TGF-Β1 Suppression of Microrna-450B-5P Expression

Home , ENOX2, PAX9

ORIGINAL ARTICLE TGF-b1 suppression of microRNA-450b-5p expression: a novel mechanism for blocking myogenic differentiation of rhabdomyosarcoma

MM Sun1,5,JFLi2,5, LL Guo3, HT Xiao4, L Dong3, F Wang3, FB Huang3, D Cao3, T Qin1, XH Yin1,JMLi3 and SL Wang3

Transforming growth factor beta 1 (TGF-b1) is the most potent inhibitor of myogenic differentiation (MyoD) of rhabdomyosarcoma (RMS); however, the underlying mechanisms of this inhibition remain unclear. In this study, we identified novel TGF-b1-related microRNAs (miRNAs); among these, miR-450b-5p is significantly regulated by TGF-b1. We provide evidence that TGF-b1 exerts it function by suppressing miR-450b-5p. Both in cultured cells and tumor implants, miR-450b-5p significantly arrested the growth of RMS and promoted its MyoD. Utilizing a bioinformatics approach, we identified miR-450b-5p target mRNAs. Among these candidates, only the expression of ecto-NOX disulfide-thiol exchanger 2 (ENOX2) and paired box 9 (PAX9) was augmented by miR- 450b-5p knockdown examined by western blot; the engineered inhibition antagonized TGF-b1-mediated differentiation inhibition. Furthermore, we found that the Smad3 and Smad4 pathways, but not Smad2, are the principal mediator of TGF-b1 suppression of miR-450b-5p. Taken together, these results suggest that disrupting the TGF-b1 suppression of miR-450b-5p, or knockdown of ENOX2 and PAX9, are effective approaches in inducing RMS MyoD.

Oncogene (2014) 33, 2075–2086; doi:10.1038/onc.2013.165; published online 13 May 2013 Keywords: rhabdomyosarcoma; TGF-b1; miR-450b-5p; differentiation

INTRODUCTION Transforming growth factor beta 1 (TGF-b1) is known to be a 6,7 Rhabdomyosarcoma (RMS) is the most common soft tissue critical modulator of skeletal muscle differentiation. Our sarcoma in pediatric patients and young adults. The two major previous report revealed that inhibition of TGF-b1 signaling in 8–10 histological types of RMS tumors are alveolar RMS (ARMS) and human RMS cell line, RD, promotes tumor cell MyoD, but the embryonal RMS (ERMS). Although most RMS is characterized by underlying mechanism remains unclear. In recent years, several expression of myogenic-promoting transcription factors, such as reports have shown that TGF-b1 signaling promotes the myogenic differentiation (MyoD) and myogenin, there is failure of metastasis and invasive potential of cancer cells through the terminal muscle differentiation.1,2 Therefore, strategies aimed at modulation of biosynthesis of oncogenic miRNAs such as storing the myogenic program and reverse RMS cell-malignant miR-21,11 miR-15512 and miR-181b.13 Moreover, reports have behavior could potentially aid in therapeutic intervention. Recent demonstrated that TGF-b1 signaling also has an important role in evidence has demonstrated the role of microRNAs (miRNAs) in the skeletal muscle differentiation via regulation of miR-24;7 a recent development and progression of RMS. Several reports have shown report demonstrated that TGF-b regulates miR-206 and miR-29 to that the expression of miR-1 and miR-133a is markedly decreased control MyoD of the C2C12 cell line. These findings revealed a in RMS cell lines compared with differentiated myoblasts and newly discovered mechanism in the TGFb1 autocrine/paracrine skeletal muscle tissues. In particular, re-expression of miR-1 or miR- pathway concerning the development of malignancy; thus, there 206 restores the MyoD programs of RMS cells and blocks the is a need for further elucidation of TGF-b1-regulated miRNAs that tumorigenic phenotype in vivo, raising the possibility that miRNA have critical roles in the regulation of RMS. re-expression potentially represents an effective differentiation To investigate the role of TGF-b1-regulated miRNAs in the therapy for RMS.3 However, miRNA therapy presents several progression of RMS, we performed comprehensive miRNA challenges,4,5 such as delivery limitations, instability and side microarray analysis on RNA derived from typical RMS cell lines effects. In particular, miRNA re-expression influences the and TGF-b1 knockdown cell lines. We identified a novel set of TGF- expression of hundreds of genes involved in cellular pathways b1-related miRNAs that included miR-450b-5p, one of the most and exhibits potentially unpredictable side effects. Thus, a more significantly expressed miRNAs; we confirmed this finding in RMS detailed understanding of the molecular events governing tissues. As we were interested in determining whether these myogenesis is warranted to identify the myogenesis-related miRNAs could potentially contribute to TGF-b1-mediated differ- miRNA biogenesis, and modulation in which cellular pathways ential inhibition, we performed sequence complementary analysis participate. of these miRNAs against proliferation or myogenic regulators; our

1Department of Anatomy, Soochow University School of Medicine, Suzhou, China; 2Department of Pathology, the Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, China; 3Department of Pathology, Soochow University School of Medicine, Suzhou, China and 4Department of Burn and Plastic Surgery, West China Hospital, Sichuan University, Chengdu, China. Correspondence: Professor SL Wang or Professor JM Li, Department of Pathology, Soochow University School of Medicine, Suzhou 215123, China. E-mail: [email protected] or [email protected] 5These authors contributed equally to this work. Received 4 October 2012; revised 11 March 2013; accepted 25 March 2013; published online 13 May 2013 TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2076 findings revealed that only induction of miR-450b-5p conferred isolated from TGF-b1 knockdown RMS cell lines (ERMS: RD, RH36 MyoD in RMS cells. In this study, we provide evidence that ecto- and SMS-CTR; ARMS: RH30, RH28 and RH3) and control cells. Of NOX disulfide-thiol exchanger 2 (ENOX2) and paired box 9 (PAX9) interest, nearly all the TGF-b1 knockdown RMS cell lines over- are targets of miR-450b-5p, and we show that ENOX2 and PAX9 expressed miR-450b-5p (4/6) (Figure 1b). Among other identified mRNAs and miR-450b-5p are inversely expressed in human RMS miRNAs by microarray analyses, miR-411-5p, miR-411-3p and miR- tissues. Moreover, our findings indicate that miR-450b-5p is 493-5p were significantly upregulated (Po0.05) in RNA derived negatively regulated by Smad4 and Smad3 in addition to from TGF-b1 knockdown RMS cell lines (see Supplementary TGF-b1, and that restoration of miR-450b-5p occurs via RNA Information, Supplementary Figure S1). interference of these genes.

TGF-b1 and miR-450b-5p exhibited a correlation in human RMS RESULTS tissues TGF-b1 regulates miRNA in human RMS cell lines The above work demonstrated that differential expression of To identify TGF-b1-related miRNAs, we conducted comprehensive miRNAs in TGF-b1-knocked down RMS cell lines versus controls, locked nucleic acid microarray analyses to obtain miRNA thus, we hypothesized that the augmented miRNAs identified in expression profiles independently in TGF-b1 knockdown cell lines TGF-b1 knocked down RMS cells would also be overexpressed in (RD, SMS-CTR and RH28) and control cell lines. Figure 1a displays TGF-b1-low-expression RMS tissues compared with TGF-b1-high- statistically significant expression changes of the miRNAs in these expression RMS tissues. To explore this possibility, we examined representative RMS cells (fold change X1.5, Pp0.05). The five these miRNAs by real-time RT–PCR using total RNA isolated from miRNAs with overexpression levels in TGF-b1 knockdown RMS cell paired human RMS tissues that exhibited low–high expression of lines were: miR-4275, miR-411, miR-493* and miR-450b-5p. Only TGF-b1. Based on the 68 cases of RMS that we previously miR-2113 expression was significantly downregulated in TGF-b1 described9 and 12 cases collected recently, the immuno- knockdown RMS cell lines versus controls. Raw microarray data are histochemical-staining findings for TGF-b1 revealed that 54 of accessible through Gene Expression Omnibus Series accession the 80 cases of RMS tissues exhibited TGF-b1-high expression (see number GSE40843. Supplementary Information, Supplementary Table S1). Among To validate the expression profiles of these miRNAs indepen- these miRNAs, miR-450b-5p exhibited the most significant dently, we conducted real-time RT–PCR assays using total RNA increase in expression (3.2-fold) in TGF-b1-low-expression RMS tissues (Figure 2a), and these findings were confirmed by northern blot and RT–PCR analysis independently (Figure 2b). In addition, Control TGF-β1 knock down we explored another six paired human RMS tissues having low– RD SMS-CTR RH28SMS-CTR RD RH28 high expression of TGF-b1, with RT–PCR and our findings revealing -6.0 -3.0 -1.0 that the majority (4/6) of TGF-b1 low-RMS tissues exhibited higher 123546456 123 miR-450b-5p expression compared with TGF-b1 high-RMS tissues 3.0240307 (Figure 2c). In contrast, the other miRNAs that were identified as

