DOCSLIB.ORG

Identification of Novel DNA Methylation Markers in Colorectal Cancer Using MIRA-Based Microarrays

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Novel DNA Methylation Markers in Colorectal Cancer Using MIRA-Based Microarrays ONCOLOGY REPORTS 28: 99-104, 2012 Identification of novel DNA methylation markers in colorectal cancer using MIRA-based microarrays HAI LI1, YONG DU2, DONG ZHANG1, LI-NA WANG1, CHUN YANG1, BIN LIU2, WEI-JIE WANG1, LEI SHI1, WEI-GUO HONG3, LIANG ZHANG3 and YIN-XUE YANG1 1Department of Colorectal Surgery and 2Surgical Research Laboratory, General Hospital of Ningxia Medical University, 3 Yinchuan, Ningxia 750004; BioChain (Beijing) Science and Technology Inc., Beijing 100176, P.R. China Received January 31, 2012; Accepted March 12, 2012 DOI: 10.3892/or.2012.1779 Abstract. To identify novel hypermethylated genes in In conclusion, we found a set of novel hypermethylated genes colorectal cancer (CRC) and to test their potential application in CRC, which may have potential to be used as biomarkers for in CRC early diagnosis, a genome-wide screening of 57,723 the early diagnosis of CRC. CpG dinucleotides covering 4,010 genes was performed using MIRA-based microarrays in paired DNA samples extracted Introduction from 3 fresh frozen CRC tissues and their matching non-cancer tissues from 3 CRC patients undergoing curative surgery. Colorectal cancer (CRC) is the third most common cancer Candidate hypermethylated genes screened by MIRA-based in men and women, accounting for 11% of all cancer-related microarrays were further validated in independent CRC deaths (1). In the Chinese population, the morbidity and samples. A total of 297 CpG dinucleotides covering 211 genes mortality of colorectal cancer has risen in recent years. were found to be hypermethylated in CRC tissues. From these Colorectal cancer is best treatable if diagnosed early. Surgery 211 candidate methylated genes, three novel hypermethylated alone can be curative in more than 90% of patients with stage I genes with more than four probes positive were picked up for CRC but less than 50% in most subgroups of stage III CRC (2). validation. Direct bisulfite sequencing revealed that methyl- Therefore, early detection of CRC is of paramount importance ations occurred at multiple CpG sites of these three genes in and the key to ultimately curing the vast majority of patients. cancer tissues, especially for PHOX2B and FGF12. Combined DNA methylation is heritable chemical modification bisulfite restriction analysis showed that these three genes induced by enzyme that changes the appearance and structure were methylated in cancer samples but not in non-cancer of DNA without altering its sequence. Aberrant DNA methyla- samples. We also compared the methylation levels of these tion of tumor suppressor genes, a more frequent mechanism of three novel hypermethylated genes with those of vimentin deregulation of gene expression of tumor suppressor genes in and SEPT9, well-known hypermethylated genes in CRC, and the development of cancer than well-known genetic variations found that methylated PHOX2B, FGF12 and GAD2 were (3), may have a potential as cancer biomarkers to achieve high better than methylated vimentin and SEPT9 in differentiating sensitivity and specificity for cancer screening. Many efforts CRC cancer tissue from non-cancer tissue. Significant enrich- have been invested to utilize such promoter methylation as ment analysis of GO terms of the hypermethylated genes a biomarker for potential early detection of CRC. As one of showed that a high proportion of hypermethylated genes in the most quickly evolving areas in CRC biomarker research, cancer tissues are involved in the regulation of transcription. the importance of methylation biomarker in CRC screening is becoming increasingly recognized. Recently, many methyl- ated genes have been demonstrated to be potential biomarkers for the detection of CRC, including methylated SEPT9 (4) in the plasma, methylated vimentin (5) and methylated TFPI2 (6) Correspondence to: Dr Yin-Xue Yang, Department of Colorectal in stool. For examples, Lofton-Day et al (4) developed an assay Surgery, General Hospital of Ningxia Medical University, Yinchuan, for the detection of circulating methylated SEPT9 DNA in Ningxia 750004, P.R. China plasma, and evaluated its performance as a colorectal cancer E-mail: [email protected] biomarker in prospectively collected case-control samples. Abbreviations: MIRA, methylated-CpG island recovery assay, CRC, ColoSure™, detecting methylation status of vimentin in stool colorectal cancer; COBRA, combined bisulfite restriction analysis with Methylation-Specific PCR (MSP) technology, has been launched for CRC screening