DOCSLIB.ORG

An OTX2-PAX3 Signaling Axis Regulates Group 3 Medulloblastoma Cell Fate

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An OTX2-PAX3 Signaling Axis Regulates Group 3 Medulloblastoma Cell Fate ARTICLE https://doi.org/10.1038/s41467-020-17357-4 OPEN An OTX2-PAX3 signaling axis regulates Group 3 medulloblastoma cell fate Jamie Zagozewski1, Ghazaleh M. Shahriary 1, Ludivine Coudière Morrison1, Olivier Saulnier 2,3, Margaret Stromecki1, Agnes Fresnoza4, Gareth Palidwor5, Christopher J. Porter 5, Antoine Forget6,7, Olivier Ayrault 6,7, Cynthia Hawkins2,8,9, Jennifer A. Chan10, Maria C. Vladoiu2,3,9, Lakshmikirupa Sundaresan2,3, Janilyn Arsenio11,12, Michael D. Taylor 2,3,9,13, Vijay Ramaswamy 2,3,14,15 & ✉ Tamra E. Werbowetski-Ogilvie 1 1234567890():,; OTX2 is a potent oncogene that promotes tumor growth in Group 3 medulloblastoma. However, the mechanisms by which OTX2 represses neural differentiation are not well characterized. Here, we perform extensive multiomic analyses to identify an OTX2 regulatory network that controls Group 3 medulloblastoma cell fate. OTX2 silencing modulates the repressive chromatin landscape, decreases levels of PRC2 complex genes and increases the expression of neurodevelopmental transcription factors including PAX3 and PAX6. Expression of PAX3 and PAX6 is significantly lower in Group 3 medulloblastoma patients and is cor- related with reduced survival, yet only PAX3 inhibits self-renewal in vitro and increases survival in vivo. Single cell RNA sequencing of Group 3 medulloblastoma tumorspheres demonstrates expression of an undifferentiated progenitor program observed in primary tumors and characterized by translation/elongation factor genes. Identification of mTORC1 signaling as a downstream effector of OTX2-PAX3 reveals roles for protein synthesis pathways in regulating Group 3 medulloblastoma pathogenesis. 1 Regenerative Medicine Program, Department of Biochemistry and Medical Genetics, University of Manitoba, Winnipeg, MB, Canada. 2 The Arthur and Sonia Labatt Brain Tumour Research Center, The Hospital for Sick Children, Toronto, ON, Canada. 3 Developmental & Stem Cell Biology Program, The Hospital for Sick Children, Toronto, ON, Canada. 4 Central Animal Care Services, University of Manitoba, Winnipeg, MB, Canada. 5 Ottawa Bioinformatics Core Facility, Ottawa Hospital Research Institute, Ottawa, ON, Canada. 6 Institut Curie, PSL Research University, CNRS UMR, INSERM, Orsay, France. 7 Université Paris Sud, Orsay France, Université Paris-Saclay, CNRS UMR 3347, INSERM, U1021, Orsay, France. 8 Program in Cell Biology, The Hospital for Sick Children, Toronto, ON, Canada. 9 Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada. 10 Department of Pathology & Laboratory Medicine, University of Calgary, Calgary, AB, Canada. 11 Departments of Internal Medicine and Immunology, Max Rady College of Medicine, Rady Faculty of Health Sciences, University of Manitoba, Winnipeg, MB, Canada. 12 Manitoba Centre for Proteomics and Systems Biology, Winnipeg, MB, Canada. 13 Division of Neurosurgery, The Hospital for Sick Children, Toronto, ON, Canada. 14 Division of Haematology/Oncology, University of Toronto and The ✉ Hospital for Sick Children, Toronto, ON, Canada. 15 Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada. email: Tamra. [email protected] NATURE COMMUNICATIONS | (2020) 11:3627 | https://doi.org/10.1038/s41467-020-17357-4 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-17357-4 rain tumors are the most deadly form of childhood cancer never been explored. PAX3 and PAX6 are epigenetically silenced with medulloblastoma (MB) being the most common in Group 3 MB patient samples and are direct targets of OTX2. B 1 malignant primary pediatric brain tumor . Despite Both PAX3 and PAX6 gain of function (GOF) results in numerous efforts to improve therapy, approximately one-third of decreased tumorsphere formation and SOX2 levels, as well as MB patients die while survivors are left with lifelong neurocog- modulation of Group 3 MB gene signatures in vitro. However, nitive sequelae, unable to live independent lives as a result of the only PAX3 overexpression reduces mTORC1 signaling and also toxicities associated with chemotherapy and radiation1,2. increases survival in vivo. Finally, we define an OTX2-PAX3 gene While historically considered a single disease, integrative regulatory network (GRN) that controls cell fate through genomic studies over the