1.5120153 differentially overexpressed in TGF-b1-knocked down RMS cells

4.933448 2.466724 0.0 (shown in Figure 1) were identiﬁed as being overexpressed in only 0.0 a minority of TGF-b1-low RMS tissues (data not shown). Of these miR-450b-5p miR-4298 TGF-b1-deregulated miRNAs, our ﬁndings suggested that miR- miR-411 450b-5p acted as an important regulator, and thus was selected miR-4275 miR-493* for further study. miR-2113

TGF-β1 knock down Control 3 MiR-450b-5p arrests proliferation of RMS by inducing apoptosis 2.5 *** In order to investigate whether TGF-b1-related miRNAs were ** * 2 * responsible for RMS proliferation, we transiently transfected 1.5 mimics and inhibitors of these miRNAs into RD (ERMS) and 1 RH28 (ARMS) cells in vitro (Figure 3). Over 90% of cells from each

change/GAPDH) cell line were transfected (data not shown), and expression of miR-450b-5p(fold 0.5 transfected miRNAs was confirmed by real-time RT–PCR analysis 0 3 RD RH36 SMS-CTR RH30 RH28 RH3 (Figure 3A). Our findings revealed that [ H] thymidine incorporation of RMS cells transfected with miR-450b-5p mimic was Figure 1. Differentially expressed miRNAs in TGF-b1-knocked down reduced (Figure 3B). Similar results were found in optical density, RMS cell lines versus controls. (a) Locked nucleic acid microarray as demonstrated by a time-dependent decrease in [3H] thymidine analyses to obtain miRNA expression profiles independently in TGF- incorporation. Significant differences in proliferation were b1-knocked down RD, SMS-CTR and RH28, and control cell lines. The heat map diagram shows the results of the two-way hierarchical observed after 4 (Po0.05) and 6 (Po0.01) days. No significant clustering of miRNAs and samples. Each row represents a miRNA differences in proliferation were found for other miRNAs, such as and each column represents a sample. The miRNA-clustering tree is miR-4275, miR-493-5p and miR-493-3p, or control transfectants shown on the left, and the sample-clustering tree appears at the top. (data not shown). Next, to determine whether growth arrest was a As shown, expression of miR-450b-5p, miR-4298, miR-411, miR-4275 consequence of RMS cell apoptosis, we utilized caspase-3 and and miR-493* were each significantly upregulated, and miR-2113 TUNEL (terminal deoxynucleotidyl transferase dUTP nick end was significantly downregulated in TGF-b1-knocked down RMS cell labeling). As expected, the number of caspase-3- and TUNEL- lines (lines 4, 5, 6) versus controls (lines 1, 2, 3). (b) Further positive cells increased significantly after 4 days of miR-450b-5p confirmation of miR-450b-5p with other TGF-b1-knocked down RMS mimic transfection. Notably, the apoptosis induced with miR- cell lines such as RH36, RH30 and RH3, besides above RD, SMS-CTR and RH28. RT–PCR analysis using RNA isolated from TGF-b1-knocked 450b-5p mimic was enhanced by TGF-b1 small interfering RNA (siRNA) treatment (Figure 3C). Apoptosis is closely related to tumor down RMS cell lines and control cell lines. Each assay was conducted 14 for at least three independent times. Error bars indicate SD. *Po0.05; cell differentiation and progression; thus, this suggests that miR- **Po0.01; ***Po0.005. 450b-5p is an anti-oncogene miRNA.

Oncogene (2014) 2075 – 2086 & 2014 Macmillan Publishers Limited TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2077

miRNA TGF-β1 low (n=4) TGF-β1 high (n=4) Fold change P value miRNA-450b-5p 1.90±0.12 0.60±0.12 3.2 0.000 miRNA-411-3p 1.48±0.29 0.60±0.14 2.5 0.004 miRNA-411-5p 1.77±0.20 0.80±0.24 2.2 0.002 miRNA-4275 1.80±0.57 1.00±0.14 1.8 0.055 miRNA-493-5p 1.50±0.35 1.00±0.14 1.5 0.063 miRNA-493-3p 1.33±0.43 0.93±0.16 1.4 0.185 miRNA-4298 1.40±0.46 1.08±0.26 1.3 0.330 miRNA-2113 0.83±0.25 1.28±0.29 -1.6 0.086

207 11051 7910 14736 1.4 1.2 ** TGF-β1 ** Westem blot 2.1 2.8 1.9 0.4 1 β-actin * 0.8 0.6 miR-450b-5p Northem blot 1.1 0.8 2.1 3.8 0.4 change/GAPDH) U6 miR-450b-5p(fold 0.2 0 miR-450b-5p ERMS ARMS ERMS ARMS RT-PCR 0.5 0.2 0.8 1.2 TGF-β1 low (IRS 0-4) TGF-β1 high (IRS 6-9) GAPDH Figure 2. TGF-b1 and miR-450b-5p correlated in human RMS tissue. (a) MiR-4275, miR-411-5p, miR-411-3p, miR-493-5p, miR-493-3p, miR-450b- 5p, miR-4298 and miR-2113 expression correlated with TGF-b1expression, respectively, in two cases of ARMS and two cases of ERMS by real-time RT–PCR analysis using RNA isolated from RMA tissues. Bars indicate RNA level normalized to GAPDH±s.d. SPSS analysis, comparison of miRNA folds change between low–high TGF-b1 expression in RMS tissues using Student’s t-test. (b) Representative validation of miR-450b- 5p expression correlated with TGF-b1 by western blot analysis TGF-b1, northern blot and RT–PCR analyses of miR-450b-5p. Protein and RNA isolated from RMS tissues with high and low TGF-b1 expression. The upper Arabic numerals are numbers of RMS tissues. (c) Real-time RT–PCR assays for miR-450b-5p were performed on RNA isolated from RMS tissues with high and low TGF-b1 expression. For the immunoreactive score (IRS) of TGF-b1, see the Supplementary Information (Supplementary Table S1). Bars indicate RNA level normalized to GAPDH±s.d. MiR-450b-5p level in RMS with low versus high TGF-b1 expression. Each assay was conducted for at least three independent times. *Po0.05; **Po0.01.

MiR-450b-5p represses tumorigenicity in vivo by promoting MyoD increase in organelles, degeneration of nucleus and cytoplasm, and To further examine whether the observed growth arrest of RMS increased myofilament. The tumor cell control group typically in vitro was associated with repression in vivo, we quantified contained a single nucleolus and few organelles, with no obvious tumorigenicity using an in vivo nude mouse animal model. Two evidence of MyoD (data not shown). Moreover, miR-450b-5p mimic weeks after tumor cell inoculation, all nude mice developed induced an increase in staining for myogenin (Po0.01) and myosin detectable tumors that reached B0.5 cm3. Next, tumors were (Po0.05) (Figures 4B and C); this was further confirmed by real-time injected with mimic, inhibitors of miR-450b-5p and negative RT–PCR analysis. As shown in Figure 4D, there was a significant control oligonucleotides in transfection solution (see Materials and difference in the ratio of myogenin mRNA/GAPDH (Po0.005) and methods) once weekly for 4 weeks. There was a significant myosin mRNA/GAPDH (Po0.005) between the miR-450b-5p mimic- difference between the mimic-treated group and control group treated group and control groups. In a parallel experiment, we after 3 weeks (Po0.01), and after 4 weeks the significant investigated antagonistic effect of TGF-b1 on miR-450b-5p mimic- difference was even greater (Po0.005) (Figure 4A). This finding induced RMS cell MyoD. As anticipated, TGF-b1 counteracted the suggests that miR-450b-5p mimic inhibits the tumorigenicity of expression of myogenin and myosin, and the differentiation- RD cells; this was further confirmed by Ki67 expression (Figure 4B, inducing effect of miR-450b-5p mimic on RMS tissues. Po0.05). It is well understood that the biological behavior of a tumor is related to the degree of differentiation of its cells, and a lower ENOX2 and PAX9 are direct targets of miR-450b-5p degree of differentiation generally correlates with greater tumor Six of the predicted miR-450b-5p targets overlapped between the growth. As miR-450b-5p arrests in vitro growth and in vivo three bioinformatic algorithms, including calcium/calmodulin- tumorigenicity of RMS, we examined the role of miR-450b-5p in dependent protein kinase II inhibitor 1, microtubule-associated differentiation of RD cells. As shown in Supplementary Information, protein 2, ankyrin 3, ENOX2, PAX9 and ATPase, class VI, type 11C. (Supplementary Figure S2), after tumors were treated with Among these candidates, only ENOX2 and PAX9 were repressed miR-450b-5p mimic once weekly for 2 weeks, tumor cells exhibited by induced miR-450b-5p overexpression and augmented by its typical ultrastructural features of MyoD: convoluted nucleus and an engineered knockdown in RMS cells, as examined by RT–PCR