service commercially. Despite Key words: DNA methylation analysis, methyl-CpG binding protein, great progression in CRC methylation biomarker applica- microarrays, CpG islands, colorectal cancer tions, more efforts are still needed to improve the sensitivity and specificity of methylation biomarker. Considering that tumorigenesis is multi-gene, multi-step and multi-pathway process, improvement in the sensitivity and specificity for 100 LI et al: IDENTIFYING DNA METHYLATION MARKERS IN COLORECTAL CANCER Table I. Primer pairs for COBRA validation of significantly hypermethylated genes. Gene symbol RefSeq Primer (5'➝3') FGF12 NM_021032 F: TTCGTGCGGTTGGTGGTT R: TATCCAAAATATACCTACACATACATACAT GAD2 NM_000818 F: AAATAGTTTTAGGTTCGTTTTATAGAAGG R: CCAAACACCCGAATCTTAACAAC PHOX2B NM_003924 F: GGCGTTTGTGTTAGAAAGGAT R: AAACCAACTCCTCCCRAATA SEPT9 NM_001311493 F: GCGGTCGTAGTAGTTAGTTTAGTAT R: CGCCGAAAACRCTTCCTC Vimentin NM_003380 F: CGGCGGGGTTTAGTTTTTTGT R: ACGATAACRCRAACTAACTCCC early detection of cancer cannot count on only using status samples using MIRA microarray to screen novel methylation of single gene. Recently, a new strategy that uses a panel of biomarkers, and further validate those methylation biomarkers methylation markers to discriminate tumor from non-tumor in independent samples. tissue has emerged. Currently, several high throughput tools have been devel- Materials and methods oped for mapping DNA methylation on a genomic scale, which offer great convenience in discovering novel methylation Subjects/patients. Primary cancer and matching adjacent biomarkers for this new strategy. Most of these tools should non-cancer tissue samples from a cohort of 3 CRC patients translate DNA methylation patterns into DNA sequence infor- undergoing curative surgery at our hospital were obtained for mation or enrich methylated DNA fragments by using bisulfite microarray screening. All cancers were clinically and histo- conversion, methylation-sensitive restriction endonucleases, logically diagnosed as CRC. All samples were immediately DNA demethylation regents or antibody against 5-methylcy- frozen in liquid nitrogen and stored at -80˚C until nucleic acids tosine. Bisulfite-based methods are limited by considerable extraction. The study was approved by the Ethics Committee bioinformatics challenges for the genome mainly consists at our hospital, and all patients gave their informed written of three DNA bases after sodium bisulfite conversion of consent. Patient information was obtained from medical cytosine. Methods based on methylation-sensitive restriction records. endonucleases are limited by the occurrence of the respective sites within the target sequence. DNA demethylation regent- MIRA microarray analysis of DNA methylation. The MIRA based approaches, which use microarray to detect altered microarray analysis was performed largely as previously gene expression induced by DNA methyltransferase inhibitor reported (13). Briefly, DNA from fresh frozen tissues was cut in vitro cells, are effective but can only be used with cell lines, using MseI digestion (5'-TTAA). The fragmented DNA samples which DNA methylation profiles may be different from that were then purified using MicroDNA Purification kit (Beijing observed in primary tumor tissue (7). Antibody based tools are CoWin Biotech Co., Beijing, China) to filter out segments also limited because it requires ssDNA for recognition, which <100 bp. The purified DNA fragments were used to enrich is sometimes difficult to achieve in CpG-rich DNA regions. methylated DNA using Methylated Human DNA Enrichment Recently, the methylated-CpG island recovery assay kit (cat. # K5011425, BioChain Institute, Inc., Hayward, CA) (MIRA) in combination with microarray has been developed according to the manufacturer's instructions. This kit uses to define DNA methylation patterns across the human genome. MBD beads which were generated with an affinity binding This method makes use of the high affinity of methyl binding of the recombinant MBD protein and Ni-beads through the domain (MBD) protein for double-stranded CpG-methlation His tag. MBD provides more sensitivity and specificity DNA and has several advantages over existing techniques for than antibody in binding methylated DNA and is capable of analyzing DNA methylation patterns. It does not depend on the enriching methylated DNA fragments more efficiently than occurrence of specific methylation-sensitive restriction sites antibody (13). The MIRA-enriched DNA was purified and within the target sequence, does not require ssDNA for recogni- amplified using GenomePlex Whole Genome Amplification tion and has a low false positive rate in cataloguing methylated kit (Sigma), instead of conventional PCR amplification with CpG islands on a genome-wide basis (8). It has been widely linker primer. This modification led to better liner amplifica- used to detect genome-wide DNA methylation, including in tion, less DNA amplification bias and procedure omission of lung cancer (8,9), childhood acute lymphoblastic leukemia adding linker. Amplicons