past decade have categorized MB into mTORC1 signaling in highly aggressive Group 3 MB tumors. four highly distinct molecular subgroups: WNT, Sonic Hedgehog 1,3,4 fi (SHH), Group 3, and Group 4 , with further subclassi cation Results into multiple subtypes exhibiting distinct clinical outcomes5–7. OTX2 regulates TF silencing in Group 3 MB. To further Group 3 MB tumors represent a quarter of MB cases, display the investigate the role of OTX2 in regulating the chromatin land- worst prognosis, and are highly metastatic with over 50% of scape, we mapped genome-wide changes in activating patients exhibiting tumor cell dissemination at diagnosis2. They (H3K4me3) and repressive (H3K27me3) histone modifications, are the most aggressive but the least understood in terms of following OTX2 silencing in stem cell-enriched D283 Group 3 tumor progression and developmental origins. While Group 3 MB tumorspheres (Fig. 1a). We found that 8444 protein-coding MBs are believed to originate from either stem or/progenitor cell genes displayed significant changes in H3K4me3 following populations that exist transiently during early cerebellar devel- – OTX2 silencing, while 2001 genes had significant change in opment7 12, the molecular mechanisms that define these popu- H3K27me3, and 564 genes showed changes in both histone lations are not well understood. Cancer cells that adopt aberrant marks (Fig. 1b, c). Of the genes that exhibited a change in stem/progenitor cell signatures are associated with tumor pro- H3K4me3, 90% showed a significant gain in this activating his- pagation, metastasis, and drug resistance13. While targeted tone mark, while 68% of genes with H3K27me3 changes dis- therapies are currently being evaluated in clinical trials (SJDAWN played a significant loss of this repressive mark (Fig. 1d). Overall, (NCT03434262) SJELIOT (NCT04023669) SJMB012 these findings suggest a global derepression of gene expression (NCT01878617)), further molecular characterization of the following OTX2 silencing in Group 3 MB. undifferentiated MB cells that harbor more primitive stem/pro- TFs play critical roles in neuronal specification, differentiation, genitor signatures will undoubtedly lead to the development of and self-renewal during CNS development32. Therefore, we were additional treatment strategies that have less toxic effects on the interested in identifying TFs downstream of OTX2 that may developing nervous system. belong to a larger OTX2-centric GRN controlling cell fate. Orthodenticle homeobox 2 (OTX2) is a homeodomain tran- Following OTX2 silencing, significant changes in H3K4me3 were scription factor (TF) that plays pivotal roles in nervous system – identified in 419 TFs, changes in H3K27me3 were found in 144 patterning, cell fate specification, and differentiation14 16.Muta- TFs, and 42 TFs displayed changes in both modifications (Fig. 1c). tions in OTX2, particularly in the DNA-binding homeodomain, Interestingly, a greater proportion of TFs lost repressive histones have been described in a number of brain and ocular defects17. modifications compared to protein-coding genes overall (Fig. 1d), Interestingly, amplification or increased expression of OTX2 is suggesting an important role for OTX2 in silencing TF expression observed in over 80% of Group 3 and Group 4 MB18.Studies in Group 3 MB tumorspheres. These TFs include a large number interrogating the function of OTX2 specifically in Group 3 MB have – of genes belonging to the FOX, HOX, POU, PAX, SMAD, and largely focused on its role in promoting tumor growth19 21.This SOX families (Supplementary Data 1). The PAX gene family has been attributed, at least in part, to a regulatory role for OTX2 in members PAX3, PAX5, PAX6, PAX7, and PAX9 all exhibited controlling the Group 3 MB chromatin landscape through asso- significant loss of H3K27me3, while PAX6 also showed significant ciation with active enhancer elements22, as well as maintenance of gain of H3K4me3 (Table 1). The PAX family of TFs are critical histone H3 lysine 27 trimethylation (H3K27me3)23. for nervous system development30,31, yet their functional role in We have previously characterized a critical role for OTX2 in Group 3 MB pathogenesis has not been explored. Therefore, we controlling cell fate decisions in Group 3 MB24,25. OTX2 silencing focused our attention on the PAX genes for further study. is accompanied by a robust increase in the expression of axon guidance genes, suggesting