& 2014 Macmillan Publishers Limited Oncogene (2014) 2075 – 2086 TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2078 MNC M INC I 4 3 * 2 * (fold 1 *

miR-450b-5p *

change/GAPDH) 0 RD RH28

RD MNC M INC I RH28 MNC M INC I 6000 7000 ** 6000 *** 5000 * * 5000 4000 4000 3000 3000 2000 2000 1000 1000 [3H]incorporation(c.p.m.) 0 [3H]incorporation(c.p.m.) 0 1 24 6 days 12 4 6 days

RD MNC M INC I RH28 MNC M INC I 0.35 0.35 * ** 0.3 0.3 0.25 *** 0.25 * 0.2 0.2 ** 0.15 0.15 OD values

OD values 0.1 0.1 0.05 0.05 0 0 1 24 6 days 12 4 6 days

M+ MNC M TGF-β1siRNA MNC M M+ TGF-β1 siRNA 40

30 * * Caspase3 * * 20

10 Positive cell content(%)

TUNEL 0 Caspase3 TUNEL

Figure 3. MiR-450b-5p arrests proliferation of RMS cells by inducing apoptosis. (A) Expression of miR-450b-5p in embryonal (RD) and aveolar (RH28) RMS cell lines, transfected with mimic or inhibitor of miRNA-450b-5p (M or I), and negative control of mimic or inhibitor (MNC or INC) (see Materials and methods) was conﬁrmed by real-time RT–PCR analysis on 4 days of treatment. Bars indicate RNA levels normalized to GAPDH±s.d. (B) Proliferation of RD and RH28 cells, treated with oligonucleotides (as above) for a period of 6 days, was evaluated by [3H] thymidine incorporation assay and MTT (see Materials and methods). The amount of [3H] thymidine incorporated was measured with a liquid scintillation counter. The optical density (OD) at 557 nm was determined using a microplate reader. The mean values from triplicate wells for each treatment were determined. (C) Apoptosis was measured by the number of caspase-3-positive cells and TUNEL-positive cells. RD cells were treated with oligonucleotides (as above) for a period of 6 days, followed by immunoﬂuorescence staining with anti-caspase-3 and TUNEL cell apoptosis detection (FITC end-labeling of the fragmented DNA of the apoptotic RD cells). Representative images of transfected MNC or M of miR-450b-5p to RD or TGF-b1-knocked down RD cells ( Â 200). Each assay (A–C) was conducted for at least three independent times. Error bars indicate s.d. *Po0.05; **Po0.01; ***Po0.005.

(Figure 5a). All six cell lines (ERMS: RD, RH36 and SMS-CTR; TGF-b1 knockdown, we investigated the mRNA levels of miR- ARMS: RH30, RH28 and RH3) were independently examined 450b-5p, ENOX2 and PAX9 in RD cells treated with 5 or 10 ng/ml in these analyses, and yielded concordant results. Next, TGF-b1, compared with TGF-b1-knocked down RD cells. As shown we confirmed the effects of miR-450b-5p-mimic/inhibitor in Figure 5c, miR-450b-5p was increased in TGF-b1-knocked down on the protein levels of ENOX2/PAX9 in RD cells. As shown in RD cells, but decreased in TGF-b1-treated RD cells, particularly in Figure 5b, downregulated protein levels of ENOX2 and PAX9 the 10-ng/ml TGF-b1 treatment group. Both ENOX2 and PAX9 were determined in RD cells 24 h following miR-450b-5p-mimic expression in TGF-b1-knocked down RD cells was decreased. treatment. However, higher protein levels of ENOX2 and PAX9 However, TGF-b1 treatment led to a slight increase of ENOX2 in RD were found in RD cells treated with miR-450b-5p-inhibitor; in cells and a marked increase of PAX9. addition, there was a more significant increase in PAX9 (Po0.05). Next, we explored whether the 30-untranslated repeat (UTR) of To confirm the effects of TGF-b1 treatment on the expression ENOX2 and PAX9 are functional targets of miR-450b-5p. As shown of miR-450b-5p, ENOX2 and PAX9 in the RD cell line relative to in Figure 5d, the reporter activities for wild-type 30-UTR sequences

Oncogene (2014) 2075 – 2086 & 2014 Macmillan Publishers Limited TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2079

MNC M INC I 4000 ** * miR-450b-5p 3000 inhibitors

* 2000

1000 miR-450b-5p

Tumor volume (mm3) mimics 0 Treatment time 1234weeks

Ki67 Myogenin Myosin Desmin MNC treated M treated

Myogenin Myosin 123123 MNC M 8 ** GAPDH 6 * * 1.5 4 1 *** *** IHC score 2 0.5 maker Ratio of 0 0 differentiation Ki67 Myogenin Myosin Desmin mRAN/GAPDH 123123 1, MNC; 2.M+TGF-β1; 3, M Figure 4. MiR-450b-5p inhibits tumorigenicity of RMS by promoting myogenic differentiation. (A) Tumor volume of RD xenografts was examined. All mice were injected subcutaneously in the right flank with 100 ml RD cell suspension (1 Â 107). Once tumors reached B0.5 cm3, intratumoral injection was performed with mimic or inhibitor of miRNA-450b-5p (M or I) and negative control of mimic or inhibitor (MNC or INC) (see Materials and methods), once weekly for 4 weeks. Tumor volume (V,mm3) was calculated as (L Â W2)/2, where L is length (mm) and W is width (mm). The picture shows a representative tumor sphere. (B, C) Immunohistochemical staining and quantification of sections of RMS xenografts based on RD cells injected intratumorally with miR-450b-5p mimic or negative control oligonucleotides for 4 weeks. Ki67-specific antibody was used as the marker for cell proliferation; Myogenin, Myosin and Desmin were used as makers for myogenic differentiated cells. Original magnification, Â 400. (D) Representative quantitative RT–PCR analysis of Myogenin and Myosin in RMS xenografts tumors from miR- 450b-5p mimic or negative control oligonucleotide-treated RD cells, and with TGF-b1 antagonist or not for 2 weeks. All means values (±s.d.) are from three independent experiments (A, C and D). *Po0.05; **Po0.01; ***Po0.005. of both ENOX2 and PAX9 were decreased by co-transfection with paired TGF-b1-low-expression (immunoreactive score 0–4) RMS miR-450b-5p mimic in RD cells and increased by co-transfection tissue with TGF-b1-high-expression (immunoreactive score 6–9) with miR-450b-5p inhibitors. However, the activity of report RMS tissue. As shown in Figure 5e, high ENOX2 and PAX9 construct mutated at the specific miR-450b-5p target site was expression levels were associated with low miR-450b-5p expres- unaffected by simultaneous transfection. sion and high TGF-b1 expression. The statistical analysis demon- To comprehensively explore the clinical association between strated that miR-450b-5p was significantly expressed in the TGF-b1, miR-450b-5p, and targets ENOX2 and PAX9, we examined majority of paired tissues (4/6), ENOX2 was significantly expressed mRNA isolated from human RMS tissues with low–high expression in half of the paired tissues (3/6) and ENOX2 was significantly of TGF-b1. According to our previously optimized scoring system expressed in more than half of the paired tissues (4/6). These of TGF-b1 expression in paraffin-embedded tissues of RMS,9 we results are in concordance with findings obtained in RMS cell lines.