Load more

Recommended publications
  • Roles and Regulation of Transcription Factor Mafa in Islet Β-Cells
    Endocr. J./ S. ARAMATA et al.: INSULIN TRANSCRIPTION AND MafA doi: 10.1507/endocrj.KR-101 REVIEW Roles and Regulation of Transcription Factor MafA in Islet β-cells * SHINSAKU ARAMATA, SONG-IEE HAN AND KOHSUKE KATAOKA Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan ＊Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba Science City, Ibaraki 305-8572, Japan. Released online August 30, 2007 Correspondence to: Kohsuke KATAOKA, Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan Abstract. Insulin is a critical hormone in the regulation of blood glucose levels. It is produced exclusively by pancreatic islet β-cells. β-cell-enriched transcription factors, such as Pdx1 and Beta2, have dual roles in the activation of the insulin gene promoter establishing β-cell-specific insulin expression, and in the regulation of β-cell differentiation. It was shown that MafA, a β-cell-specific member of the Maf family of transcription factors, binds to the conserved C1/RIPE3b element of the insulin promoter. The Maf family proteins regulate tissue-specific gene expression and cell differentiation in a wide variety of tissues. MafA acts synergistically with Pdx1 and Beta2 to activate the insulin gene promoter, and mice with a targeted deletion of mafA develop age-dependent diabetes. MafA also regulates genes involved in β-cell function such as Glucose transporter 2, Glucagons-like peptide 1 receptor, and Prohormone convertase 1/3. The abundance of MafA in β-cells is regulated at both the transcriptional and post-translational levels by glucose and oxidative stress.
    [Show full text]
  • The Prognostic Utility and Clinical Outcomes of MNX1-AS1 Expression in Cancers: a Systematic Review and Meta-Analysis
    The prognostic utility and clinical outcomes of MNX1-AS1 expression in cancers: a systematic review and meta-analysis Juan Li The rst aliated hospital, college of medicine, zhejiang university https://orcid.org/0000-0002-0121-7098 Wen Jin The rst aliated hospital, college of medicine, zhejiang university Zhengyu Zhang The rst aliated hospital, college of medicine, zhejiang university Jingjing Chu The rst aliated hospital, college of medicine, zhejiang university Hui Yang The rst aliated hospital, college of meicine, zhejiang university Chang Li the rst aliated hospital, college of medicine, zhejiang university Ruiyin Dong The rst aliated hospital, college of medicine, zhejiang university Cailian Zhao ( [email protected] ) https://orcid.org/0000-0001-8337-0610 Primary research Keywords: Long non-coding RNA, MNX1-AS1, Cancer, Prognosis Posted Date: March 25th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-19089/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/9 Abstract Background: Recently, emerging studies have identied that MNX1-AS1 highly expressed among variety of cancers and related with worse prognosis of cancer patients. The purpose of this study was to evaluate the relationship between MNX1-AS1 expression with clinical features and prognosis in different cancers. Methods: In this study, we searched the Web of Science, PubMed, CNKI, and Wanfang databases to nd relevant studies of MNX1-AS1. Pooled hazard ratios (HRs) and odds ratios (ORs) with 95% condence intervals (CIs) were applied to explore the prognostic and clinical signicance of MNX1-AS1. Results: A total of 9 literatures were included in this study, including 882 cancer patients.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Rb and P53 Execute Distinct Roles in the Development of Pancreatic Neuroendocrine Tumors
    Author Manuscript Published OnlineFirst on June 26, 2020; DOI: 10.1158/0008-5472.CAN-19-2232 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 Title: Rb and p53 execute distinct roles in the development of pancreatic neuroendocrine tumors 2 Running Title: Roles of Rb and p53 in pancreatic neuroendocrine tumors 3 4 1Yuki Yamauchi, 1,2Yuzo Kodama, 1Masahiro Shiokawa, 1Nobuyuki Kakiuchi, 1Saiko Marui, 5 1Takeshi Kuwada, 1Yuko Sogabe, 1Teruko Tomono, 1Atsushi Mima, 1Toshihiro Morita, 1Tomoaki 6 Matsumori, 1Tatsuki Ueda, 1Motoyuki Tsuda, 1Yoshihiro Nishikawa, 1Katsutoshi Kuriyama, 7 1Yojiro Sakuma, 1Yuji Ota, 1Takahisa Maruno, 1Norimitsu Uza, 2Atsuhiro Masuda, 3Hisato 8 Tatsuoka, 3Daisuke Yabe, 4Sachiko Minamiguchi, 5Toshihiko Masui, 3Nobuya Inagaki, 5Shinji 9 Uemoto, 1,6Tsutomu Chiba, and 1Hiroshi Seno 10 11 1Department of Gastroenterology and Hepatology, Kyoto University Graduate School of 12 Medicine, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 13 2Department of Gastroenterology, Kobe University Graduate School of Medicine, 7-5-1 14 Kusunoki-cho, Chuo-ku, Kobe, Hyogo, 650-0017, Japan. 