that OTX2 actively represses differ- entiation while maintaining Group 3 MB cells in a primitive, Group 3 MBs exhibit low PAX3 and PAX6 expression. We next stem/progenitor cell state25. However, the majority of axon gui- evaluated transcript levels of the PAX genes exhibiting changes in dance genes identified were found to be indirect targets of histone marks, following OTX2 silencing across 763 subgrouped OTX225. The mechanisms by which OTX2 inhibits differentiation patient samples5. PAX3 and PAX6 were significantly lower in of Group 3 MB cells are largely unknown. Thus, we sought to Group 3 and Group 4 MB relative to WNT and SHH MB tumors, identify OTX2-binding partners and to further interrogate how while, PAX5, PAX7, and PAX9 were not significantly different OTX2 regulates
Load more

Recommended publications
  • Correct Setup of the Substantia Nigra Requires Reelin-Mediated Fast, Laterally- Directed Migration of Dopaminergic Neurons
    RESEARCH ARTICLE Correct setup of the substantia nigra requires Reelin-mediated fast, laterally- directed migration of dopaminergic neurons Ankita Ravi Vaswani1, Beatrice Weykopf2†, Cathleen Hagemann1, Hans-Ulrich Fried3, Oliver Bru¨ stle2, Sandra Blaess1* 1Neurodevelopmental Genetics, Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 2Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 3Light Microscope Facility, German Center for Neurodegenerative Diseases, Bonn, Germany Abstract Midbrain dopaminergic (mDA) neurons migrate to form the laterally-located substantia nigra pars compacta (SN) and medially-located ventral tegmental area (VTA), but little is known about the underlying cellular and molecular processes. Here we visualize the dynamic cell morphologies of tangentially migrating SN-mDA neurons in 3D and identify two distinct migration modes. Slow migration is the default mode in SN-mDA neurons, while fast, laterally-directed *For correspondence: migration occurs infrequently and is strongly associated with bipolar cell morphology. Tangential [email protected] migration of SN-mDA neurons is altered in absence of Reelin signaling, but it is unclear whether Reelin acts directly on migrating SN-mDA neurons and how it affects their cell morphology and † Present address: Precision migratory behavior. By specifically inactivating Reelin signaling in mDA neurons we demonstrate its Neurology Program & Advanced direct role in SN-mDA tangential migration. Reelin promotes laterally-biased movements in mDA Center for Parkinson’s Disease neurons during their slow migration mode, stabilizes leading process morphology and increases the Research, Harvard Medical School and Brigham & Women’s probability of fast, laterally-directed migration.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author J Dent Res Manuscript Author . Author manuscript; Manuscript Author available in PMC 2017 October 01. Published in final edited form as: J Dent Res. 2017 October ; 96(11): 1322–1329. doi:10.1177/0022034517716914. A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts L.M. Moreno Uribe1, T. Fomina2, R.G. Munger3, P.A. Romitti4, M.M. Jenkins5, H.K. Gjessing2,6, M. Gjerdevik2,6, K. Christensen7, A.J. Wilcox8, J.C. Murray9, R.T. Lie2,6,*, and G.L. Wehby10,* 1Department of Orthodontics and Dows Institute, College of Dentistry, University of Iowa, Iowa City, IA, USA 2Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway 3Department of Nutrition and Food Sciences, Utah State University, Logan, UT, USA 4Department of Epidemiology, College of Public Health, University of Iowa, Iowa City, IA, USA 5National Center on Birth Defects and Developmental Disabilities, Centers for Disease Control and Prevention, Atlanta, GA, USA 6Norwegian Institute of Public Health, Bergen and Oslo, Norway 7Department of Public Health, University of Southern Denmark; Department of Clinical Genetics and Department of Biochemistry and Pharmacology, Odense University Hospital, Odense, Denmark 8Epidemiology Branch, National Institute of Environmental Health Sciences, National Institutes of Health, Durham, NC, USA 9Department of Pediatrics, Carver College of Medicine, University of Iowa, Iowa City, IA, USA 10Departments of Health Management and Policy, Economics, and Preventive and Community Dentistry, and Public Policy Center, University of Iowa, Iowa City, IA, USA Abstract Prior genome-wide association studies for oral clefts have focused on clinic-based samples with unclear generalizability.