& 2014 Macmillan Publishers Limited Oncogene (2014) 2075 – 2086 TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2080 MiR-450b-5p downregulates ENOX2 and PAX9 proteins, and whether the effects of miR-450b-5p would be enhanced. As promotes MyoD of RMS shown in Figure 6A, ENOX2-targeting siRNAs and PAX9-targeting We examined the mRNA levels of ENOX2 and PAX9 in siRNA- siRNAs each repressed the respective mRNAs to 0.17- and mediated ENOX2 or PAX9-knocked down RD cells, respectively, 0.33-fold change/GAPDH, compared with 1.93- and 1.83-fold 48 h after initial miR-450b-5p-mimic transfection to determine change/GAPDH in the control. As anticipated, miR-450b-5p mimic

ENOX2 MNC M INC I PAX9 MNC M INC I 300 250 * * ** * *** * 200 *** * 200 150 * * * * * * 100 100 50 mRNA (% control) mRNA (% control) 0 0 RD RD RH3 RH3 SMS- CTR SMS- CTR RH36 RH30 RH28 RH36 RH30 RH28

miR-450b-5p-M miR-450b-5p-I Control Ctrl 24h 48h Ctrl 24h 48h TGF-β1 knock down ENOX2 TGF-β1 treatment (5ng/ml) β PAX9 TGF- 1 treatment (10ng/ml) 250 β-actin * * 200 ENOX2 PAX9

- 3

β 150 * 2 100 * * 1 * *

actin (%) 50

* mRNA (%control) and PAX9/

Ratio of ENOX2 0 Ctrl 12h 24h Ctrl 12h 24h 0 miR-450-5P ENOX2 PAX9 miR-450b-5p-M miR-450b-5p-I

ENOX2 PAX9 300 300 ** 200 * 200

100 * 100 ** (%control) (%control) Relative signal 0 Relative signal 0 Wt. UTR + + - + + - Wt. UTR + + - + + - Mut.UTR - - + - - + Mut.UTR - - + - - + miR-Ctrl + - - + - - miR-Ctrl + - - + - - miR-M +++- - - miR-M +++- - - miR-I - - - +++ miR-I - - - +++

miR-450b-5p ENOX2 PAX9 1.6 1.4 1.2 * * ** 1 * 0.8 * * 0.6 * * *

mRNAs level ** 0.4 *

(fold change/GAPDH) 0.2 0 235 458 1123 2879 5627 9876 154 2354 63222 7789 14567 11526 ERMS ARMS ERMS ARMS TGF-β1 low (IRS 0-4) TGF-β1 high (IRS 6-9)

Oncogene (2014) 2075 – 2086 & 2014 Macmillan Publishers Limited TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2081 intensified the effects of ENOX2 siRNA and PAX9 siRNA knock- revealed that Smad3, not Smad2, has an important role in control down on mRNA levels of ENOX2 and PAX9. Next, to study whether processing of miR-450b-5p expression, as well as the common ENOX2 and PAX9 were involved in miR-450b-5p deregulation and Smad and Smad4. This observation provides additional evidence mediated the block of RMS MyoD, we individually knocked down that TGF-b1 inhibits muscle differentiation through Smad3.15 these target genes using siRNAs in RD cells, and the number of caspase-3 and myosin heavy chain (MHC)-positive cells was analyzed using rabbit anti-caspase-3 and MHC. As shown in Figure 6B, siRNA-mediated knockdown of either ENOX2 or PAX9 DISCUSSION induced apoptosis and MyoD, as well as miR-450b-5p mimic. The TGF-b1 signaling pathway has a vital role in the development Furthermore, we observed that siRNA-mediated knockdown of and homeostasis of normal tissues, and abnormal function of this either ENOX2 or PAX9 promoted apoptosis and MyoD caused by pathway contributes to the initiation and progression of diverse engineered miR-450b-5p derepression (Figure 6C). Similar assays cancer types, including RMS.9,16,17 Our results demonstrated that were conducted with RH28 cells and similar results were miR-450b-5p acts as a tumor suppressor, has a key role in MyoD of independently obtained (see Supplementary Information, RMS by targeting of ENOX2 and PAX9, and is negatively regulated Supplementary Figure S3). by the TGF-b1/Smad pathway. Previous studies have shown that TGF-b1 regulates the expression of several miRNAs. These studies suggest that these TGF-b1 signal pathway regulates miR-450b-5p TGF-b1-upregulated miRNAs function as oncogenes; miR-21 To investigate whether the downstream proteins of the TGF-b1 targets programmed cell death 4,11 miR-155 contributes to signal pathway have a key role in the regulation of miR-450b-5p epithelial cell plasticity by targeting RhoA,12 and miR-181b and ENOX2/PAX9, we examined the expression levels of miR- targets the tissue inhibitor of metalloprotease 3.13 In this study, 450b-5p and ENOX2/PAX9 in TGF-b1-, Smad4-, Smad2- and we performed a genome-wide analysis of differentially expressed Smad3-knocked down RMS cell lines. To determine whether these miRNAs in TGF-b1-knocked down or not RMS cell lines, and signal proteins exhibited complete knockdown, we examined identified TGF-b1-related miRNAs in RMS for the first time. We Smad7, a TGF-b1-inducible antagonist of TGF-b1 signaling in TGF- demonstrated that a set of miRNAs was prominently upregulated b1 signal-gene-knocked down RD and RH28 cells treated with in TGF-b1-knocked down RMS cells. TGF-b1 5 ng/ml. As shown in the Supplementary Information, In recent years, miRNAs have emerged as prominent factors in Supplementary Figure S4, Smad7 expression increased signifi- cancer. With respect to cancer, miRNAs are often located in cantly in the TGF-b-treated TGF-b1-knocked down group, and not unstable genomic regions, and therefore are typically down- in Smad4-, Smad2- and Smad3-knocked down RMS cell lines. regulated in tumors;18 moreover, inhibition of miRNA biogenesis We observed greater expression of pre-miR-450b-5p and tends to enchance tumorigenesis.19 Several studies have mature-miR-450b-5p in TGF-b1 siRNA-treated RD cells and RH28 demonstrated that miRNA maturation pathways crosstalk with cells compared with controls (Figure 7a). Moreover, the signal of intracellular signaling molecules, Smad proteins,11 estrogen ENOX2 and PAX9 was decreased in TGF-b1-, Smad4- and Smad3- receptor20 and p53.21,22 To determine whether TGF-b1 knocked down RD cells, but not in Smad2-knocked down RD cells downregulates miR-450b-5p as a tumor suppressor or not, we examined with ENOX2- and PAX9-30-UTR-containing reporter engineered re-expression of miR-450b-5p-repressed proliferation (Figure 7b); a similar finding was observed in RH28 cells of both ERMAS cell line RD and ARMS cell line RH28; however, (Supplementary Information, Supplementary Figure S5). These modest or no significant growth inhibition was observed in results suggest that a key role is played by Smad4/3 on miR-450b- miR-450b-5p inhibitor-treated RMS cell lines (Figure 3). Engineered 5p/ENOX2/PAX9 regulation. re-expression of miR-450b-5p also reduced in vivo tumorigenicity. As miR-450b-5p is in a miRNA cluster with miR-450a/b-3p/b-5p, Notably, this repression of in vivo tumorigenicity depended on and TGF-b1 regulates miR-450b-5p, it may also regulate other time-dependent treatment of miR-450b-5p mimic (Figure 4). miRNA clusters. To test this hypothesis, we examined miR-450a, As miR-450b-5p arrests the growth of RMS, we examined the miR-450b-5p and miR-450b-3p in TGF-b1 signal-protein gene- role of miR-450b-5p in the differentiation of RD cells. We silenced RD cells individually. As shown in Figure 7c, miR-450a, investigated apoptosis (caspase-3 and TUNEL), MyoD regulator miR-450b-5p and miR-450b-3p expression was more or less (myogenin), makers of MyoD (myosin and desmin) and morphol- induced in TGF-b1 signal-protein gene-silenced RD cells. Interest- ogy changes in RD cells treated with miR-450b-5p mimic in vitro ingly, exogenous TGF-b1 antagonized miR-450b-5p and miR-450b- and in vivo. These findings revealed that miR-450b-5p promotes 3p levels in TGF-b1- and Smad2-knocked down RD cells, but not in MyoD of RMS cells by inducing apoptosis, which suggests that Smad4- and Smad3-knocked down RD cells. These findings miR-450b-5p is a tumor suppressor.

