ONCOLOGY REPORTS 28: 99-104, 2012 Identification of novel DNA methylation markers in colorectal cancer using MIRA-based microarrays HAI LI1, YONG DU2, DONG ZHANG1, LI-NA WANG1, CHUN YANG1, BIN LIU2, WEI-JIE WANG1, LEI SHI1, WEI-GUO HONG3, LIANG ZHANG3 and YIN-XUE YANG1 1Department of Colorectal Surgery and 2Surgical Research Laboratory, General Hospital of Ningxia Medical University, 3 Yinchuan, Ningxia 750004; BioChain (Beijing) Science and Technology Inc., Beijing 100176, P.R. China Received January 31, 2012; Accepted March 12, 2012 DOI: 10.3892/or.2012.1779 Abstract. To identify novel hypermethylated genes in In conclusion, we found a set of novel hypermethylated genes colorectal cancer (CRC) and to test their potential application in CRC, which may have potential to be used as biomarkers for in CRC early diagnosis, a genome-wide screening of 57,723 the early diagnosis of CRC. CpG dinucleotides covering 4,010 genes was performed using MIRA-based microarrays in paired DNA samples extracted Introduction from 3 fresh frozen CRC tissues and their matching non-cancer tissues from 3 CRC patients undergoing curative surgery. Colorectal cancer (CRC) is the third most common cancer Candidate hypermethylated genes screened by MIRA-based in men and women, accounting for 11% of all cancer-related microarrays were further validated in independent CRC deaths (1). In the Chinese population, the morbidity and samples. A total of 297 CpG dinucleotides covering 211 genes mortality of colorectal cancer has risen in recent years. were found to be hypermethylated in CRC tissues. From these Colorectal cancer is best treatable if diagnosed early. Surgery 211 candidate methylated genes, three novel hypermethylated alone can be curative in more than 90% of patients with stage I genes with more than four probes positive were picked up for CRC but less than 50% in most subgroups of stage III CRC (2). validation. Direct bisulfite sequencing revealed that methyl- Therefore, early detection of CRC is of paramount importance ations occurred at multiple CpG sites of these three genes in and the key to ultimately curing the vast majority of patients. cancer tissues, especially for PHOX2B and FGF12. Combined DNA methylation is heritable chemical modification bisulfite restriction analysis showed that these three genes induced by enzyme that changes the appearance and structure were methylated in cancer samples but not in non-cancer of DNA without altering its sequence. Aberrant DNA methyla- samples. We also compared the methylation levels of these tion of tumor suppressor genes, a more frequent mechanism of three novel hypermethylated genes with those of vimentin deregulation of gene expression of tumor suppressor genes in and SEPT9, well-known hypermethylated genes in CRC, and the development of cancer than well-known genetic variations found that methylated PHOX2B, FGF12 and GAD2 were (3), may have a potential as cancer biomarkers to achieve high better than methylated vimentin and SEPT9 in differentiating sensitivity and specificity for cancer screening. Many efforts CRC cancer tissue from non-cancer tissue. Significant enrich- have been invested to utilize such promoter methylation as ment analysis of GO terms of the hypermethylated genes a biomarker for potential early detection of CRC. As one of showed that a high proportion of hypermethylated genes in the most quickly evolving areas in CRC biomarker research, cancer tissues are involved in the regulation of transcription. the importance of methylation biomarker in CRC screening is becoming increasingly recognized. Recently, many methyl- ated genes have been demonstrated to be potential biomarkers for the detection of CRC, including methylated SEPT9 (4) in the plasma, methylated vimentin (5) and methylated TFPI2 (6) Correspondence to: Dr Yin-Xue Yang, Department of Colorectal in stool. For examples, Lofton-Day et al (4) developed an assay Surgery, General Hospital of Ningxia Medical University, Yinchuan, for the detection of circulating methylated SEPT9 DNA in Ningxia 750004, P.R. China plasma, and evaluated its performance as a colorectal cancer E-mail: [email protected] biomarker in prospectively collected case-control samples. Abbreviations: MIRA, methylated-CpG island recovery assay, CRC, ColoSure™, detecting methylation status of vimentin in stool colorectal cancer; COBRA, combined bisulfite restriction analysis with Methylation-Specific PCR (MSP) technology, has been launched for CRC screening service commercially. Despite Key words: DNA methylation analysis, methyl-CpG binding protein, great progression in CRC methylation biomarker applica- microarrays, CpG islands, colorectal cancer tions, more efforts are still needed to improve the sensitivity and specificity of methylation