    [Show full text]
  • BMP Signaling Orchestrates a Transcriptional Network to Control the Fate of Mesenchymal Stem Cells (Mscs)
    bioRxiv preprint doi: https://doi.org/10.1101/104927; this version posted February 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. BMP signaling orchestrates a transcriptional network to control the fate of mesenchymal stem cells (MSCs) Jifan Feng1, Junjun Jing1,2, Jingyuan Li1, Hu Zhao1, Vasu Punj3, Tingwei Zhang1,2, Jian Xu1 and Yang Chai1,* 1Center for Craniofacial Molecular Biology, University of Southern California, Los Angeles, CA 90033, USA 2State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China 3Department of Medicine, Keck School of Medicine, University of Southern California, Los Angeles, CA 90089, USA *Corresponding author: Yang Chai 2250 Alcazar Street – CSA 103 Center for Craniofacial Molecular Biology University of Southern California Los Angeles, CA Phone number: 323-442-3480 [email protected] Running Title: BMP regulates cell fate of MSCs Key Words: BMP, mesenchymal stem cells (MSCs), odontogenesis, Gli1 Summary Statement: BMP signaling activity is required for the lineage commitment of MSCs and transcription factors downstream of BMP signaling may determine distinct cellular identities within the dental mesenchyme. 1 bioRxiv preprint doi: https://doi.org/10.1101/104927; this version posted February 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
    [Show full text]
  • Differentiation of the Human PAX7
    © 2020. Published by The Company of Biologists Ltd | Development (2020) 147, dev187344. doi:10.1242/dev.187344 HUMAN DEVELOPMENT TECHNIQUES AND RESOURCES ARTICLE Differentiation of the human PAX7-positive myogenic precursors/satellite cell lineage in vitro Ziad Al Tanoury1,2,3, Jyoti Rao2,3, Olivier Tassy1,Bénédicte Gobert1,4, Svetlana Gapon2, Jean-Marie Garnier1, Erica Wagner2, Aurore Hick4, Arielle Hall5, Emanuela Gussoni5 and Olivier Pourquié1,2,3,6,* ABSTRACT SC derive from the paraxial mesoderm, the embryonic tissue that Satellite cells (SC) are muscle stem cells that can regenerate adult forms the vertebral column and skeletal muscles (Chal and Pourquié, muscles upon injury. Most SC originate from PAX7+ myogenic 2017; Gros et al., 2005; Hutcheson et al., 2009; Kassar-Duchossoy precursors set aside during development. Although myogenesis has et al., 2005; Lepper and Fan, 2010; Relaix et al., 2005; Schienda et al., + been studied in mouse and chicken embryos, little is known about 2006). Pax3 myogenic precursors arise from the dorsal epithelial + human muscle development. Here, we report the generation of human compartment of the somite called the dermomyotome. Pax3 cells of induced pluripotent stem cell (iPSC) reporter lines in which fluorescent the dermomyotome lips activate Myf5, then downregulate Pax3 and proteins have been introduced into the PAX7 and MYOG loci. We use delaminate and differentiate into elongated post-mitotic myocytes single cell RNA sequencing to analyze the developmental trajectory of expressing myogenin (Myog) to form the first embryonic muscles + the iPSC-derived PAX7+ myogenic precursors. We show that the called myotomes (Chal and Pourquié, 2017). At the same time, Pax3 PAX7+ cells generated in culture can produce myofibers and self- myogenic precursors delaminate from the lateral edge of the renew in vitro and in vivo.