Figure 5. ENOX2 and PAX9 are targets for miR-450b-5p. (a) ENOX2 and PAX9 expression levels were each downregulated by miR-450b-5p- mimic (M), but upregulated by miR-450b-5p-inhibitor (I) transfection independently, compared with negative control of mimic or inhibitor (MNC or INC) treatments (see Materials and methods), performed in human embryonal (RD, RH36 and SMS-CTR) and alveolar (RH30, RH28 and RH3) histotype RMS cell lines. (b) Western blot confirmed the effects of miR-450b-5p mimic/inhibitor on the protein levels of ENOX2/PAX9 in RD cells. Downregulated protein levels of ENOX2 and PAX9 were explored in RD cells 24 h after being treated with miR-450b-5p mimic. However, the higher protein levels of ENOX2 and PAX9 were explored in RD cells 24 h after being treated with miR-450b-5p inhibitor, and PAX9 increased more significantly (Po0.05). (c) RT–PCR confirmed the effects of TGF-b1 treatment on the expression of miR-450b-5p, ENOX2 and PAX9 in RD cell line, relative to TGF-b1 knockdown. MiR-450b-5p increased in TGF-b1-knocked down RD cells, but decreased in TGF-b1- treated RD, especially more significantly in 10 ng/ml TGF-b1 treatment. Both ENOX2 and PAX9 in TGF-b1-knocked down RD cells decreased. The TGF-b1 treatment leads to a slight increase of ENOX2, but a marked increase of PAX9. (d) Diagram of ENOX2- and PAX9-30-UTR-containing reporter constructs RD with transfection of Wt- or mut-report and miR-450b-5p mimic or inhibitor (miR-M or miR-I). The luciferase assays confirmed that miR-450b-5p binds to the wild-type 30-UTR sequences of ENOX2 and PAX9 in RD cells. Co-transfection of miR-450b-5p mimic significantly reduced the luciferase levels, and co-transfection of miR-450b-5p inhibitor increased luciferase levels. Mut: contains seven-base mutation at the miR-450b-5p target region. (e) Clinical association between TGF-b1, miR-450b-5p, and targets ENOX2 and PAX9 were examined by real-time PCR. 235, 458, 1123, 2879, 5627, 9876 versus 154, 2354, 63222, 7789, 14567, 11526, respectively (the Arabic numerals are numbers of RMA tissues). Each assay (a–c) was conducted at least three independent times. Error bars indicate s.d. *Po0.05; **Po0.01; ***Po0.005.

& 2014 Macmillan Publishers Limited Oncogene (2014) 2075 – 2086 TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2082 3 ENOX2 PAX9 2.5 2 1.5 * 1 * * * ** ** mRNA level *** 0.5 *** *** ***

(fold change / GAPDH) 0 MNC+siRNACtrl + ----- + ----- M - + - - ++ - + - - ++ ENOX2 siRNA - - + - + - - - + - + - PAX 9 siRNA --- + - + --- + - +

MNC M M+ENOX2siRNA M+PAX9siRNA TUNEL MHC

40 TUNNEL MHC ** 30 *** *** * *** ** *** 20 ****

Positive cell content(%) 0 MNC+ siRNACtrl + --- - - + ----- M - + - - ++ - + - - + + ENOX2 siRNA - - + - + - - - + - + - PAX 9 siRNA --- + - + --- + - + Figure 6. MiR-450-5b-5p promotes differentiation of RMS by targeting ENOX2 and PAX9. (A) The mRNA levels of ENOX2 and PAX9 are presented for the indicated transfected of RD cells with miR-450-5b-5p mimic (M), negative control of mimic (MNC), ENOX2 siRNA, PAX9 siRNA and control siNRA (siRNACtrl). Bars indicate RNA levels normalized to GAPDH±s.d. (B) Representative images of TNNEL- and MHC-positive RD cells upon miR-450-5b-5p mimic, ENOX2 siRNA and PAX9 siRNA induction. RD cells treated with oligonucleotides (as above) for a period of 6 days, immunoﬂuorescence staining with TUNEL cell apoptosis detection kit and anti-MHC. (C) Quantity of TUNEL and MHC expression in miR- 450-5b-5p mimic-treated RD cells, promoted by siRNA-mediated knockdown of either ENOX2 or PAX9 performed 48 h after miR-450-5b-5p mimic transfection. Each assay was conducted for at least three independent times. Error bars indicate s.d. *Po0.05; **Po0.01; ***Po0.005.

We identified six miR-450b-5p targets, including ENOX2 and and TGF-b1 expression in RMS tissues. Taken together, these PAX9 by bioinformatic analyses, and functional as well as binding findings are in concordance with previous reports that TGF-b1 assays. It is known that each miRNA can affect multiple targets via signal pathways contribute to the inhibition of differentiation in distinct mechanisms.23 Thus, we focused on identification of RMS9 by revealing specific miRNAs that are underexpressed in candidate miR-450b-5p targets that could exert a miR-450b-5p RMS. We propose that miR-450b-5p acts as an antioncomir in this growth inhibition- or differentiation-inducing effect. The mRNAs context by negatively regulating specific oncogenes. This view is of ENOX2 and PAX9 were downregulated in RMS cell lines supported by miR-450b-5p re-expression or knockdown treated with miR-450b-5p-mimic, and induced differentiation with experiments, in which its targets ENOX2 and PAX9 exhibited increased numbers of TUNEL-positive cells and myogenic marker derepression or repression, respectively. Thus, the TGF-b1/miR- MHC-positive cells, reinforced by siRNA-mediated knockdown 450b-5p/ENOX2/PAX9 pathway constitutes a previously of either ENOX2 or PAX9 (Figure 6). Our investigation of unrecognized differentiation regulator of RMS. It is unclear how clinical associations demonstrated that there is an inverse ENOX2 and PAX9 are involved in the MyoD of RMS. Based on relationship between miR-450b-5p and targets, ENOX2 and our finding that miR-450b-5p mimic induces apoptosis and PAX9, and a similar inverse relationship between miR-450b-5p differentiation, which is reinforced by knockdown of either

Oncogene (2014) 2075 – 2086 & 2014 Macmillan Publishers Limited TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2083 Ctrl pre-miR mature-miR RD ENOX2 PAX9 Smad2 2.5 siRNA Smad3 RD RH28 120 Smad4 TGF-β1 siRNA *** siRNA 2 ** 100 siRNA * * * * * 1.5 80 * 60 * 1 ** 40 0.5

miR-450b-5p level 20 Relative signal (%Ctrl) (fold change/GAPDH) 0 0 siRNA Ctrl + - - + - - ENOX2-Wt.UTR + - + - + - + - TGF-β1siRNA - ++- ++ PAX9-Wt.UTR - + - + - + - +

miR-450a miR-450b-5p miR-450b-3p 2.5

1.5

* 1 * ****

miR-450a/b-5p/b-3p 0.5 (fold changes/Control)

0 TGF-β1 TGF-β1 Smad4 Smad4 Smad2 Smad2 Smad3 Smad3 siRNA siRNA siRNA siRNA siRNA siRNA siRNA siRNA +TGF-β1 +TGF-β1 +TGF-β1 +TGF-β1

Figure 7. Smads-mediated TGF-b1 signal pathway regulates miR-450b-5p. (a) Real-time RT–PCR analysis on the effect of TGF-b1 siRNA on miR- 450b-5p processing in RMS cell lines. The level of pre-miR-450b-5p and mature miR-450-5p increased in RD and RH28 cells treated with TGF-b1 siRNA for a period of 6 days; moreover, mature miR-450-5p exhibited a more marked increase compared with pre-miR-450b-5p. Ctrl means the control for mature miR-450-5p in RD and RH28 cells treated with TGF-b1 siRNA for a period of 24 h. (b) The luciferase assay analysis of miR- 450b-5p targets ENOX2 and PAX9. The luciferase reporter conﬁrmed that miR-450b-5p binds to the wild-type 30-UTR sequences of ENOX2 and PAX9 in RD cells (Figure 5). Signals of ENOX2 and PAX9 in TGF-b1-, Smad4-, Smad2- and Smad3-knocked down RD were examined after 48 h in differentiation medium. Each assay was conducted at least three independent times. (c) Real-time RT–PCR analysis on expression of miR-450a, miR-450b-5p and miR-450b-3p in TGF-b1-, Smad4- and Smad3-knocked down RD cells treated with exogenous TGF-b1 5 ng/ml. Methods for TGF-b1-, Smad4-, Samd2- and Smad3-knocked down RD construction see Materials and methods, and Supplementary Information, Supplementary Figure S4. Error bars indicate s.d. *Po0.05; **Po0.01; ***Po0.005. (d) Schematic illustration of miR-450b-5p processing via TGF-b1 signal pathway, block of RMS differentiation, miR-450b-5p targets ENOX2 and PAX9, and their possible relationship.