15 3Department of Diabetes, Endocrinology and Nutrition, Kyoto University Graduate School of 16 Medicine, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 17 4Department of Diagnostic Pathology, Kyoto University Graduate School of Medicine, 54 18 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 1 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 26, 2020; DOI: 10.1158/0008-5472.CAN-19-2232 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes
    Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes Sevda Gheibi *, Tania Singh, Joao Paulo M.C.M. da Cunha, Malin Fex and Hindrik Mulder * Unit of Molecular Metabolism, Lund University Diabetes Centre, Jan Waldenströms gata 35; Box 50332, SE-202 13 Malmö, Sweden; [email protected] (T.S.); [email protected] (J.P.M.C.M.d.C.); [email protected] (M.F.) * Correspondence: [email protected] (S.G.); [email protected] (H.M.) Supplementary Table 1. Transcription factors associated with development of the pancreas. Developmental Gene Aliases Function Ref. Stage SRY-Box Transcription Factor Directs the primitive endoderm SOX17 DE, PFE, PSE [1] 17 specification. Establishes lineage-specific transcriptional programs which leads DE, PFE, PSE, Forkhead Box A2; Hepatocyte to proper differentiation of stem cells FOXA2 PMPs, EPs, [2] Nuclear Factor 3-β into pancreatic progenitors. Regulates Mature β-cells expression of PDX1 gene and aids in maturation of β-cells A pleiotropic developmental gene which regulates growth, and Sonic Hedgehog Signaling differentiation of several organs. SHH DE [3] Molecule Repression of SHH expression is vital for pancreas differentiation and development Promotes cell differentiation, proliferation, and survival. Controls C-X-C Motif Chemokine the spatiotemporal migration of the Receptor 4; Stromal Cell- CXCR4 DE angioblasts towards pre-pancreatic [4] Derived Factor 1 Receptor; endodermal region which aids the Neuropeptide Y3 Receptor induction of PDX1 expression giving rise to common pancreatic progenitors Crucial for generation of pancreatic HNF1 Homeobox B HNF1B PFE, PSE, PMPs multipotent progenitor cells and [5] Hepatocyte Nuclear Factor 1-β NGN3+ endocrine progenitors Master regulator of pancreatic organogenesis.
    [Show full text]
  • BMP Signaling Orchestrates a Transcriptional Network to Control the Fate of Mesenchymal Stem Cells (Mscs)
    bioRxiv preprint doi: https://doi.org/10.1101/104927; this version posted February 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. BMP signaling orchestrates a transcriptional network to control the fate of mesenchymal stem cells (MSCs) Jifan Feng1, Junjun Jing1,2, Jingyuan Li1, Hu Zhao1, Vasu Punj3, Tingwei Zhang1,2, Jian Xu1 and Yang Chai1,* 1Center for Craniofacial Molecular Biology, University of Southern California, Los Angeles, CA 90033, USA 2State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China 3Department of Medicine, Keck School of Medicine, University of Southern California, Los Angeles, CA 90089, USA *Corresponding author: Yang Chai 2250 Alcazar Street – CSA 103 Center for Craniofacial Molecular Biology University of Southern California Los Angeles, CA Phone number: 323-442-3480 [email protected] Running Title: BMP regulates cell fate of MSCs Key Words: BMP, mesenchymal stem cells (MSCs), odontogenesis, Gli1 Summary Statement: BMP signaling activity is required for the lineage commitment of MSCs and transcription factors downstream of BMP signaling may determine distinct cellular identities within the dental mesenchyme. 1 bioRxiv preprint doi: https://doi.org/10.1101/104927; this version posted February 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
    [Show full text]
  • Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis
