Spatial and Temporal Specification of Neural Fates by Transcription Factor Codes François Guillemot
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
© 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice. -
I LITERATURE-BASED DISCOVERY of KNOWN and POTENTIAL NEW
LITERATURE-BASED DISCOVERY OF KNOWN AND POTENTIAL NEW MECHANISMS FOR RELATING THE STATUS OF CHOLESTEROL TO THE PROGRESSION OF BREAST CANCER BY YU WANG THESIS Submitted in partial fulfillment of the requirements for the degree of Master of Science in Bioinformatics with a concentration in Library and Information Science in the Graduate College of the University of Illinois at Urbana-Champaign, 2019 Urbana, Illinois Adviser: Professor Vetle I. Torvik Professor Erik Russell Nelson i ABSTRACT Breast cancer has been studied for a long period of time and from a variety of perspectives in order to understand its pathogeny. The pathogeny of breast cancer can be classified into two groups: hereditary and spontaneous. Although cancer in general is considered a genetic disease, spontaneous factors are responsible for most of the pathogeny of breast cancer. In other words, breast cancer is more likely to be caused and deteriorated by the dysfunction of a physical molecule than be caused by germline mutation directly. Interestingly, cholesterol, as one of those molecules, has been discovered to correlate with breast cancer risk. However, the mechanisms of how cholesterol helps breast cancer progression are not thoroughly understood. As a result, this study aims to study known and discover potential new mechanisms regarding to the correlation of cholesterol and breast cancer progression using literature review and literature-based discovery. The known mechanisms are further classified into four groups: cholesterol membrane content, transport of cholesterol, cholesterol metabolites, and other. The potential mechanisms, which are intended to provide potential new treatments, have been identified and checked for feasibility by an expert. -
The Prognostic Utility and Clinical Outcomes of MNX1-AS1 Expression in Cancers: a Systematic Review and Meta-Analysis
The prognostic utility and clinical outcomes of MNX1-AS1 expression in cancers: a systematic review and meta-analysis Juan Li The rst aliated hospital, college of medicine, zhejiang university https://orcid.org/0000-0002-0121-7098 Wen Jin The rst aliated hospital, college of medicine, zhejiang university Zhengyu Zhang The rst aliated hospital, college of medicine, zhejiang university Jingjing Chu The rst aliated hospital, college of medicine, zhejiang university Hui Yang The rst aliated hospital, college of meicine, zhejiang university Chang Li the rst aliated hospital, college of medicine, zhejiang university Ruiyin Dong The rst aliated hospital, college of medicine, zhejiang university Cailian Zhao ( [email protected] ) https://orcid.org/0000-0001-8337-0610 Primary research Keywords: Long non-coding RNA, MNX1-AS1, Cancer, Prognosis Posted Date: March 25th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-19089/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/9 Abstract Background: Recently, emerging studies have identied that MNX1-AS1 highly expressed among variety of cancers and related with worse prognosis of cancer patients. The purpose of this study was to evaluate the relationship between MNX1-AS1 expression with clinical features and prognosis in different cancers. Methods: In this study, we searched the Web of Science, PubMed, CNKI, and Wanfang databases to nd relevant studies of MNX1-AS1. Pooled hazard ratios (HRs) and odds ratios (ORs) with 95% condence intervals (CIs) were applied to explore the prognostic and clinical signicance of MNX1-AS1. Results: A total of 9 literatures were included in this study, including 882 cancer patients. -
Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. -
Investigating Cone Photoreceptor Development Using Patient-Derived NRL Null Retinal Organoids
ARTICLE https://doi.org/10.1038/s42003-020-0808-5 OPEN Investigating cone photoreceptor development using patient-derived NRL null retinal organoids Alyssa Kallman1,11, Elizabeth E. Capowski 2,11, Jie Wang 3, Aniruddha M. Kaushik4, Alex D. Jansen2, Kimberly L. Edwards2, Liben Chen4, Cynthia A. Berlinicke3, M. Joseph Phillips2,5, Eric A. Pierce6, Jiang Qian3, ✉ ✉ Tza-Huei Wang4,7, David M. Gamm2,5,8 & Donald J. Zack 1,3,9,10 1234567890():,; Photoreceptor loss is a leading cause of blindness, but mechanisms underlying photoreceptor degeneration are not well understood. Treatment strategies would benefit from improved understanding of gene-expression patterns directing photoreceptor development, as many genes are implicated in both development and degeneration. Neural retina leucine zipper (NRL) is critical for rod photoreceptor genesis and degeneration, with NRL mutations known to cause enhanced S-cone syndrome and retinitis pigmentosa. While murine Nrl loss has been characterized, studies of human NRL can identify important insights for human retinal development and disease. We utilized iPSC organoid models of retinal development to molecularly define developmental alterations in a human model of NRL loss. Consistent with the function of NRL in rod fate specification, human retinal organoids lacking NRL develop S- opsin dominant photoreceptor populations. We report generation of two distinct S-opsin expressing populations in NRL null retinal organoids and identify MEF2C as a candidate regulator of cone development. 1 Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Baltimore, USA. 2 Waisman Center, University of Wisconsin-Madison, Madison, USA. 3 Department of Ophthalmology, Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, USA. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Id4: an Inhibitory Function in the Control