ENOX2 or PAX9 (Figure 6), and previous reports demonstrating understanding. Therefore, exploration of differentially expressed that ENOX2 enhances cell proliferation and PAX9 modulates tissue miRNAs between RMS and muscle tissue is warranted. We differentiation,24–26 we hypothesized that these interactions determined the differentially expressed miRNAs in a number of caused RD cells to drop out of cell cycle and block MyoD in representative TGF-b1-knocked down ERMS and ARMS cell lines, RMS cells; further studies are warranted to investigate this based on the common biological behavior, the excretive TGF-b1, hypothesis. differentiation block and coloration, previously demonstrated by Recently, several studies have demonstrated that the expression our reports and other reports. Whether or not there are of specific miRNAs that regulate skeletal muscle development differentiated miRNAs between ERMS and ARMS, and have been shown to be downregulated in RMS, raising the associations between ERMS/ARMS and TGF-b1/miR-450b/ENOX2/ possibility that miRNA re-expression could potentially serve as an PAX9 axis, requires further study. effective differentiation therapy for RMS. RMS most commonly Several TGF-b1-regulated miRNAs have been shown to mediate originates from skeletal muscle; however, a recent finding TGF-b1 signaling to control the aggressiveness of cancer cells indicates that RMS also originates from adipocyte lineage,27 associated with metastasis and invasiveness.11–13 In this study, of indicating that the complex origination is far beyond our present the six significantly differentially expressed miRNAs, none of the

& 2014 Macmillan Publishers Limited Oncogene (2014) 2075 – 2086 TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2084 miRNAs exhibited a change consistent with these results. This RNA isolation and miRNA arrays discrepancy may be due to the use of different cell types and Total RNA was isolated from TGF-b1-knocked down RD, SMS-CTR and interference means to TGF-b1 signal for the miRNA array analysis. RH28, respectively, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). However, an important inconsistency between TGF-b1-mediated After having passed RNA quantity measurement using the NanoDrop 1000, upregulation of these miRNAs, such as miR-21,11 miR-18113 and the samples were labeled using the miRCURY Hy3/Hy5 Power labeling kit miR-155 expression,12 and TGF-b1-mediated downregulation of and hybridized on the miRCURY LNA Array (v.16.0) (Exiqon, Vedbaek, miR-450b-5p is the requirement of the common Smad, Smad4 Denmark). Following the washing steps, the slides were scanned using the Axon GenePix 4000B microarray scanner. Scanned images were then (Figure 7). Moreover, we demonstrated that Smad3 has an imported into GenePix Pro 6.0 software (Axon Instruments, Foster City, CA, important role in control processing of miR-450b-5p expression, USA) for grid alignment and data extraction. Expressed data were as well as Smad4. Consistent with this finding, a previous normalized using the Median normalization. Finally, hierarchical clustering study reported that TGF-b1 inhibited muscle differentiation was performed to determine distinguishable miRNA expression profiles through the Smad3-mediated repression of myogenic trans- among the samples. cription factors.15,28,29 Further investigation is required to determine the mechanism underlying the TGF-b1/Smad Real-time RT–PCR quantification of precursor and mature miRNAs pathway downregulation of miR-450b-5p, although it is likely Total RNA was harvested from RMS cell lines and frozen tissues according that the regulation occurs post transcriptionally (Figure 7d). to the manufacturer’s recommendations. Pre-miRNA sequences were This study revealed a novel mechanism for blocking MyoD obtained from miBase (http://www.mirbase.org/index.shtml). The primers of RMS, that is, TGF-b1 suppression of miRNA-450b-5p expression. for pre-miRNA were designed with the following criteria: (a) both forward Engineered re-expression of miR-450b-5p arrested growth of and reverse primers were designed to be located within the hairpin RMS and promoted MyoD of RMS in vitro and in vivo. Notably, sequence of the miRNA precursors, (b) a maximal extension of four ENOX2 and PAX9 were targeted by miR-450b-5p, providing a nucleotides in the 50 direction was allowed for each primer over the likely mechanism responsible for the blocking of TGF-b1-mediated presumed termini of the pre-miRNA, and (c) primers were designed with a 1 RMS differentiation through previously unrecognized regulation of maximal Tm difference between both primers of p2 C and a primer tumor-promoting pathways. It is intriguing to speculate that use of length between 18 and 24 nucleotides. The sequences of the miRNA-450b- 5p precursor was as follows: 50-GCAGAAUUAU(UUUUGCAAUAUGUUCCUG miR-450b-5p as a differentiation therapy for RMS could potentially AAUA)UGUAAUAUAAGUGUA(UUGGGAUCAUUUUGCAUCCAUA)GUUUUGU provide even prognostic information. Indeed, evidence indicates AU-30. The underlined sequences are forward and reverse PCR primers for that clinical associations exist between miR-450b-5p and the miRNA-450b-5p precursors. As the hairpin is contained within both the pri- histological grade of RMS differentiation (data not shown), and miRNA and the pre-miRNA, primers amplify both RNAs. Mature miRNA miR-450b-5p mimic promotes RMS differentiation in vitro and analysis was performed using the TaqMan miRNA assays, including RT and in vivo. Taken together, these findings indicate that miR-450b-5p real-time PCR. The RT reactions were performed using a single miRNA- 33,34 acts as an anti-oncogenic miRNA in RMS by conferring repression specific stem-loop RT primer, as described by Chen (for primers, see of specific oncogenes. Conceivably, targeting of miR-450b-5p by Supplementary Information, Supplementary Table S2). anti-miR oligonucleotides would constitute a novel approach to arrest RMS development. Northern blot analysis For quantitative northern blot analysis of miRNAs, 5 mg of total RNA were electrophoresed in a 15% polyacrylamide-urea gel and transferred by electroblotting onto Hybond-N þ membrane (Amersham Biosciences, MATERIALS AND METHODS Piscataway, NJ, USA). Hybridization was performed with 32P-labeled DNA Cell culture and RMS tissue sampling oligos (see Supplementary Information, Supplementary Table S3). Anti-U6, The human ERMS (RD, RH36 and SMS-CTR) and ARMS (RH30, RH28 and 50-TGTGCTGCCGAAGCGAGCAC-30. RH3) cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and were maintained in Dulbecco’s Transient transfection modified Eagle’s medium. The differentiation medium comprised serum-free Dulbecco’s modified Eagle’s medium with 10 mg/ml insulin The sequences of mimics and inhibitors of miRNAs used in our studies are and transferrin.30,31 All samples were obtained following informed consent listed in Supplementary Information, Supplementary Table S4. All of the nucleotides contain 20-OMe modifications at every base and a 30- C3- and with obscured identity corroding to the recommendations of the 35 Institutional Review Board. The histological material consisted of initial containing amino linker. To transfect, 100-pmol mimics or inhibitors of biopsy or resection specimens and of post-chemotherapy biopsy miRNA (miR-M or miR-I) and negative control of mimics or inhibitors (MNC specimens from residual, recurrent or metastatic tumor sites. or INC) in 200 ml of serum-free medium were mixed with 5 mlof Lipofectamine 2000 transfection reagent (Invitrogen), dissolved in 200 ml of the same medium. The resulting transfection solutions were then added to each well containing 1.6 ml of the medium. Eight hours later, the Construction of TGF-b1 signal-protein-knocked down cell lines cultures were replaced with differentiation medium. The specific siRNAs of and western blot ENOX2 and PAX9 were designed with BLOCK-iT RNAi Designer (Invitrogen) The procedure for TGF-b1, Smad4, Smad2 and Smad3 gene silencing was (ENOX2 siRNA: 50-GGAATTGCCGGACAACCAA-30; PAX9 siRNA: 50-GCGTGTGC 8,9,32 described previously. These human TGF-b1 signal protein-specific GACAAGTACAA-30) (synthesized by Shanghai GeneCore Biotechnologies oligonucleotide sequences were synthesized (Sangon Inc, Shanghai, China) Co, Ltd, Shanghai, China). The siRNA transfection was conducted following and ligated into the mammalian expression vector, pSUPER gfp-neo identical procedures as for miR at a final concentration of 30 nM. (Catalog: VEC-PBS (phosphate-buffered solution)-0006, OligoEngine, Seattle, WA, USA) at the BglII and HindIII cloning sites. A neomycin resistance cassette was cloned into the pSUPER vector and transfected into Immunohistochemistry RMS cell lines using Effectent Transfection Reagent (Qiagen, Hilden, Paraffin-embedded tissue sections (3–5 mm thick) were immunostained. Germany). To test the efficiency of the gene silencing, western blot analysis After boiling in 10 mM citrate buffer for 10 min in a microwave oven, the was utilized to explore the above signal proteins and conventional TGF-b1 tissue sections were incubated with 10% normal rabbit serum in buffer to target Smad7. Membranes were incubated with specific antibodies against block nonspecific binding sites, and incubated with antibodies at 4 1C TGF-b1, Smad4, Smad2, Smad3 and Smad7 (Santa Cruz Biotechnology, overnight. The slides were incubated with peroxidase-conjugated IgG Santa Cruz, CA, USA) diluted at 1:1000. ENOX2 rabbit polyclonal antibody (Genomics, Shanghai, China) and stained with diaminobenzidine– was purchased from Abcam, Inc (Cambridge, MA, USA), and PAX9 chromogen substrate mixture (DAKO, Carpinteria, CA, USA), and then mouse polyclonal antibody was obtained from Abnova Inc (Taipei, counterstained with hematoxylin. The expression of proteins were Taiwan). Proteins were visualized with peroxidase-conjugated secondary classified according to the following grading system: staining extensity antibodies at 1:2000, using an enhanced chemiluminescence detection was categorized as 0 (no positive cells), 1 (p25% positive cells), 2 (425% system (Santa Cruz). and p50% positive cells ) or 3 (450% positive cells), and staining intensity