    cells Article Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis Han-Yu Wang 1,2, Chun-Hsiang Lin 1, Yi-Ru Shen 1, Ting-Yu Chen 2,3, Chia-Yih Wang 2,3,* and Pao-Lin Kuo 1,2,4,* 1 Department of Obstetrics and Gynecology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] (H.-Y.W.); [email protected] (C.-H.L.); [email protected] (Y.-R.S.) 2 Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] 3 Department of Cell Biology and Anatomy, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan 4 Department of Obstetrics and Gynecology, National Cheng-Kung University Hospital, Tainan 704, Taiwan * Correspondence: [email protected] (C.-Y.W.); [email protected] (P.-L.K.); Tel.: +886-6-2353535 (ext. 5338); (C.-Y.W.)+886-6-2353535 (ext. 5262) (P.-L.K.) Abstract: Septins are GTP-binding proteins that form heteromeric filaments for proper cell growth and migration. Among the septins, septin7 (SEPT7) is an important component of all septin filaments. Here we show that protein kinase A (PKA) phosphorylates SEPT7 at Thr197, thus disrupting septin filament dynamics and ciliogenesis. The Thr197 residue of SEPT7, a PKA phosphorylating site, was conserved among different species. Treatment with cAMP or overexpression of PKA catalytic subunit (PKACA2) induced SEPT7 phosphorylation, followed by disruption of septin filament formation. Constitutive phosphorylation of SEPT7 at Thr197 reduced SEPT7-SEPT7 interaction, but did not affect SEPT7-SEPT6-SEPT2 or SEPT4 interaction.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • The Regulation of Lunatic Fringe During Somitogenesis
    THE REGULATION OF LUNATIC FRINGE DURING SOMITOGENESIS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Emily T. Shifley ***** The Ohio State University 2009 Dissertation Committee: Approved by Professor Susan Cole, Advisor Professor Christine Beattie _________________________________ Professor Mark Seeger Advisor Graduate Program in Molecular Genetics Professor Michael Weinstein ABSTRACT Somitogenesis is the morphological hallmark of vertebrate segmentation. Somites bud from the presomitic mesoderm (PSM) in a sequential, periodic fashion and give rise to the rib cage, vertebrae, and dermis and muscles of the back. The regulation of somitogenesis is complex. In the posterior region of the PSM, a segmentation clock operates to organize cohorts of cells into presomites, while in the anterior region of the PSM the presomites are patterned into rostral and caudal compartments (R/C patterning). Both of these stages of somitogenesis are controlled, at least in part, by the Notch pathway and Lunatic fringe (Lfng), a glycosyltransferase that modifies the Notch receptor. To dissect the roles played by Lfng during somitogenesis, we created a novel allele that lacks cyclic Lfng expression within the segmentation clock, but that maintains expression during R/C somite patterning (Lfng∆FCE1). Lfng∆FCE1/∆FCE1 mice have severe defects in their anterior vertebrae and rib cages, but relatively normal sacral and tail vertebrae, unlike Lfng knockouts. Segmentation clock function is differentially affected by the ∆FCE1 deletion; during anterior somitogenesis the expression patterns of many clock genes are disrupted, while during posterior somitogenesis, certain clock components have recovered. R/C patterning occurs relatively normally in Lfng∆FCE1/∆FCE1 embryos, likely contributing to the partial phenotype rescue, and confirming that Lfng ii plays separate roles in the two regions of the PSM.
    [Show full text]
  • The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling
    FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Cand.scient. Rasmus Klinck Department of Beta Cell Regeneration, Hagedorn Research Institute, and The PhD School of Science, Faculty of Science, University of Copenhagen, Denmark. The role of Hes1 in pancreas development Expression, Interdependancy and Notch signalling. Academic Advisors Dr. Olaf Nielsen, Department of Biology, Faculty of Science, University of Copenhagen – Denmark Dr. Mette C. Jørgensen, Department of Beta Cell Regeneration, Hagedorn Research Institute Denmark Submitted: 31/05/11 Cover picture: e10.5 mouse embryo expressing EGFP under the control of the Hes1 promoter manually stitched together from 15 complete image stacks. 2 Preface This Ph.D. thesis is based on experimental work performed in the Department of β Cell Regeneration at the Hagedorn Research Institute, Gentofte, Denmark from January 2008 to December 2010. The faculty supervisor on the project was Professor Olaf Nielsen, Department of Genetics, Faculty of Science, University of Copenhagen, and the project supervisor was Mette Christine Jørgensen, Ph.D., Chemist, Department of Beta Cell Regeneration at the Hagedorn Research Institute. This thesis is submitted in order to meet the requirements for obtaining a Ph.D. degree at the Faculty of Science, University of Copenhagen. The thesis is built around three scientific Manuscripts: Manuscript I: “A BAC transgenic Hes1-EGFP reporter reveals novel expression domains in mouse embryos” Submitted to Gene Expression Patterns Rasmus Klinck1, Ernst-Martin Füchtbauer2, Jonas Ahnfelt-Rønne1, Palle Serup1,Jan Nygaard Jensen1, Ole Dragsbæk Madsen1, Mette Christine Jørgensen1 1Department of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark .2Department of Molecular Biology, Aarhus University, C.
    [Show full text]