroismeae, Calenduleae, Gnaphalieae, Heliantheae, Senecioneae папиллы имеются только у некоторых видов. У исследованных нами видов триб Barnadesieae, Mutisieae, Cynareae, Vernonieae, Arctotideae, Inuleae, Helenieae, Coreopsideae, Tageteae, Madieae, Millerieae, Eupatorieae папиллы не обнаружены. Длина, форма папилл, их расположение на поверхности семянки различны у разных видов и могут быть использованы как таксономический признак. Ключевые слова: Asteraceae, семянки, папиллы, морфология, сканирующая электронная микроскопия (СЭМ), систематика. Summary. The sculpture of the surface of cypselae (scanning electron microscopy) of 371 species of 168 gene­ ra, 21 tribes, five subfamilies of the family Asteraceae was investigated. 75 species of 45 genera belonging to 8 tribes and the species Symphyllocarpus exilis with uncertain taxonomic position, papillae were detected. Papillae of diverse structure have been revealed on the surface of the cypselae of the majority of Cichorieae species.
    [Show full text]
  • Index Seminum 2018-2019
    UNIVERSITÀ DEGLI STUDI DI NAPOLI FEDERICO II ORTO BOTANICO INDEX SEMINUM 2018-2019 In copertina / Cover “La Terrazza Carolina del Real Orto Botanico” Dedicata alla Regina Maria Carolina Bonaparte da Gioacchino Murat, Re di Napoli dal 1808 al 1815 (Photo S. Gaudino, 2018) 2 UNIVERSITÀ DEGLI STUDI DI NAPOLI FEDERICO II ORTO BOTANICO INDEX SEMINUM 2018 - 2019 SPORAE ET SEMINA QUAE HORTUS BOTANICUS NEAPOLITANUS PRO MUTUA COMMUTATIONE OFFERT 3 UNIVERSITÀ DEGLI STUDI DI NAPOLI FEDERICO II ORTO BOTANICO ebgconsortiumindexseminum2018-2019 IPEN member ➢ CarpoSpermaTeca / Index-Seminum E- mail: [email protected] - Tel. +39/81/2533922 Via Foria, 223 - 80139 NAPOLI - ITALY http://www.ortobotanico.unina.it/OBN4/6_index/index.htm 4 Sommario / Contents Prefazione / Foreword 7 Dati geografici e climatici / Geographical and climatic data 9 Note / Notices 11 Mappa dell’Orto Botanico di Napoli / Botanical Garden map 13 Legenda dei codici e delle abbreviazioni / Key to signs and abbreviations 14 Index Seminum / Seed list: Felci / Ferns 15 Gimnosperme / Gymnosperms 18 Angiosperme / Angiosperms 21 Desiderata e condizioni di spedizione / Agreement and desiderata 55 Bibliografia e Ringraziamenti / Bibliography and Acknowledgements 57 5 INDEX SEMINUM UNIVERSITÀ DEGLI STUDI DI NAPOLI FEDERICO II ORTO BOTANICO Prof. PAOLO CAPUTO Horti Praefectus Dr. MANUELA DE MATTEIS TORTORA Seminum curator STEFANO GAUDINO Seminum collector 6 Prefazione / Foreword L'ORTO BOTANICO dell'Università ha lo scopo di introdurre, curare e conservare specie vegetali da diffondere e proteggere,
    [Show full text]
  • Chloroplast Genome of the Conserved Aster Altaicus Var. Uchiyamae B2015-0044 As Genetic Barcode
    Journal154 of Species Research 10(2):154-158, 2021JOURNAL OF SPECIES RESEARCH Vol. 10, No. 2 Chloroplast genome of the conserved Aster altaicus var. uchiyamae B2015-0044 as genetic barcode Minjee Lee1, Jae-Sun Yi2, Jihye Park1 and Jungho Lee1,* 1Green Plant Institute, B­301, Heungdeok IT Valley, Yongin 16954, Republic of Korea 2Shingu Botanical Garden, Seongnam 13443, Republic of Korea *Correspondent: [email protected] An endemic endangered species, Aster altaicus var. uchiyamae (Danyang aster) B2015-0044, is cultivated at the Shingu Botanical Garden, which serves as the ex situ conservation institution for this species. In this work, we sequenced the chloroplast genome of A. altaicus var. uchiyamae B2015-0044. We found that the chloroplast (cp) genome of B2015-0044 was 152,457 base pairs (bps) in size: 84,247 bps of large single copy regions (LSC), 25,007 bps of inverted repeats (IRs), and 18,196 bps of small single copy regions. The B2015- 0044 cp genome contains 79 protein-coding genes (PCGs), 4 RNA genes, 29 tRNA genes, and 3 pseudo- genes. These results were identical to a previously reported cp genome (Park et al., 2017), except for two sites in introns and three in intergenic spacer (IGS) regions. For the intronic differences, we found that clpP.i1 had a 1-bp small simple repeat (SSR) (T) and petD.i had a 3-bp SSR (ATT). We found 1-bp SSRs in the IGSs of trnT_ggu~psbD and psbZ~trnG_gcc, C and A, respectively. The IGS of (ndhF)~rpl32 had a SNP. Based on our results, the cp genome of the A.
    [Show full text]
  • Э.В. Бойко EV Boyko ТРИХОМЫ СЕМЯНОК ВИДОВ ASTERACEAE
    Turczaninowia 2012, 15 (2) : 85–95 85 УДК 582.998 (581.471) Э.В. Бойко E.V. Boyko ТРИХОМЫ СЕМЯНОК ВИДОВ ASTERACEAE. II. ЖЕЛЕЗИСТЫЕ ВОЛОСКИ ACHENE TRICHOMES OF ASTERACEAE. II. GLANDULAR HAIRS Аннотация. Исследована скульптура поверхности семянок (сканирующая электронная микроскопия) 353 видов 114 родов из 18 триб, пяти подсемейств семейства Asteraceae. На поверхности семянок 42 видов выявлено наличие железистых трихом, которые отнесены к 4 типам. Виды с железистыми трихомами отно- сятся к трибам подсемейства Asteroideae: Astereae (15 видов из 9 родов), Anthemideae (11 видов из 7 родов), Inuleae (4 вида из 2 родов), Athroismeae, Coreopsideae, Helenieae, Madieae, Eupatorieae. На семянках видов триб Gnaphalieae, Heliantheae, Senecioneae (подсем. Asteroideae), Cichorieae (подсем. Cichorioideae) и Car­ dueae (подсем. Carduoideae) железистые трихомы нами не обнаружены. Ключевые слова: Asteraceae, семянки, железистые волоски, морфология, сканирующая электронная микроскопия (СЭМ), систематика. Summary. The sculptures of the surface of achenes of 353 species (114 genera, 18 tribes, five subfamilies) of the family Asteraceae are investigated with scanning electron microscopy (SEM). On the surface of achenes of 42 species, the presence of glandular trichomes is revealed, which are assigned to four types. All species with glandular trichomes belong to the tribes Astereae (15 species from 9 genera), Anthemideae (11 species from 7 genera), Inuleae (4 species from 2 genera), Athroismeae, Coreopsideae, Helenieae, Madieae, Eupatorieae of subfamily Asteroideae.
    [Show full text]