Oncogene (2014) 2075 – 2086 & 2014 Macmillan Publishers Limited TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2085 was categorized as 0 (negative), 1 (weak), 2 (moderate) or 3 (strong). The Construction of 30-UTR luciferase plasmid and reporter assays total immunoreactive score was a summation of the individual categories. To create ENOX2- and PAX9-30-UTR luciferase reporter constructs, the full- length 30-UTR of ENOX2 (1746 nucleotides) and PAX9(1026 nucleotides) was amplified using complementary DNA from RD (primers of ENOX2: Cell growth assays forward -50-TGTGTGAGAGTCCAGCCTTG-30, reverse -50-AAGTAAGTTCCGGG 0 0 The embryonal (RD) and alveolar (RH28) RMS cell lines were plated at GTACATG-3 ; primers of PAX9: forward -5 -GGTGCTCTCGCAAGGAGAAA 0 0 0 5 Â 104 cells per well in 96-well plates, with transfection solutions GG-3 , reverse -5 -GCGCTTATGAGTTAAACTGTGTC-3 ). The primers were containing miR-450b-5p-M, miR-450b-5p-I or NC for 8 h. Then, the culture digested and cloned into the Xba1-site of pGL3 (Promega, Madison, WI, medium was replaced with differentiation medium. The [3H] thymidine USA), checked for orientation, sequenced and named Wt. The miR-450b- incorporation with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium 5p-binding sites for ENOX2 and PAX9 are indicated in Figure 5. The bromide (MTT) was explored after each treatment for 1, 2, 4 and 6 days. mutagenesis within selected seeding sequence regions was conducted During the last 4 h of each treatment, cells were pulsed with 3.7 Â 104 [3H] according to the following rules: A was changed to T and vice versa. For thymidine (1 mCi) per well or with MTT (Sigma, St Louis, MO, USA) 10 ml per reporter assays, RD and RH28 were transiently transfected with Wt or well. After cells were pulsed with [3H] thymidine, the cells were rinsed with mutant reporter plasmid and miR-450b-5p mimic and inhibitor using PBS, and DNA was precipitated with 10% (wt/vol) trichloroacetic acid for Lipofectamine 2000 (Invitrogen). Reporter assays were performed 24 h post 30 min at 4 1C. The amount of [3H] thymidine incorporated was measured transfection using the Dual-luciferase assay-system (Promega), and with a liquid scintillation counter. For the MTT assay, after the cells were normalized for transfection efficiency by co-transfected Renilla luciferase. incubated at 37 1C for 4 h to allow MTT formazan formation, the medium The luciferase signal was read using a TD-20/20 Luminometer (Turner and MTT were replaced by 100 ml DMSO to dissolve the formazan crystals. Biosystems, Sunnyvale, CA, USA). Then, the optical density at 557 nm was determined using a microplate reader (Model 550; Bio-Rad, Hercules, CA, USA). The mean value from Statistical analysis triplicate wells for each treatment was determined. All data were presented as mean and s.d. Analysis was conducted using SPSS 10.0 (Chicago, IL, USA). Student’s unpaired t-test was used to compare values of test and control samples. A value of Po0.05 was Apoptosis assay and immunofluorescence staining considered to indicate a statistically significant result. After cultivating on coverslips for 24 h in Dulbecco’s modified Eagle’s medium that contained 10% fetal calf serum, the coverslips were placed at the bottom of each well. The 400 ml of the above resulting transfection CONFLICT OF INTEREST solutions were then added to each well containing 1.6 ml of medium. Eight hours later, the culture medium was replaced with differentiation medium. The authors declare no conflict of interest. After 6 days, coverslips were then washed with iced PBS and fixed with 4% paraformaldehyde for 15 min at 4 1C. Briefly, the treated cells were permeabilized with 0.1% Triton X-100 for fluorescein isothiocyanate (FITC) ACKNOWLEDGEMENTS end-labeling of the fragmented DNA of the apoptotic RD cells, using a We would like to thank the West China Hospital of Sichuan University for providing us TUNEL cell apoptosis detection kit (Beyotime, Shanghai, China). Expression with the tumor specimens. This work was supported partially by the Chinese Nature of caspase-3 and MHC was analyzed using rabbit anti-caspase-3 and MHC Science Foundation (81072186, 81272738), Jiangsu Provincial Nature Science (Boster, Wuhan, China). At least 200 cells per slide in random fields were Foundation (SBK20110743), Jiangsu Provincial Higher Institution Nature Science counted under a fluorescence microscope (BX2-FLB3-000; Olympus, Tokyo, Foundation (10KJB320018), Suzhou Applied Basic Research Programs (SYS201207), Japan) to determine the percentage of FITC-positive cells. and Sponsorship of Jiangsu Overseas Research and Training Program for University Prominent Young and Middle-aged Teachers and Presidents.