biomarker. Considering that tumorigenesis is multi-gene, multi-step and multi-pathway process, improvement in the sensitivity and specificity for 100 LI et al: IDENTIFYING DNA METHYLATION MARKERS IN COLORECTAL CANCER Table I. Primer pairs for COBRA validation of significantly hypermethylated genes. Gene symbol RefSeq Primer (5'➝3') FGF12 NM_021032 F: TTCGTGCGGTTGGTGGTT R: TATCCAAAATATACCTACACATACATACAT GAD2 NM_000818 F: AAATAGTTTTAGGTTCGTTTTATAGAAGG R: CCAAACACCCGAATCTTAACAAC PHOX2B NM_003924 F: GGCGTTTGTGTTAGAAAGGAT R: AAACCAACTCCTCCCRAATA SEPT9 NM_001311493 F: GCGGTCGTAGTAGTTAGTTTAGTAT R: CGCCGAAAACRCTTCCTC Vimentin NM_003380 F: CGGCGGGGTTTAGTTTTTTGT R: ACGATAACRCRAACTAACTCCC early detection of cancer cannot count on only using status samples using MIRA microarray to screen novel methylation of single gene. Recently, a new strategy that uses a panel of biomarkers, and further validate those methylation biomarkers methylation markers to discriminate tumor from non-tumor in independent samples. tissue has emerged. Currently, several high throughput tools have been devel- Materials and methods oped for mapping DNA methylation on a genomic scale, which offer great convenience in discovering novel methylation Subjects/patients. Primary cancer and matching adjacent biomarkers for this new strategy. Most of these tools should non-cancer tissue samples from a cohort of 3 CRC patients translate DNA methylation patterns into DNA sequence infor- undergoing curative surgery at our hospital were obtained for mation or enrich methylated DNA fragments by using bisulfite microarray screening. All cancers were clinically and histo- conversion, methylation-sensitive restriction endonucleases, logically diagnosed as CRC. All samples were immediately DNA demethylation regents or antibody against 5-methylcy- frozen in liquid nitrogen and stored at -80˚C until nucleic acids tosine. Bisulfite-based methods are limited by considerable extraction. The study was approved by the Ethics Committee bioinformatics challenges for the genome mainly consists at our hospital, and all patients gave their informed written of three DNA bases after sodium bisulfite conversion of consent. Patient information was obtained from medical cytosine. Methods based on methylation-sensitive restriction records. endonucleases are limited by the occurrence of the respective sites within the target sequence. DNA demethylation regent- MIRA microarray analysis of DNA methylation. The MIRA based approaches, which use microarray to detect altered microarray analysis was performed largely as previously gene expression induced by DNA methyltransferase inhibitor reported (13). Briefly, DNA from fresh frozen tissues was cut in vitro cells, are effective but can only be used with cell lines, using MseI digestion (5'-TTAA). The fragmented DNA samples which DNA methylation profiles may be different from that were then purified using MicroDNA Purification kit (Beijing observed in primary tumor tissue (7). Antibody based tools are CoWin Biotech Co., Beijing, China) to filter out segments also limited because it requires ssDNA for recognition, which <100 bp. The purified DNA fragments were used to enrich is sometimes difficult to achieve in CpG-rich DNA regions. methylated DNA using Methylated Human DNA Enrichment Recently, the methylated-CpG island recovery assay kit (cat. # K5011425, BioChain Institute, Inc., Hayward, CA) (MIRA) in combination with microarray has been developed according to the manufacturer's instructions. This kit uses to define DNA methylation patterns across the human genome. MBD beads which were generated with an affinity binding This method makes use of the high affinity of methyl binding of the recombinant MBD protein and Ni-beads through the domain (MBD) protein for double-stranded CpG-methlation His tag. MBD provides more sensitivity and specificity DNA and has several advantages over existing techniques for than antibody in binding methylated DNA and is capable of analyzing DNA methylation patterns. It does not depend on the enriching methylated DNA fragments more efficiently than occurrence of specific methylation-sensitive restriction sites antibody (13). The MIRA-enriched DNA was purified and within the target sequence, does not require ssDNA for recogni- amplified using GenomePlex Whole Genome Amplification tion and has a low false positive rate in cataloguing methylated kit (Sigma), instead of conventional PCR amplification with CpG islands on a genome-wide basis (8). It has been widely linker primer. This modification led to better liner amplifica- used to detect genome-wide DNA methylation, including in tion, less DNA amplification bias and procedure omission of lung cancer (8,9), childhood acute lymphoblastic leukemia adding linker. Amplicons