    [Show full text]
  • PAX7 Balances the Cell Cycle Progression Via Regulating Expression of Dnmt3b and Apobec2 in Differentiating Pscs
    cells Article PAX7 Balances the Cell Cycle Progression via Regulating Expression of Dnmt3b and Apobec2 in Differentiating PSCs Anita Florkowska , Igor Meszka, Joanna Nowacka, Monika Granica , Zuzanna Jablonska, Magdalena Zawada, Lukasz Truszkowski , Maria A. Ciemerych and Iwona Grabowska * Department of Cytology, Institute of Developmental Biology and Biomedical Sciences, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw, Poland; a.fl[email protected] (A.F.); [email protected] (I.M.); [email protected] (J.N.); [email protected] (M.G.); [email protected] (Z.J.); [email protected] (M.Z.); [email protected] (L.T.); [email protected] (M.A.C.) * Correspondence: [email protected] Abstract: PAX7 transcription factor plays a crucial role in embryonic myogenesis and in adult muscles in which it secures proper function of satellite cells, including regulation of their self renewal. PAX7 downregulation is necessary for the myogenic differentiation of satellite cells induced after muscle damage, what is prerequisite step for regeneration. Using differentiating pluripotent stem cells we documented that the absence of functional PAX7 facilitates proliferation. Such action is executed by the modulation of the expression of two proteins involved in the DNA methylation, i.e., Dnmt3b and Apobec2. Increase in Dnmt3b expression led to the downregulation of the CDK inhibitors and Citation: Florkowska, A.; Meszka, I.; facilitated cell cycle progression. Changes in Apobec2 expression, on the other hand, differently Nowacka, J.; Granica, M.; Jablonska, impacted proliferation/differentiation balance, depending on the experimental model used. Z.; Zawada, M.; Truszkowski, L.; Ciemerych, M.A.; Grabowska, I.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • The Regulation of Lunatic Fringe During Somitogenesis
    THE REGULATION OF LUNATIC FRINGE DURING SOMITOGENESIS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Emily T. Shifley ***** The Ohio State University 2009 Dissertation Committee: Approved by Professor Susan Cole, Advisor Professor Christine Beattie _________________________________ Professor Mark Seeger Advisor Graduate Program in Molecular Genetics Professor Michael Weinstein ABSTRACT Somitogenesis is the morphological hallmark of vertebrate segmentation. Somites bud from the presomitic mesoderm (PSM) in a sequential, periodic fashion and give rise to the rib cage, vertebrae, and dermis and muscles of the back. The regulation of somitogenesis is complex. In the posterior region of the PSM, a segmentation clock operates to organize cohorts of cells into presomites, while in the anterior region of the PSM the presomites are patterned into rostral and caudal compartments (R/C patterning). Both of these stages of somitogenesis are controlled, at least in part, by the Notch pathway and Lunatic fringe (Lfng), a glycosyltransferase that modifies the Notch receptor. To dissect the roles played by Lfng during somitogenesis, we created a novel allele that lacks cyclic Lfng expression within the segmentation clock, but that maintains expression during R/C somite patterning (Lfng∆FCE1). Lfng∆FCE1/∆FCE1 mice have severe defects in their anterior vertebrae and rib cages, but relatively normal sacral and tail vertebrae, unlike Lfng knockouts. Segmentation clock function is differentially affected by the ∆FCE1 deletion; during anterior somitogenesis the expression patterns of many clock genes are disrupted, while during posterior somitogenesis, certain clock components have recovered. R/C patterning occurs relatively normally in Lfng∆FCE1/∆FCE1 embryos, likely contributing to the partial phenotype rescue, and confirming that Lfng ii plays separate roles in the two regions of the PSM.
    [Show full text]
  • NKX2-8 Antibody (Pab)
    21.10.2014NKX2-8 antibody (pAb) Rabbit Anti -Human/Mouse/Rat NK2 homeobox 8 (NKXH, NKX2 -9) Instruction Manual Catalog Number PK-AB718-6753 Synonyms NKX2-8 Antibody: NK2 homeobox 8, NKXH, NKX2-9 Description NKX2-8 (NK2 homeobox 8) is a member of a family of transcription factors that are involved in embryonic development and cell fate. It is expressed in the ventral foregut, the developing heart, the epithelial layers of the branchial arches and in the dorsal mesoderm. In conjunction with related protein, NKX2-5, NKX2-8 may play a role in cardiac embryonic development. NKX2-8 is also thought to be involved in lung development and is suspected of being an oncogene in lung cancer that is activated by way of gene amplification at chromosome 14q13. Quantity 100 µg Source / Host Rabbit Immunogen NKX2-8 antibody was raised against a 19 amino acid synthetic peptide near the center of human NKX2-8. Purification Method Affinity chromatography purified via peptide column. Clone / IgG Subtype Polyclonal antibody Species Reactivity Human, Mouse, Rat Specificity NKX2-8 antibody is predicted to not cross-react with other NK2 homeobox family members. Formulation Antibody is supplied in PBS containing 0.02% sodium azide. Reconstitution During shipment, small volumes of antibody will occasionally become entrapped in the seal of the product vial. For products with volumes of 200 μl or less, we recommend gently tapping the vial on a hard surface or briefly centrifuging the vial in a tabletop centrifuge to dislodge any liquid in the container’s cap. Storage & Stability Antibody can be stored at 4ºC for three months and at -20°C for up to one year.
    [Show full text]