Id4: an inhibitory function in the control of hair cell formation? Sara Johanna Margarete Weber Thesis submitted to the University College London (UCL) for the degree of Master of Philosophy The work presented in this thesis was conducted at the UCL Ear Institute between September 23rd 2013 and October 19th 2015. 1st Supervisor: Dr Nicolas Daudet UCL Ear Institute, London, UK 2nd Supervisor: Dr Stephen Price UCL Department of Cell and Developmental Biology, London, UK 3rd Supervisor: Prof Guy Richardson School of Life Sciences, University of Sussex, Brighton, UK I, Sara Weber confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Heidelberg, 08.03.2016 ………………………….. Sara Weber 2 Abstract Mechanosensitive hair cells in the sensory epithelia of the vertebrate inner ear are essential for hearing and the sense of balance. Initially formed during embryological development they are constantly replaced in the adult avian inner ear after hair cell damage and loss, while practically no spontaneous regeneration occurs in mammals. The detailed molecular mechanisms that regulate hair cell formation remain elusive despite the identification of a number of signalling pathways and transcription factors involved in this process. In this study I investigated the role of Inhibitor of differentiation 4 (Id4), a member of the inhibitory class V of bHLH transcription factors, in hair cell formation. I found that Id4 is expressed in both hair cells and supporting cells of the chicken and the mouse inner ear at stages that are crucial for hair cell formation. -
Epigenetic Mechanisms of Lncrnas Binding to Protein in Carcinogenesis
cancers Review Epigenetic Mechanisms of LncRNAs Binding to Protein in Carcinogenesis Tae-Jin Shin, Kang-Hoon Lee and Je-Yoel Cho * Department of Biochemistry, BK21 Plus and Research Institute for Veterinary Science, School of Veterinary Medicine, Seoul National University, Seoul 08826, Korea; [email protected] (T.-J.S.); [email protected] (K.-H.L.) * Correspondence: [email protected]; Tel.: +82-02-800-1268 Received: 21 September 2020; Accepted: 9 October 2020; Published: 11 October 2020 Simple Summary: The functional analysis of lncRNA, which has recently been investigated in various fields of biological research, is critical to understanding the delicate control of cells and the occurrence of diseases. The interaction between proteins and lncRNA, which has been found to be a major mechanism, has been reported to play an important role in cancer development and progress. This review thus organized the lncRNAs and related proteins involved in the cancer process, from carcinogenesis to metastasis and resistance to chemotherapy, to better understand cancer and to further develop new treatments for it. This will provide a new perspective on clinical cancer diagnosis, prognosis, and treatment. Abstract: Epigenetic dysregulation is an important feature for cancer initiation and progression. Long non-coding RNAs (lncRNAs) are transcripts that stably present as RNA forms with no translated protein and have lengths larger than 200 nucleotides. LncRNA can epigenetically regulate either oncogenes or tumor suppressor genes. Nowadays, the combined research of lncRNA plus protein analysis is gaining more attention. LncRNA controls gene expression directly by binding to transcription factors of target genes and indirectly by complexing with other proteins to bind to target proteins and cause protein degradation, reduced protein stability, or interference with the binding of other proteins. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Perkinelmer Genomics to Request the Saliva Swab Collection Kit for Patients That Cannot Provide a Blood Sample As Whole Blood Is the Preferred Sample
Microphthalmia/ Anophthalmia/ Coloboma Spectrum Panel Test Code D4300 Test Summary This test analyzes 48 genes that have been associated with microphthalmia, anophthalmia, coloboma and/or disorders associated with these ocular findings Turn-Around-Time (TAT)* 3 - 5 weeks Acceptable Sample Types Whole Blood (EDTA) (Preferred sample type) DNA, Isolated Dried Blood Spots Saliva Acceptable Billing Types Self (patient) Payment Institutional Billing Commercial Insurance Indications for Testing Individual born with small eyes, missing a piece of their eye or missing their entire eye Individual suspected of having a syndrome associated with microphtalmia, anophthalmia, and/or colobomas Family planning purposes for individuals with a personal and/or family history of microphthalmia, anophthalmia, and/or coloboma Test Description This panel analyzes 48 genes that have been associated with microphthalmia, anophthalmia, coloboma and/or disorders associated with these ocular findings. Both sequencing and deletion/duplication (CNV) analysis will be performed on the coding regions of all genes included (unless otherwise marked). All analysis is performed utilizing Next Generation Sequencing (NGS) technology. CNV analysis is designed to detect the majority of deletions and duplications of three exons or greater in size. Smaller CNV events may also be detected and reported, but additional follow-up testing is recommended if a smaller CNV is suspected. All variants are classified according to ACMG guidelines. Condition Description Microphthalmia is an eye disease where an individual is born with one or both eyes being abnormally small. Anophthalmia is an eye disease where an individual is born without one or both eyes. A coloboma is an eye disease where an individual is born with a piece of their eye missing.