Electron microscopy After RD cells were plated at 5 Â 104 cells per well in six-well plates with REFERENCES transfection solution containing miR-450b-5p-M for 6 days, the cells were 1 Sebire NJ, Malone M. Myogenin and MyoD1 expression in paediatric rhabdo- harvested, fixed with 3% glutaraldehyde and osmium tetroxide, dehy- myosarcomas. J Clin Pathol 2003; 56: 412–416. drated and embedded in Epon812. Thin sections were cut at a thickness of 2 Tapscott SJ, Thayer MJ, Weintraub H. Deficiency in rhabdomyosarcomas of a 50 nm, stained with uranyl acetate and lead citrate, and examined under factor required for MyoD activity and myogenesis. Science 1993; 259: 1450–1453. an H-600IV electron microscope (Hitachi Inc, Tokyo, Japan). 3 Mishra PJ, Merlino G. MicroRNA reexpression as differentiation therapy in cancer. J Clin Invest 2009; 119: 2119–2123. 4 Wurdinger T, Costa FF. Molecular therapy in the microRNA era. Pharmacogenomics In vivo tumorigenicity J 2007; 7: 297–304. 5 Wang V, Wu W. MicroRNA-based therapeutics for cancer. BioDrugs 2009; 23: All animal procedures were approved by the Ethics Review Committee for 15–23. Animal Experimentation of Soochow University. A total of 100 male BALB/c 6 Li Y, Foster W, Deasy BM, Chan Y, Prisk V, Tang Y et al. Transforming growth nude mice (5–6 weeks old and 18 g in weight) were purchased form SLAC factor-beta1 induces the differentiation of myogenic cells into fibrotic cells in Laboratory Animal Co Ltd (Shanghai, China). The mice were divided into six injured skeletal muscle: a key event in muscle fibrogenesis. Am J Pathol 2004; 164: groups of 20 mice each. All mice were injected subcutaneously in the right 1007–1019. flank with 100-ml RD cell suspension (1 Â 107). For intratumoral transfec- 7 Sun Q, Zhang Y, Yang G, Chen X, Cao G, Wang J et al. Transforming growth factor- tion, 100 pmol mimics or inhibitors of miRNA and negative control beta-regulated miR-24 promotes skeletal muscle differentiation. Nucleic Acids Res oligonucleotides in 100 ml of PBS were mixed with 5 ml of Lipofectamine 2008; 36: 2690–2699. 2000 transfection reagent (Invitrogen) dissolved in 100 ml of the same PBS. 8 Wang SL, Yao HH, Guo LL, Dong L, Li SG, Gu YP et al. Selection of optimal sites for Once tumors reached B0.5 cm3, the 200 ml of the above resulting TGFB1 gene silencing by chitosan-TPP nanoparticle-mediated delivery of shRNA. transfection solutions were injected into the tumor once weekly for 4 Cancer Genet Cytogenet 2009; 190: 8–14. weeks. Tumor size was measured in a blinded manner weekly with calipers, 9 Wang S, Guo L, Dong L, Li S, Zhang J, Sun M. TGF-beta1 signal pathway may and tumor volume was calculated. Histological differentiation was contribute to rhabdomyosarcoma development by inhibiting differentiation. evaluated by observing changes in morphology and expression of MyoD Cancer Sci 2010; 101: 1108–1116. markers. 10 Ye L, Zhang HY, Wang H, Yang GH, Bu H, Zhang L et al. Effects of transforming growth factor beta 1 on the growth of rhabdomyosarcoma cell line RD. Chin Med J (Engl) 2005; 118: 678–686. Bioinformatic prediction of miRNA targets 11 Davis BN, Hilyard AC, Lagna G, Hata A. SMAD proteins control DROSHA-mediated The following bioinformatic algorithms were utilized to predict microRNA maturation. Nature 2008; 454:56–61. miRNA target sites: target ccan 6.1 (http://targetscan.org), Diana microT 12 Kong W, Yang H, He L, Zhao JJ, Coppola D, Dalton WS et al. MicroRNA-155 is 4.0 (http://diana.cslab.ece.ntua.gr/DianaTools/index.php?r=microtv4/index) regulated by the transforming growth factor beta/Smad pathway and contributes and MICRORNA.ORG (http://www.microrna.org/microrna/home.do). to epithelial cell plasticity by targeting RhoA. Mol Cell Biol 2008; 28: 6773–6784.

& 2014 Macmillan Publishers Limited Oncogene (2014) 2075 – 2086 TGF-b1 suppression of miRNA-450b-5p expression MM Sun et al 2086 13 Wang B, Hsu SH, Majumder S, Kutay H, Huang W, Jacob ST et al. TGFbeta- 25 Rodrigo I, Hill RE, Balling R, Munsterberg A, Imai K. Pax1 and Pax9 activate Bapx1 mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by to induce chondrogenic differentiation in the sclerotome. Development 2003; 130: targeting TIMP3. Oncogene 2010; 29: 1787–1797. 473–482. 14 Shoji Y, Saegusa M, Takano Y, Ohbu M, Okayasu I. Correlation of apoptosis 26 Zeng ZM, Chuang SM, Chang TC, Hong CW, Chou JC, Yang JJ et al. Phosphor- with tumour cell differentiation, progression, and HPV infection in cervical car- ylation of serine-504 of tNOX (ENOX2) modulates cell proliferation and migration cinoma. J Clin Pathol 1996; 49: 134–138. in cancer cells. Exp Cell Res 2012; 318: 1759–1766. 15 Liu D, Black BL, Derynck R. TGF-beta inhibits muscle differentiation through 27 Hatley ME, Tang W, Garcia MR, Finkelstein D, Millay DP, Liu N et al. A mouse model functional repression of myogenic transcription factors by Smad3. Genes Dev of rhabdomyosarcoma originating from the adipocyte lineage. Cancer Cell 2012; 2001; 15: 2950–2966. 22: 536–546. 16 Massague J. TGFbeta in cancer. Cell 2008; 134: 215–230. 28 Liu D, Kang JS, Derynck R. TGF-beta-activated Smad3 represses MEF2-dependent 17 Bouche M, Canipari R, Melchionna R, Willems D, Senni MI, Molinaro M. TGF-beta transcription in myogenic differentiation. EMBO J 2004; 23: 1557–1566. autocrine loop regulates cell growth and myogenic differentiation in human 29 Ge X, McFarlane C, Vajjala A, Lokireddy S, Ng ZH, Tan CK et al. Smad3 signaling is rhabdomyosarcoma cells. FASEB J 2000; 14: 1147–1158. required for satellite cell function and myogenic differentiation of myoblasts. Cell 18 Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer 2006; Res 2011; 21: 1591–1604. 6: 857–866. 30 Segev H, Fishman B, Ziskind A, Shulman M, Itskovitz-Eldor J. Differentiation of 19 Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. Impaired microRNA processing human embryonic stem cells into insulin-producing clusters. Stem Cells 2004; 22: enhances cellular transformation and tumorigenesis. Nat Genet 2007; 39: 265–274. 673–677. 31 Yang Z, MacQuarrie KL, Analau E, Tyler AE, Dilworth FJ, Cao Y et al. MyoD and 20 Yamagata K, Fujiyama S, Ito S, Ueda T, Murata T, Naitou M et al. Maturation E-protein heterodimers switch rhabdomyosarcoma cells from an arrested myo- of microRNA is hormonally regulated by a nuclear receptor. Mol Cell 2009; 36: blast phase to a differentiated state. Genes Dev 2009; 23: 694–707. 340–347. 32 Guo H, Zhang HY, Wang SL, Ye L, Yang GH, Bu H. Smad4 and ERK2 stimulated by 21 Suzuki HI, Yamagata K, Sugimoto K, Iwamoto T, Kato S, Miyazono K. Modulation of transforming growth factor beta1 in rhabdomyosarcoma. Chin Med J (Engl) 2007; microRNA processing by p53. Nature 2009; 460: 529–533. 120: 515–521. 22 Suzuki HI, Miyazono K. Emerging complexity of microRNA generation cascades. 33 Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT et al. Real-time J Biochem 2011; 149: 15–25. quantiﬁcation of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 2005; 33: e179. 23 Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: 34 Schmittgen TD, Lee EJ, Jiang J, Sarkar A, Yang L, Elton TS et al. Real-time PCR 215–233. quantiﬁcation of precursor and mature microRNA. Methods 2008; 44: 31–38. 24 Liu NC, Hsieh PF, Hsieh MK, Zeng ZM, Cheng HL, Liao JW et al. Capsaicin-mediated 35 Cheng AM, Byrom MW, Shelton J, Ford LP. Antisense inhibition of human miRNAs tNOX (ENOX2) up-regulation enhances cell proliferation and migration in vitro and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic and in vivo. J Agric Food Chem 2012; 60: 2758–2765. Acids Res 2005; 33: 1290–1297.

Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc)

Oncogene (2014) 2075 – 2086 & 2014 Macmillan Publishers Limited